Xenopus_tropicalis Locus Mono:3:SNORA63
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Mono:3:SNORA63
Xenopus_tropicalis
Mono:3:SNORA63
scaffold_319
SNORA63
1001..1131
2131
CTGCTCTGGTAAGACTTTAAACATTTGCTATGGCTGGGCTGCTTATAAATGCAGGATAA
GTTACAATATAGCTGGGCAGTGCTGTGTTGTCGTTCCCCCTGCAAAAAATAAACTGCTTC
CTACTATCCCTGTCTGTTTTGACACTACCTCAGCAGACAGGGACGCTTGGTCTCAAACAG
TGATTTTTTTTTTCCAATATAAATATAGTAATGTACTTCAATCTGTTACAGCATGGTGAC
ATGGACCAGAAAGAGAGGGATGTTATTATGAGAGAGTTTCGTTCTGGATCCAGTCGTGTA
TTAATCACCACAGACTTGCTGGTAGGTGTTTAAATTACATGCAAACCTTCCTTGGTAAGT
CTGCACAAAGTTATGCTTTGCTGAAATAGGCTACAGGTGAGACACAAATGTGCACTATTT
AAGTTGTGGGCAGAGATAACTGAATGCAGCATATTACAGTAATGAACATTCCTTTAAATC
ATCTGTTAATCATTTTCCAAAGACTTAAAACATTTTCATGATGGTTCCTCATACCAGATG
GAAAAAAGTCATTTGGTATATTAAGACCCACATTCCACAGTGGATTACAGTGTTGTAATC
CACCACTATATTGTGGCTGACAAACCTTTTCTCCTCAAGCCAGTGTGAAATGGCAATTTG
TGCCTTTCAACAGGCTTTATAAAATACATGAAATCGCAAGTAGTGTAAGTTAATGCATTT
TATTATACCATTAGGCTCGTGGCATAGATGTGCAGCAAGTTTCCCTGGTTATAAATTACG
ACTTGCCTACCAATCGTGAAAACTACATTCACAGGTCAGTGACTATTTGAAATCTAAACT
TCTGCTGTTCTGCCTCAAATGTTTGTACGAATTTAACTAGTAACAATGCACCCTTTCCTA
TAACACCATAGGATTAGCTGGTGCCAAAGCATTAAATACCCTTCCAAAGTTACATTATGG
CTGCTTTGTGATGTAAATTTGTCTTTTGGAAGCTGCAATTTCTGCAGGATTAGTTACAAT
ACATCTGTGCAGTGCTGTGTTGTCGTTCCCCCTGCAAAAAATAAACTGCTTCCTACTATC
CCTGTCTGTTTTGACACTACCTCAGCCGACAGGGACGCTTGGTCTCAAACATTCATGCCA
TACTATTGGCAGTTGAACTGTAGTCATCCACAAAATTTTTACAAACAATTTTATGTTTAA
ATAGTTAAGGAGCAGAATACAGCTGCTCCCGGACACAGCTGAGAATGGGCCTATGGAAGT
GGCGTCTTTCTCTTGATCAGAGAACACACACTTCCGGTCGTGGTCTGATGGCAGCCAGTG
GAGCATGGATCAAATCTTTGTAAAGGTAAAACATTTTGCTTATTTGAAAATGTGCACTTC
AAGCACAGTACCTAGAGGTATTAATGCCTTGGCCTTTATCAAAATGGCAAAGTTTTGACT
TGTTTATGCATTTAAACACTTGAGAATTTACACTAGAATTTTGCCTTTGTTTACATTTAT
ACCTGGTGGGGTCTCTTCCAAAACGCTTCCTGCCACTTGGGTCTTAACTCAACAAATCCT
ACACTTCATTACATAATGAGGACAGGTTTTAGAGGGTAAATGGAGGTAGCTTTGATAAAG
CCATAAGGTAAAATCTCATGTATGCTTTGCATAAGAAACTGCAAACATGTAGTGTAATTT
TGCAGTCTTCCTTTAAAATCATTAAATTTGAATATCCATTCTAGCTCAGTATTAGTATGT
TGACCTGTTAACAATGTTTAGCTGTAGTAAGCTTTGTAAGTGTATAGTCCTTACACTTCC
AAGACATTCTGATATAAAGCATAATGTGTTGCATGACACTTACGGCTACCCTTATTTGTC
CATGAGCACCTCCATTTCTTTCACAGCACAAGCTCTGGTACTGAAGCTTAGAGACCAATC
AACAGAAAAGACCTATAATTTATTAGCCTATATTGGGCATATGGTGCAACCGAACCTATT
CATGTTTGGTTCTTGTGAGGCAGAGCCTGTATGTTTTTCTGTAAGGTAGGATGGAGGGAG
GTGTTTTTTTAGAGAAGTCTCCCTAGTAAGTGAAAGCAAAACCATACTTTTTAAAATTCT
TTAAGTATACTCTTTTGCATAGTTCAATTTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved