Xenopus_tropicalis Locus Poly:5:SNORD35
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Poly:5:SNORD35
Xenopus_tropicalis
Poly:5:SNORD35
scaffold_447
SNORD35, SNORD35, SNORD35
1001..1092, 1680..1763, 1945..2035
3035
TTTGACACTTTCCTTTCCTAATAAACATACTAGTTTGGAGATTGGTAGTCCACTTATTT
TCAATTGATATTGTGACAATTTTGTTCCCCTGGTAATAAGATTAATCCTGCTCCCACTTC
TTTTCCAGGACCTGATTCTTTGAGGTAGAGTGCAGCTGGGATATACCCCAAGTGGCAAGG
TAAAAATGTTTATGCACCTTCATGTATTAGGGCTTGGATTGGTTACTGCTATTTTGCAGC
TACCTAATTTGCTGTATTGCCTGTGAAATGTCAGTGATGTTTTTTTTACCTACATTGTTT
GATTATCTAAATGAAAAACATCTTAGACTGAGACATTCTTAGTGTTAAAGTGATTGTGTA
TTTATATTATTTTTTAGTCTTACGGTTTTTGTTTTGCTCTTTTCCCACCTAGTCTTCTGT
AAAGGAAAATGGTTGAATAACAGGTATGTAACTTTTCAACCATTTTTTCACTGGGGGTGC
AAATGTCTGGCAATGCCCAGTAAATTCAGTCACTAGGCTGTGAGGTGGGTGCTTAACATG
CCCCCCCTCCTGTGAATTTGGGTATCCTTTAAAGGTCTAGAACAGGGAACACAGTATGTT
TCTGGAGATACTCTAAGCAAGAAATGTATCCCCCCCCCCCCAACACTGGCTGCAAGATTT
TATCCCTCCCCTAATTGCAATGGGTGTCCTAGAAATATTCTCATATGCTAATAAGTCTAA
TGTGAAATTTGCTCAGTTATTAATGCAAACCTAGGGACTTGTATTCCCCCACCCTCTCAA
GCAGCATAAGATGGCAGTACCTAAGCTCGGACACTTGCAAGATAGTAACACTTGTCCTTG
ATTTCTTCTTAGAAGTTTTTATATTTATGCTTTTTTTGTCTAGTTCTTCTACATGCAGTT
AATTCTGCAGCATGAATAACTTTGGAGCCTGTTCTTGTGGAAATCCTGTGATCTTTCAGT
AAAGGTATGTTTGAATCAAACAAGATCTGAAAATGCTGATGTGCAAATGATGTTTATACT
CACGATGGTCTTCCAAGCCTCGTGGTGAAGAGGTTTTGACGAAAGTGCCAGATGGCTTTG
CTGATGCTTTGCATAATGTTGGCTGAAATACAATGTGTATGATATAGTGACTGATCACTG
TGTGTTCTTTAAAGGTTCATCAAGAATGACTAAAGCTGCCGTGCAGTGAAGCATCTGCCT
GGCACTACATAAAGGTGAATATGCTGAAGGGGAATGTTCTGTCTTGTACATGGATTGTAC
CCAAAGAGGTTGGGTGTTAATGGAACGTGCTTCCTTGTGTCGGCTGTAGTTCAGTATAAA
ATATTTTCAAAATTAACTTTTTGACAGCAGCTGTCCTGTTGAGAAGCTTTCAGTTTGTAG
TAGTGGCATTTCATCCATGGTACTTTATCCCTGGTCTTCCTTGGACCAATCCACAACTTT
TTTTTTTTTTTTTGTTTTGTTGTACAGACTTGCTTTTTACCATAGCTAGGTGTTTGTTCT
TAAAATAGATTCCTTTCCTCACTGCCCCCTAAAGTTTTTCTGTTTCCAGAAGCAAGCTCT
GGCTAGTAACCATAGTCCTACAGTAGTTTCAGCTATGTACAACTGATGCATGAAACTGCA
TGTCTCTTGGCTACTGACTTTGTACTGTACCAGTTCTCCTGTAATGTCTTCCCTTAAGCA
GCAATATGATGTATTTTCTCACGATGGTCTTCCAAGCATTGATGCTTTGACGAAACTGCC
ATTTGGCTTTGCTGATTGCTGAGCTTATAAATGTAGAATATTTACTGTTTTTTTTTTAGT
AGTTACATTTTTTTTTTTTCTTTCCACTCTAGTGCTTCTGAAAGACTCCTAATGTCATCA
TGATATGAGCCTTCAGTAAGAGGTATGTTAGGATATATGTAAATGTTAACATTATTCAAA
GGACTCTAAGCAGGGGGCAGGGCTCTGCAAATGATGTTTACTCACGATGGTCTTCCAAGC
CTCACTGGTGAAGAGGTTTTGACGATATTGCCAAATGGCTTTACTGATGCTCTGAAGTTT
GACAAAAAATTCATAGGTTTCTGTTGGCAATGCAACAATTCTATTCTTATTTTTACAGAT
TAAGTTAGAGGAAGAATTGAGAAGTACTTCTGTTTTACAAGGTTAGTTATGAATTTAACA
TTCAATCTGCTATGATATGATATAAATGTGATTGCACTTTGTCCTTACAAAGTGTTCTCT
GCTCATCTGGATACTTTTTGGCTTAATGATACTGGCATGGTTGCACTGTATTTGGGCAAC
CATAGTTGAGTCAATCCTCTAGTGGCAAGTCATTTGGCAATAACTTAATTTCACCACCAG
CATGAAAAGGCCAATTGTGTTGTGTAGTTGCTTAACACAGGCCTGTCAGTGTGCAAGGTG
AGTTTTTGCCAGAAACCTTTTTGCATTTTCTGTTTTAAATCTACTTTTCAGTGAACAGAA
TAAATTAAATCCTCACAACATGTGGAACAAGTTCAGACAAGATCAGCCTCTCTGCTGGTG
AAGATGCAATGTGTGCCATAAGCACTTGAAATTGCTGATTTACACTAGACAGGGATTCTC
CTGCTCTCTAAGAAATTTCTTCCAGTTACAATGTCTGTTAACTATGATGAGTCTATCCCG
AACCTGATTTGTGATGACACTTTCTTATGGATCTGACTGCTGAGTTTAACTTTCCTATTT
TATACCCTGCAAAAGCTATATGCTGTACTTCTTTCAATTTAGAAATATTATTTTTTGCAG
TTTAATGAAAGACTCAAGTTCCATGGTCTTTTGCATACGGTGAGTTGTCACTTAAATTTT
ATTTAGCATATTTTATTAAAGGAACGGTAACATCAAAGTTAATGTGTTTTAAATTAATTA
AAATATAATGTGCCATTGCTCTGCAAAAAACTGAATACAGAAAAGCTACACTATAAATAA
GCTGCTGTGTAGCCATGGGGGCAGCCATCCAAGCTGGAAAAGAGAAAAGGCACAGGTTAC
ATAGCAGATAACTAGTAGATAAGCCCCATATAATGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved