Xenopus_tropicalis Locus Mono:19:SNORD77
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Mono:19:SNORD77
Xenopus_tropicalis
Mono:19:SNORD77
scaffold_1172
SNORD77
1001..1064
2064
AGCAGATCGGAATGTACAGTGCAGCTATGGCTGTATGCCTATATAACTGCATTGTCAGC
AGATTGGAATATACAGTGCAGCTATGGCTGTATGCCTATATAACTGCATTGCTCAGCAGA
TTGGAATGTACAGTGCAGCTATGGCTGTATGCCTATATAACTGCATTGTTCAGCAGATTG
GAATATACAGTGCAGCTATGGCTGTATGCCTATATAACTGCATTCTTCAGCAGATTGGAA
TGTACAGTGCAGCTATGGCTGTATGCCTATATAACTGCATTGTTCAGCAGATTGGAATGT
ACAGTGCAGCTATGGCCGTATGCCTATATAACTGCATTCTTAAGCAGATTGGAATGTACA
GTGCAGCTATGGCTGTATGCCTATATAACTGCATTGTTCAGCAGATCGGAATGTACAGTG
CAGCTGCGGCTGTTTGCCTTCATAGCTGCATTGTCAGCAGGTTGGAATGTACAGTTCAGC
TATGGCTGTATGCCTATATAACTGCATTGTTCAGCAGATTGGAATGTACAGTGCAGCTAT
GGCTGTATGCCTATATAACTGCATTGTTCAGCAGATTGGAATGTACAGTGCAGCTATGGC
TGTATGCCTATATAACTGCATTGTTCAGCAGATTGGAATGTACAGTGCAGCTATGGCTGT
ATGCCTATATAACTGCATTGTTCAGCAGATTGGAATATACAGTGCAGCTATGGCTGTATG
GCTATATAATTGCATTGTCAGTAGATTCGAATATACAGTGTAGCTATGCCTGTATGCCTA
TATAACTGCATTGCTCAGCAGATCGGAATGTACAGTGCAGCTATGGCTGTATGCCTATAT
AACTGCATTGTTCAGCAGATTGGAATATACAGTGCAGCTATGGCTGTATGCCTATATAAC
TGCATTGCTCAGCAGATCGGAATGTACAGTGCAGCTATGGCTGTATGCCTATATAACTGC
ATTGTTCAGCAGATCGAAATGTACAGTGCAGCTATGGCTGTATGCCTATATAACTGCATT
GTTCAGCAGATTGAATGTACAGTGCAGCTATGGCCGTATGCCTATATAACTGCATTCCTA
AACAGATTGGAATGTACAGTGCAGCTATGGCTGTATGCCTATATAACTGCATTGTCAGCA
GATTGGAATGTACAGTGCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved