Xenopus_tropicalis Locus Mono:6:SNORA71
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Mono:6:SNORA71
Xenopus_tropicalis
Mono:6:SNORA71
scaffold_417
SNORA71
1001..1131
2131
TTCGTTGAAAAATAATGCAGCCAAATGCCTGTTCTAACCATTTCAACAACGCTGCTTCT
ACGCTTGCAGTTATCCTCCCGGCCGCTAGTGGACGCTACTGTTACCGTAGCCAGTACACT
CTCTTCCGCCTGTTTATAGCCTCGCTCCCGGCATCCTTTGCCCTCTTCTACCAGCTCGGG
CCAACATGGTGGGTCTTTAATCTAGTTTTGTCTCTAAGATTATCCGTATCCATCCTACTT
TTCTGCTACTTGTCTCGGTCGACTCACGTCCGCAATGGTTTCTTTAATTCTTACACAAGG
CTCAGGGTATAGTATTGGCAGCGAAGGCCGGTAGGAAATCTTTAACAGGAGATCTTTACT
GAAACTGTCATGAAGGCCCGGCAGCTAGGAACGCAGGGATAGTTTGGGGTCCCGAGTTTC
GGTGGGACACTGCGCTAGCTGATTTGAAGAGAATTGGGCATACGGTGCGGGTAGAGTTAG
TCGGTTTGTATTGGGCGTAACTCAGCGGCAGAAGGGGTTCATATCATGGTAGGTTTACGC
CACAGATCTTCAGCCTCCGGCTCTGCAGCGGTCTGTACAGTAGAGCAGGAAAAGGTGGCG
GATTGAATAAATGTGCTGCGGGAGTGAAGGTTGGACACACATGTCTGTAGAGCAGCGCTC
CGGCCGGTATGTGGGTGCTGCCTGTGTATGGTGGCTGTGCTCATATCGCTTATAGCAAGG
GGTGTACAGGGTGAACTGTCTGTGTAATGTACACCGTCGGGCCTGCACCCCTTAAGCCCA
ATACTGGACATAGTCGCCCGATTGTAGTTCTACATCAGCTGAAAGGCCACAATCGTTTTA
TTACTGGAAAATGAGTTGGACTCTTAGTTGCACTCACCCACATATACTTACCAAGTGGGA
CCTTATTGCTATATGTAATTGCTATCTATATGGCTGAGGGTTTGCACAGTGCATATTGAA
CATGACTATTTTAAGTACTTTATTTTTTACAATGTTTGAAAACCTGCATCGAAAGTGATT
GTGGCCTAATTTGTGGCCTGGTCATTGATACTGCAGGAATATCAGCATGTGTCAGTTTTT
CCCGTGTTTGTAGTGTTGCTTGTATACTGACAAACCCTGTAACTTACACACATCACTAAC
AGGTTACTCCACATTGTAGCTTTTGGTGGTTCCCAATGGGGTATTTATTACTGCTGTCAT
GTAAATACAAGGCCAAAATATAATTCAATTCACCCCTGTAAATAAGGATTTTGAACTGAT
GATAGATACAATAATTACACCCTATTTGAGTTAGTTTGGTACCATGCCATGTACCTAGCC
CTCTATGTAACACTACTCCTGCTGTAAACCTGGGGGGGGGGGGGGATATTTTTACCTATG
AGTAGATATGCTATGTAGTGGTTTGTTCCTTTAAAAACATGTCTATTCATTTTTACACCA
TAGGTGCAATAGAAATACATATAGATCAAACCATTATATTTTCACTGTCCATTACAGGAA
GTAATGAGTCAAGATCTTTCCTCATGTAGTTTGTGGGTGGCCAGACCTACACCAGTGTAT
ATTAAAAATTAGAAAGCCTGTATATCGGTGATCATACTGTAGTATCTTGTAAGGTTGATA
GAACTAGATCTAGTATATCTGGTTTGTACTTGTCACACTTGGATTTTTCTTCTTTTTGAG
TATCAGTATTTTGGACCTATTTGTCTTACTATTTTCTTTTCCTATAGGGACGCGTCAGGA
CAAAGACCGTTAAAAAGGCAGCTCGGGTAATAATTGAAAAATATTACACCCGGCTTGGTA
ATGACTTCCACACAAACAAGCGTGTGTGTGAGGAGATCGCCATCATCCCCAGCAAAAAGC
TGCGCAACAAGATCGCTGGGTGAGAGATTTCACATAGGTGGAAACTTTAAGCACAACTTG
TATTAACAACGTAATTAGAATTGGTATTCAAATTCACATACTTTGAAATAAAGGGGCATT
TCTAATTGACAAATGTTTCCCAGTTCAGTGATGTGTGATGCTCGCTCAGTACAGGAAGAT
ATGAATATTACCTCTACTAAGGACCTATGAATAATTTTTTTTTTTCTTTAACTTCAATCC
AACCTGCATCGAAAGTGATTAGGGTTTCCTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved