Xenopus_tropicalis Locus Mono:23:SNORD100
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Mono:23:SNORD100
Xenopus_tropicalis
Mono:23:SNORD100
scaffold_11731
SNORD100
1001..1083
2083
TGTGGCCTGCTGTGTGAAAGAGTAATGGCAACACGTTACATTTCTGTACGTACCGGTGT
AAAGAGCGAATGCATCTGCCCTGTGTCTTTTCTTTACTTGCTTGTATGTGTGGCTCATGT
GTTTGGGGTATGAGTGAGGCATTCTGGGAAGGACGCTGTTGAATTTGTTCTTATACAGCT
AGTTCCTTTTATGTGCACGTTTAAATGTCCAGTCTCCTAGTTATAGGAAAAGTGGAATTA
CACGTAGTGATATATTCAGTGTGAACATCCTTTTGAATCTTGCGCCTATATTTTCCTTCT
ATTATAGTGTTCCTTTTATTGGGTCATTGTAAATAAAACTGGGATTTTTTGTTTGACAGG
AAATGCGGTTGTTATAATGCTATAAGTGGAATAACAAATCTGAGTAAAAGCATAATGTCT
TCAGTTATTGCTGCAGTGTTTGTGTGATGATTTTACTGTAAAGTCGGATACCCCTTCACT
CTTTCTGAGTGATAACTTCTATCTGACAAACCTGCAGCAGCCTCAGATGTATTTGTGTTG
GGTGCAACTGCAGAAGATATTTGACCAGCATTTGTTTTTTAGCATTTCTGCTGGAGGTGT
AATGGATGTTAACACCGCACTGCAAGAGGTGCTTAAGACTGCTCTCATCCATGATGGTCT
AGCACGAGGAATTCGTGAAGCTGCCAAAGCTCTTGACAAGTAAGCCTTCCAAAGTTTTGA
AATCCCTACTGCTGTGCTGTCTAATACATGGCCTTTTCTCGATGGGTTTCCAAATGTGAA
AATATTAAATGAAGATACTCAAATTGATATTTAAACTTTTGCTAATTTTGACACATCAAA
AAACTTTCTGCATCTTTAGCTTTCATGTAGAATGAAACTTGAGCATCTTGATGCTGTTAA
TTTCTTGTAGCGCATGAAAAGTTCTGCAAGTGCCAAAGATAATGTAAACTTAATTTAACA
CAAGGCTTCATTTGTCTCTGCTCCCACATATCCAGCCCACCTTTACCTATGATGAGAATT
TGGCTCCCTCTTCTGAAACTAGTGAGGAAATTGCCAATTGTTACCCAATAATCTCTGAGG
TGCATGGGGGGAATATAGCAAACGTTCTTAGCTGAACCAAATATGTGTATAGGTAACTCT
TAGATCTTGTCACCTATCTGACAGATAATGTAACTTAACTATACATCAGTTCTAAAAAAA
CGGTAAACTACCTTTAAAGAATAAGTAAACCTTATTTTAAAAAACTCAGAATAACCGCTA
AGAGCTGTGGTTGAGCTGCTTGTGATAAAAAAAATAAAATGGAGCTGAATGTAGGGAGAA
AGGTATGTTCTGGGGCTTTTTGGGCTCAAAAGACATGCTAAAAACTACTTTAAATTTTTT
AACATGTATAGTCAAAGTGAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved