Xenopus_tropicalis Locus Mono:14:SNORD42
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Mono:14:SNORD42
Xenopus_tropicalis
Mono:14:SNORD42
scaffold_817
SNORD42
1001..1066
2066
ATGTTGTTGAAATGGTAAAGAGCTGTTTGTATATTTTATTATAGACCAAGATAACATCT
GAAAATAGAAAATCCATAAAACTCAATGTATCTTGCCATTAAAGAAAGCATACTTTCGTG
AAAAAAATAGTTTCAGAATCATTAAACTTTTATATTAGAATGTATAGGCAGGGCATTGCT
TAGAGAAGCGACCTGAGTAAGTTAGCGTCAGTTCATTTTCCTTTTTTTGTAAAGGCCACA
TTTCCGATGTGCTATTGCAAATATAGTTCCTGATTAAATTTGACAGATTATCATAAATTA
AATGCTTTGTTTGGTGTTGCCTTGACAGCTAAGTATTTTTTTTTTATATTTTAGGCTTGA
TCATTATGCTATTATCAAGTTCCCACTGACCACTGAGTCAGCCATGAAGAAGATCGAGGA
CAACAATACTCTGGTTTTCATTGTTGATGTTAAAGCAAACAAGCACCAGATCAAACAGGC
AGTGAAGAAACTCTATGACATTGATGTACAAAAAGTGAACACCTTGATCAGGTGAGAGAT
GGCAAGATTAATATCCTGTATCGGTGCTTAAGTTTAGTAATGGGTAGCCTATGTAGTTTC
TTGTGCGAATGATGGAAAACATATTAATGCTGAAAATATTGATGTTTCCAAAGGAACCAC
TGATGCATAAGTTAAAACTTAAAAATGTGTTTTCAGTAATTTTTTCTTTAGTATTAACTG
TTGGTCATTGTGTTTTAGGCCTGATGGTGAAAAGAAAGCATACGTCCGCCTAGCTCCAGA
TTATGATGCTTTGGATGTTGCAAACAAGGTAACTGTTCTACTTATTGTACAGCGCTGCAG
AATATGTTGGCGCTTTATAAATAAATTTTAATAATAATTTAGTACTCAATTACTTCCCAT
GAATGACTTTTGTAAATTCATTCCTATGGGGTCCTCTAACAGCAAATATGTATTGCATTA
GTATAGCTCTGGTCATTGGCAGACTTCTGCAGTTTTAAACTTTGCAAATGATGGAAATGT
TATTTGGACTGAATACATTGATGAGCTCAAAGGAACCACTGATGCACAGTATAACTGCAG
ACTCTTATTTATTTGGCCAATGTTTTGATGTGAGAAATTGATGGGCTTTTATATAGACCG
AAGTGTCTGCTTTTAGCTTACCATGCTTAATGTATCTGCAAACCTGTCTTATGCCCTGTG
TGTGTAATTGTACACATGCTCCTGAGGCTTTATGGTACACAAGGGTGCCATGTCTTAATA
GAAAGCAAAGTTCATCTTAAAATAACATTATAATAAAGCCCACCAGTCAACCAAACTATT
GGGGCCCTAGCCTAAAGCTGGTTACACACGATTTTGTTGCACGAAAGATCATTCCCACCC
TCCACAGACGTTCAGTGCTGAATCGTCCGATATGGAGGTAGAAACAGTAGGATTTCTACT
CCTTCTGCCGATTCAGCCCTGAAGGTAGATTTTGCTCAGACGCCTTCAATGGCGCCCAAT
CAAAATTGGCGAGTCGACTGATATCCGCAGTCTTTTGCGATATTGGTCGCCTCGCCGACT
TACCATACACGCACCGAATATCGTAGGAAACGAGGCTTCGTACGATATCATCGTTGCGTG
TATGGCCAGCTTAACAAGGCTTTATACGCCAACCATATTATCCAAGCTTTGAACTTAGGA
TCAATCATTTAAATCCAATTTAACACACTGCCTAGGTTCAAAATCAGGCAAAGATTCACT
TACTGGCCAGTTCAGGAGACGATGACCAGCACAAGTCATTCTGAATGACTTATAAGTAAA
TATAGCTTGTTATCCATTAACCGATGGAGTTGGGTGTGCCATCATATTAAGGTTACAAAG
GATTGCACTAGAATTTGTTCTTGTATAATTTGCTGTTTCTAGTTCATAAATGTGTTTTCA
TTTTTATCTTTCAGATTGGCATCATCTAAACCTGCATCTTCAAAAAGCTGTACAGAAATA
AATGTGTTTTTCTGCCTATTTGTGTTGTCGGTGTATTGTGTTTAACAGGGGTCCCCAACC
TTTTTAACCTGTGAGCAACATTAAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved