Xenopus_tropicalis Locus Poly:4:snoR38
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Poly:4:snoR38
Xenopus_tropicalis
Poly:4:snoR38
scaffold_178
SNORD65, SNORD65, SNORD65, SNORD49, SNORD49
1001..1072, 2095..2168, 2458..2529, 3056..3129, 4662..4735
6212
AGTAAAATAGCCACACTACTCTAGGCCCATAACATTTACCACAGCACAACTTCAGCTCT
TTCTCACGACTCACCACAGCGCTAAAGAACTACTATGCACCGCCTACAGTCTAACTCCAG
CCAATCGAATACAGCGGTGGGCTGAGCGCATGCGCAGTCGGACGATATCGTAAGAAAAAA
AGACTACATTTCCCGGCATGCTGCGCGTAGTCTCGCGAGATTTCGCCGGGTCGGGACGGT
ATATATAATGATGTAGCACGGACGGAAGTTCTTTCATTCAGTCATGGCTGAAGCTACTAG
GTAGGTGAAACGGGAATCCAATGCCATCCTGTTTGTGCGAGGCCGCCTGGGTGGTTGTAA
ATATAAATGTAAGATTATTAGATCGTGTACAAGTCTGACTGGTAGGGTGGGGCAGTGTTT
GTGTAGATGTGGGGTAGATATAAAGGAAAGAAATGCCATGCTCAACTCAATACAGTTCTT
AGCAGTGCAACAGGGCCCCTCTCTCCTCCAGCCTGGCCTCCCTTTCCCACAATGTCGTGC
GTAGGGTTCTTGCATTTTAAATGATGATCAAAGCATGTAAGGCTCTGTGGCAGTTGAAGT
CTTGGCCAGAGGAGAGCTGATTATATAGTGGTTCTATACAAAATAAAAGAATGTGGTAGA
GGCCTGTCCTTCTGCCAAGGCTACACTTAGCCTGTAAAGTTATATTTATTATATGTAATT
AAACTTATATTAAGTGGATGAAAGACTAACCTTAACCAGGGTTAATGCTCCTTTTTCTGT
AGCACAATGTATAAAATCTGGCCAATTGGATTTGTCTTCTGTAGATGACTACAGGCCAGG
ATCATGGCCACAGTCTTGGCAAAATATTGTATAACATCACCCTAACTAGATAAACTTCAG
CATCTGACTTGGAAACATGTGCAATGGAAGCCATTAGGCAGCAGTTTTATCCCTACAACA
TCCATAAATAGACATTTTTTTTTATATATAGTTATTGTGCCTTATGATGAAGTGACCATA
AATATAGCTGGAATTACCGGCAGACTGTAAGTGGTGATATTGGTTGCTCTGAGGGCACCC
TAGTGTAATGGGCAGATTTCAGTAGTTATCTGTGTAACATAAAATAAACCTTAGCAGCAT
GTTAGTCTGGACTTACTACAGGTAGGGTAATGGGGCAATGTTAGATCCTAAGGGGCTTCT
GTAATCACTTAAGGGATGCATTAAATCCATAACATGGCATTTGTCCTTTTTTACAGGCCA
CTGCCTTGTCACGATGGATCCCCTGAAGGAGTGATATTAACACTATGCGAGGTAAGTAAC
CCATTAAGGGAGAGTCATAGTGGGGGTTTGTAAAGATAAGTTTAAGATGATTAAATCATG
TACAAGTCTCACTGGTAGGCTTGGGCGGTGGTTGTGTTGATGTGGGGTAGCTATAAAGGA
AAGAAATGGCATGCATGTTGTCTTTAAAGGTGTATGGTCAGCCCTGTACAGGGAAAACAA
AATCAGGTCGGGCAGAATGCGAACATTAATTCCAATTAAAAGTAACCTCTGTCTGTCCTC
TAGACTTAATACAGTTTGCAGTAGTAGTGCAGTAGGGCCCCTCTCTCCTACAGCCTAGCC
TCCATTTCCCACAATGCCTTGCGTGGTTTTCTTGCATTTTAAAGGTTAATCAAAGCTTGC
AAGGCACTGTGACAATTGAAGTCTTGGCCAGAGGTGAACTGATTATATAGTGATTCTATA
GAAAAATAAAGGAAATGTGGCAGAGGCCAGCTTTCTGCCAAGGCTGCTCTTAGTCTGTAA
AGTTATATTTATAATGTTATAAAGCTTATATTAAGTGGATGACCTTAACCAGGGTTAATG
CTCCTCTTTCTATAGCACAATGTATGAAATCTGGCCAATTGGATTTGTCGTCTTTTGATT
ATTACAGGCCAGGATCATGGCCACAGTCTTGGCAAAATATCGTATAACATCACCCAAACC
AGATAAACTTCAGCATCTGACTTGGAAACATGTGCAATGGAAGCCATTAGGCAGCAGTTT
TATCTCTACAACATCCATAAATAGACATTTTTTTTTTATATATAGTTATTGTGCCTTATG
ATGAAGTGACCATAAATATAGCTGGAATTACCGGCAGACTGTAAGTGGTGATTATTGGTT
GCTCTGAGGGCACTGTAGTGTAATGGGCAAATCTCAGTAGTTTATTATCTAACTTAAAAT
AAACCTTAGCAGCATGTTAGTGTAGACTTACTACAGGTAGGGTAATGGCTGTTAGATCCT
AAGGGGCTTCTGTAATCAGGTAAGGGATGCATTAAATCCATAACATGGCATTTGTCTTTT
TACAGGCCACTGCCTTGTCATGATGGATCCCCTGAAGGAGTGATATTAACACCATATACA
AGGTAAGTAACCCACTAAAGGAAAGTCAGTGTAGCTTTGGCTTTAAGGTAACTGTTCCCT
GTGATGAATTAACCTGAAAAATAGCTGGAATTACCGGCAGATTGCTGGTGGTGATATTGG
TTGTCTGAGCTTTGTATGCAAAGGGTAAATTGGTACAGTTCACCCAGGACAGAGTTTTGA
AGTTTTCATTTTTCTTTGCAGGGTTGACTTTCTGCATAGTAACACAGGTAAGTGTTTGGT
GTGTGTGTCTAAGCTTACATTGAACATCGTCGCTGGTAGATAATTTGTGCACTGATCATT
GTAGAGCAGCAACACTCTAGCTAAGGTAGCCTTATGAGCTCCTCCTGTACAGTGCTCTGT
TCCATTGGCTCTTGCTCCAAAAGGAGATCAGCAGCTCCTACACTTTTGGCAGGCTGGCTA
AAAAGTGTCTAATGTTAAACCTCTCCACCAGCATTACAGGGCTAGCAGTCTGAATATGCC
CAAACTGGCCAGGCAGTATAGTCAAAATCTGTAAATTTATGACCAATCTTTAGCATGTAT
AATCCACACAAGGCTACAACGGTGTATGAGCAGTGTTACTGTATTGGTAACCTTGTGCTG
ATCCAAGGTGGGTCACATACTATAGAGTTCTGGGTTAGGCTACTGACTAGTGCCATGAGC
ATGATGAAACCAGGATATAGGAAGTGCCGTCAGATGCGATAACTGACGAGAACCTTTTCC
TGTTCTGACTTTAATCTGCTTTTCCTTCCCCCCCCTTTTTGTGAGATGTATCACTGCCTC
ACTCATACTTTCTGTTGCAGGGTAATCAAGCAGCAGCAAGGATGTAAAGAGACCATAAAC
TGGTAGGTATCATTTAGCTGTAGTGATAAGGGGTATAACTTCTATTATTTCTCTATTCCT
GCTTGCTTTGAGTCCTGTACAGTCTTTCCTACAGCCTGTGATGTTGTGTTATCCCTGTCT
GAACTACTGTGAGGGACATTTCTTTTTAACTGAGGCTTTCTCCTTTGATGCTTAAAGGGA
ATGTTTGTTAGGATAAATAGGAAATATACTGCTTATATCAGCCAGTTGATAAAATGCTCA
TGCCCATGGAGGCAGCTGCAGATATTTAATCTGTTTTGAATGCTGTGTGCCTTGATATTT
GTGCCAACCTTGCCAATACAGCAACATTGGGAGTATACCCTTTCCTGTATATTAAGTGTC
ACTACCTGACTTGGGGTTGGGTTTTTCACTGCTAGGTATAACCCAAATTTCTAGTGCTGG
CTTGCTGCTGTTGGCCTTAAGTCTGAGTTGGGCCAGAAGTACTTTTTTTTTTTTTTTTTT
TTTTATTGAAATATGTGAGCAACTGAACTAGTATTAGTCTACATGCTAGTTGTAGTACAG
GCATGTAACAATATGTTGGCCTGGATTTGCCGTTAACTTGTCAGAACTGTTTTACAGGGC
TTTGCTGTATGATGAAACCACTGAAGGAGGTTACACTCTTAATACCAGGTAAGTCGGAAA
CTTGTGTAGTGGAAGCCAGTGGGCAGCCATTTTTCCCATAAACATCTTTTTAAACATAGC
ATTTTATGGCTATTCTGCCTTATGATGAAGTAACCATAAATATAGCTGGAATTACCGGCA
GACTGCAGGTGGTGATACTGGTTGCTCTGAGGGCACTATTGTGAAATGGGCAAATCTCGG
GTGTGTTAACTGGTAAAAGTATCTTTTGAAATAACTGCAGCCAACTGGCTTTAATATAAT
AGAAATATAAGCTATTTGGGCAGCTTATGACTGCAACCCTTGTATTGTGTGGTGATGCTG
GCTCGGATTTGACATGAGTGCTGTTAGCATTAATTACATGAAGCTAACCTAGAATAATTT
AAAGCTGTAGTATTGCATCTACAACATGGGTATAGTTCTGGTGGTTAAAGGTGTTTGGTT
AAGTATTTCAGTGGGCTGACTTGTGGGGCAGTTTGCTGTATGAACCGTACTTTTTTTTTT
TTTTTTTTTTTTTTAGGGATGCTTACCCTGACCTAGGGTATTACACAAAGAATATTGTGT
AACAGTCATGGCGATGTTCAGTGCACCCACTCACATAACTTTTCTCTTCACTGGCCTCAG
TTTGGCTAAATTGTGGTGCTCCCTGCATATATGGAAAACTTAAAGGTAAGCCACTAAAGC
TGAAGAAAATGTGTACTCACTAGGGGCACTCTGCAGGCATTCCTTATCTTGTTGTTGGTG
TCCCTACTTTTGCAATTCTGGTTACTATGTTGGCCAGAAAGTAAACATGATGAAATCTGG
ATATAGGAAGTGCCGTCAGATGCGATAACTGACGAGAACCTTTTCCTGTTCTGACTTTGT
AGGGCAATTAAAGCTCCATCTAAACTTTATTTTGGCAGTGGTGCAGTGTCCCCACCCATA
TACTACTTTACCCCCAAGTACCAGCACATGTATGTGCTCCCCTAGTAATGAGAGCAGTGC
AGAGCTTTGCACTGGCTGCACTTAGCACCTCTCGTGCTCTTTGCTGCTTTTCTAATTGTG
AGCTGGCCTGTCCCAAGTTTATTTAATTTAGAAATTGAGTATTTACTTGTGCATCACTCA
TCCTTTCTGTTGCAGGTAAAACTGGTAGTGACTGCAAGAAGGCTGGAAACCTTTAGAGCC
CATAAAGCGGTAGGTATAATGTTAAGGAAACTTCTCAGCATTCATCTTCCAGTTTGCTTG
TGAGGGATGCTGGGAGTTGTGCCTAACATGGCCATTCCTGTTCTACAGCCTGTGATGTTT
TGTTATCCCTGTCTGAAATCATCTGAGGGAAAAAATTTTTTACTGAGGCTTCCTACATAG
TTGGCACGCTTCCATGCAATATTACCCAAATACTGTGACATTATTTTGGCATTTGGATTA
GTACACTAGCATTCATTTGGTTATTTTTTTTTCTCACCAGATCAGTATTCATTACTTCAA
GGGATAAAGTGCAGCTGAAGAGGACCCATCCCTGAATTGTTACATTACTGGAATGACTTC
TGCTCCCTTGGAAGTTTGGCTTCAATATGTGCCCTGTTCATCATAGCAAGAGACTGGGTG
GAAATGTCATTGCTCTTCAGTTTCTCTTGGGTATCTGTGTTTTCAGTTTTGAGTAATTTT
AAGAACTGGAAATCCAAGCTCAAGAGTGCCTTGATTTGCTGCTTTTATACTTGGTTGTAG
CAACACTGCATAGAATAGTAGTTTTACTGTTTCTTGCTCGCTGCCTTTGGAGTGTTTCTT
GTCTTTGATCATTGTGAAATCTCATATTCTGGTCTGGAGACACTGCCTGTTTAACTGTAA
TAAATGTGAATCTTTATAAATTGTCTAGTTTTTATGCTTTTAAATAAAGGGGCTTATTGT
ATATTTTAAATCACCTTAATTTAGATTAAACCAAACAATAGTTGATTTCAGTCGGTGCTT
CTGAATGCCACCGTTGCAGCTTCCAAAGAATTTCTAGTGCCTGGTACAGTCCAAACTCTG
CACTGCTCATTTCGCCACTTGGCATTTGCCTCTGCTACCTACCCTTACTACTACAATGTT
ATGTACACTGGCTTATAAAAGAATCAGCATAGTGGAGTTGGGCATAGCACCCAACAAGTT
GTCACCACCAGTGGAATACACCCCTTTATTTTAAGAGGGTGGAGGTGAGCAGTTTCTTAT
TACCCATGTTGGGAGTTTGTTGGCCAATGTAACATTACAGGGGTTAAACCTGAGCACAAA
AATTAGGCCGTGAGAATGGAATGAGTACTATTTGTTGTTAAGCGAACAAGAGTTAAGGAA
TTCAGAATTTAAATAGCACTCTAATCTCTGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved