Xenopus_tropicalis Locus Mono:7:SNORA21
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Mono:7:SNORA21
Xenopus_tropicalis
Mono:7:SNORA21
scaffold_571
SNORA21
1001..1133
2133
CTACCTTTATACCCCATGGGCTCCGCAGCCCTAACCTCTTTAAACCCTACTTTCCAGGT
TGCTATATGCAGGCATTTCACCGTACGCCACAACAATTGTACATTTAAACCTCCTGCGGA
CACACAGGAATCGCCTTTACCTGGGCAGTCACGGCGTGTTATGGCGTAAACAAACCCACA
AATGGCGCAGGCGCAGTCTCCACCACTTTAGGCCCCGCCCTTCCTCGTATATCTTGGTCA
CATGGCTATGCCGTCATCCGTCTGTTCCGGCGCCTCCAATCCGCAGGCGATGTCACGTGA
TCTCGCCCCCTTCTCCCTCCCTTGCCTGACTTGCTGCTATATCCCAGCATCCTTTGCGCC
CGCCTCTTTCTCTTTCCGGTAACCAAGATGTCTAAGAGAGGTGAGGGCTGTGGGCCTGTG
ACTTAAATCCGTTGTCATCTACCGACTTGTTGTCGTTGTCGGTGCCTGTAACTTGCGGAG
GGCGCTTGCTGATCCCTGTTCTTTTCCCGGCTGTCAGTATGGCCGATGCTGAAAGGCAGA
GAGGGCTGTGGAGATGTCTTATATACAGCGGGAAGCTATAGCTGACGTCCCGGGAAGCCA
TGTTTAGAGTACGCTGGGCTTAGCCCCTCTCTCTGTAGTTTTCTAATTAGTGCAATAGTA
TATAGAGTATATTATGAATGTATATATTTATAGGTCGCAATCATTTCTTTCCTCTTCTAT
GTAATCAGCCAGGCTGTACCATTACTGTACATTTGGGGGGGGGGGGGATATAGTATAAGG
AGAGAGTGCTTGGTATGTCCCTGTACCCACCTCTGTCTCTACTGCCCAAGGCCCATTACC
CCCAGCCTTTATCTGCATGTGTATGGGACTCCCACAGATACCCCTTCCCATTAGCCTTAC
CATTTGTTTTTTCATTTTTAAACCCTGGGAGTACATTGTTGATGTTGAACTAGAACTTGG
CACACATATATATATATATATAACAGGGGGAACAGGAAGCCCCTCTTCTTAAAGCACTTG
CAGTGTCTGCTCGGTGGCACGATGAGTTGTCGTGGAAGAGGATAGAAAGACATTGCTTTT
GGGTGAAGAGGCAGCTACATGTGCTGTTCTGCTTCAATCAGTGATGTGACACAAACTGAG
CTTTTATAGCTGCTGTGTTTCTCTCAAATATTTCCTCATTTTTTCTTATTTTAGTTGGTT
GGTTTCACTGTTAATCTAATCATTATTAAGGACGTTGTTGTGAAACTACTAAATGTCCAT
ATCCTACCCATGTATATGTTATATTACTGGCAGTACAGTGTCGCTATTCTGACTGCGGTC
AAACTGCAATGCCTCTTTACTAAGGCACAGTTAATGGAACAGTATCCAAAAAAAAACCTG
ATCTGTTTGCTTCAGAAATGTTACTGTAGTTTATATAAACAAGCTGCTTTGTATCAATGG
AGGCAGTTAAAATAGGGCTGAATGGCACAGGTTACATAGCAGATTGAAGATAAACTCTAT
ACAATATAATGGTATTCTACAGAGCTCATCTGCAATCTGCTGTGTAACCTGGGCCTTTTG
GCTGCCCCCATGGCTACACAGCAAGGTAAATACCTTGCTGTGTAGCCATGGGGTACAAAG
ACTCCTTTGTAGTCACATTGGGCTTTAGGCAATGCAATCCTTGCATGGGCCGGAGTACTG
ATTTAATGTGCCTGTAGAAGGATCGTCACCCCTAGCCCAGCATGACCACAGGAAGTTTTG
TTCTAATATCTGTCCACTTCTGCTAAGCTGGTACCACTGGGCTGGGTGTGGTTTTGGGGC
ACTTCTGGCGGAAATATTTTGGTACTGCAACTCTAATAATAATGACACAATTCTATGGAT
TTTTATAGGGAATTGTCTCTCCCTCTCTCACCTGCATTCCTGGAAATGTGCTGCTGCCTT
TCCTAATGTTGCTAATGACTTTCTCCTAGGTGCAAAGAATTTGTACATAATCTCTGTGAA
AGGCATCAAGGGTCGCCTGAACAGACTGCCGGCTGCTGGTGTTGGAGACATGGTGATGGC
CACAGTAAAAAAAGGAAAACCTGAGCTGAGGAAGAAGGGTAGGTGGAGTGCGCATACAGG
GGGCAATAGTCATCTCTGGGAGCAGTTGCCTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved