Xenopus_tropicalis Locus Poly:2:SNORD12
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Poly:2:SNORD12
Xenopus_tropicalis
Poly:2:SNORD12
scaffold_48
SNORD12, SNORD12, SNORD12
1001..1090, 1301..1391, 1708..1799
2799
AATGCAGACACCAGAAATTACTATTTTTTTTTAATTAACATTCTTTGCTTGAACTGTGT
GAGTTTGCTTTAAAAGTGTTTTCCTGATGCTTTTGTTACCTTTCTGATCCCCCCCCATGT
TCCTCTGAGGGGGCTGCCATATCTGTGCCGCAGAGGGTTAGCATTAGTAGATATAACGGG
CAGAATGGGAAGGGACAGTCAGGTTAGGAACTTCCAAGTAACAATAACATAAGGTGGCCA
TACATGCTAAGATCTGCCTGTTTGGTGCTGTCTCCAAGTGAGCAGATCTTCCAATATCCC
CTCATACGGGTGGGCAGTATTGGGCTAATTCGGTTGTTTGGCCTTGGGACCAAATGATCA
AATTAGAATGACTGGTATAGGTGTCTGTCGGTTCAACGAGTTGATACAGTCCCCAATCTG
ATTTTCAAACCTGCCATATTTCAGACCAGGTGTTGGTCAGGCAGGCCCGTTGTTAGTGCC
CATACATGGGCCGGTAAGCTGCTAAATCTAAGGGACCCGTATCAGCAGCTAGAATCGGCC
CCAATGGGTATGGCCTCCTTTACAAAAGCAAACCTGTTGGTTTTTCTTAGGTAATTTTAT
GTAGCTTTTGTCAGTATCCCTTTAATGCAAAGGATTTCTGTGAGTCCCAGAGACTGCTGT
GCTTTTGCCCTCTTGCCTGCCTGGGGTGTATGGTGAGTGGAAATGGGGTGCCAATGTTAA
TGTCTGTTTTAATCTGTTTGCAGGAAGTGGAGCGTGCCAAGGAATGGGGCACAGGGTGTG
CTTGTCACTTGCTCTTCTGCAATCAAGTGAATGTGCCCTACTCGGTCATGGAGCACCTCT
GTGCCTGCGGCAGGGTTTGCCAGAGCTTGTGTGGGTGACTGAACCCTGACTGGAGAAACT
GTATAACTAAGGTAAGTTGGTCTGATGCCTCTGATTGCCCATGGTATTTCTACATGGCAG
CAGAGTTGCTTTTAGCTTCAAGTAGCAAATCTATTGCCGTGCGATGTCTGTATGATGACT
AAACTTTTTTCCCCAGCAGATCGACACTGTTGACTTGCAATGCTTTTAAGCCAGTTTTGT
CTGATACATCGGCAACAGATTTTGTTGCAATTGACTTTCCTTACCTGATTGGGAAATACT
GAGCTTTTTCTTTCTGTTTAAAGGGAGATGGCAATCTCGTGATTCTCGGCTGAAGACTAC
ATTATGCCTGTGTGGAGTCGGCATACACGTCTATGGTAAGTGCTGCAACTGTTCCATTAA
CGCAAACCTTCTCTACTTACTGCTGCTGGTCTGGGCCTATTGCTGACATGCATGATGACC
AAACTTTTTTCCCCAACAGATCGACAGTGTTGACTTTGTTGCTATTAAGCCAGTTTTGTC
TGATATGTCTGTAGAATAGCCCAGAATTAATGCAGTCTCTATACTATTAAATAGTTAAAA
TGGATCTGTGATTTTCATGGCTCATAGCTTAATGTTCTTTGAGACTAATCGGTTGCTTAA
GTTCCCTTGTGACTGGAGAATGTCCATACAGAATACTGTGTTCCACATGGCTTTCCTTTC
TGTTGCAGGTTAAGTAACAGCAATTACCTGGACATGGGAGTGGTGCCACAGAAACAATAC
AAGGGATGCAATATGGGTAAGTTTCGGAATTGAGTGGGTTGTATATATTGAGCTTTATAT
GGAGGCTGCCCCTTTCTCCAGATCCTGCTCTGCTGTATGTGATGACTAGACTTTTTTCCC
CAGCAGATCGACACTGTTGACCATAATCTGATTTAAGCCAAACATTGTCTGATACACAGA
ATAGATCTGAGTTTCTAACAGACTTGTGCTTTACTATGTACCTTCTGGCGCTAAATGAGT
TTTCTTTCTTTGCAGCTGTACTCCTGTACAAGGCAGAAGGCTGAAGTTGGACAGTGGTGG
TTACAATTATAAAAATGGTTGCAATTTGTAAATAAAATTTTATATATTTTTTTTAAAGTT
GGTTTTGTCTTAATATCGGCAAGTTGCTTGTCTGCAGAAATTTAAGGCAATATTGTTGAA
CCTGTTAACAATGTTAATAGCTGCTGGGCTTTTACGGCTGTTATAGTTAGGGCAGAATGC
TTTATTTACTTGTATTACTTGGTCTTAAATTCCACCTTTTTCCATAACTTGTTGCTAAAT
TAGTATTACAGGCCTGATTACTGTTGGCCCTGTGGGTACTCAGGACTAAGCAGGGCTTAG
CATTTTTAAAAATGGTTATGCCTTAGTCCCAGTTGAAATGAGTATGGGGGTTGGGTAGTG
TAAAACATTTTTATAAGGATATATAACATTAATTGAACATGCCTGGTGTCCAAAGGGCAC
TGTGCTTGCAATGTAGTCGGTAGCCTTAGCAGGTAGCCATTTGCTAGAAAGCATTGCTTT
TTGACTGACTTGTCGCTGTGTTCAGGGCTTAAAACTGGAAGGGAATTTGGTGGGGGTGGG
ATAAAATGACATAATTGTCTTAAGTTTTATGTCTTGGACATTTTTGGAATCAGTAGTATA
AAGTTATAATTGCTGACCCAATATGATAGGGGAAGGCGTTCCACCTATGTAGATGGGCAC
AATTTGTATTTCCTCTTGAGCCAAGCTTTGCTCCTACAACTAGACTCAATTTAGCCTTGT
TGGGCAATGTACAATTGTACAATTTTTCGCATGCATTGTATAAGTGCTCCAATCCTTTCC
TCAGGGAGAACAAAATACTTAATTGGAAACCACTTTTCAGCAAAGCAGCGAGTGGAAGTT
GAAATGGTCCCATTGCAGCACTTGCCAGATCCAACTTGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved