Xenopus_tropicalis Locus Mono:20:SNORD57
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Mono:20:SNORD57
Xenopus_tropicalis
Mono:20:SNORD57
scaffold_1626
SNORD57
1001..1070
2070
NNNNNNNNNNNNNNNNNNNNNNNNCAACTGGCCAGGTGTGTGTGACCTCCCTCCCTAGG
GTGTTGGTGCCACCGGCTTGTAACGCTGAGGTGGCCAAGCTCACTGCCCGAGTTGTGCCC
AGTAGTAACCAATAGGAGGTCACATCCATGTTGGACTCCATGCTTTGCACTTATATCTGA
TAAAACAACCAATTGCATTACAGGGCGCTGAAGACCCGCGGGAACACGCCCAAATACGGG
CTGATATTTCACTCCACGTTTATTGGCCGAGCAGCCGCCAAGAACAAGGGGCGGATCTCT
CGTTACTTGGCCAATAAGTGCACCATCGCCTCTCGTATAGACTGCTTCTCAGGTGAGCCG
GCATGTTCCATCCTTCTGCCCATGGGGGGGCAATGGGTAGAGATTAGCTCCCCCCCTTTC
CTTATACAAGGGACCGGGCTTTGCAATGATGGGAATAATTTTTCGTCAACAGTATATCAC
GTTCTGCGTGAATGGTGAGAGATTCTGTCTGAGCAAAGCCCCCGCTCGCCTAATGAGCCC
CTTCTGCTCCTCTGAGCACTTCTCTTCAATCGCCAGTTTGTTAATGAGGCCATGTTCTAT
TTCCCAGAAATCCCCACTAGCGTCTTCGGGGACAAGCTGAGAGAGCAGGTAGAGGAGAGA
CTGGCTTTCTATGAGACCGGGGAGGCTCCACGCAAAAACCTGGATGTAATGAAGGAGGCA
CAGCAGGAGGTACGTGTGTGGGGGGGGCTCACTGGGTAGTACTGGGGGGGGGGGTAATCC
AATAGAATAGGGTTCCCTGAGCACTGTGGGTACAGGAGTGTAGGGGTTTGACCACCCTGC
CTCATTGGGGCCCCCCACATTAGGCCAGAATAGGGTTCCCTGAGCATTGTGGGTACAGGA
GTGTAGGGGTTTGACCACCCTGCCTCATTGGGGCCCCCCACATTAGGCCAGAATAGGGTT
CCCTGAGCATTGTGGGTACAGGAGAGGGAAGCAGGGGCTGTCGGAGATGATGTCAATCTT
TTGCCCTGACCTGAAGCCATGAGGCAAAAACTGATTTAATGAGCCTGATCCGACATTGGC
TGTTAGCGATGTAGGTGTGGCCTGTGTGGGCCTTGGGTTATAAATGTGCCCCTACTGGGG
GAGGGGTTCTGGGTGCAGCTGAACAGTAACACAAGCAGAATAGGCCCTGCCTGTGACTGG
GGGCGGAGTGAGTGGGGAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAAGAAAAAGAAACGCCATGCTGAGCCAGAAGTCTCCGAGAACGGGATG
GAAGAGGAAACGCCGTCCAAAAAGAAAAAGCAAAAAGCCGCCGCAGAAGAAGCGCCTCAG
AAACCCAAGAAGAAGAAAAAGTCCAAAGAGGAGAATGAGAGCTGATATGGGGGTGACCCT
GTTAGAGACTCAGCGCCCCCCAATGGCGCACACACAAACTCCATCACATCATTTCATATA
TTTTTATTTACGTTGAGCCGTCTGTGTTGGCTGAGAGTGGGGCCCCCCTGCCCTGAAGCC
TGTGGATAATTGGGGGGAGGAGATTGTATTTGGGCCAATTAAAGTTTGTATATAATGTAC
CCGCCTCCTGTTATCATTGGCTCTTGTACTATGGTGGCAGCACAAGTTCCGCCCTGTCAC
TTTCTCTGCCGCAGTTGCACGGCTTGTGGGTGTGAAGCTGAATTCCTATTGGTTTAGGGA
AAGTATTGGGGCAGGAAGGCTGCTTGGTATCTGGGGATGTAGAGTGGCCCAGGGCAGGGT
AAGCAGGATGTCTCAGGGCTGGAGAAGATTTCAGTGTTATAGACATCAAAACAAGTTAAG
AAATTTGTTTGCATTGCTAAACCCTCACTAGCCCCACCTAGTGGTAGACATGAGACTAGC
CCCCAACCAGGAGAAACCCTGCTCATCTCTTTGCTACTTGCGTCCTACTGACAGTTACAT
GGGAGTAGGAGAAACAATAGGTTAGCTGAAAGCAGTTCTAATGTGTAGCGCTGGCTGAAA
GCTCAGACTCAGGCACACTTTACTGCTGCGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved