Xenopus_tropicalis Locus Poly:1:SNORA8
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Poly:1:SNORA8
Xenopus_tropicalis
Poly:1:SNORA8
scaffold_23
SNORA8
2764..2903
3903
CTTTAGTAGTGTTTTGTAGCCTTTAACTGCCCTGGTGCCTTATTGAGCATCTAGACACA
CTCTTATCATGAATGTGCCCATCTCAATCAGTAAGGCAATATTACTGGTCAGGTTTTGCT
TCCATCGTGCAAATTACTAATTGCACTGGTGACAATGAGACCTGCCACATTGTCTTGTTG
ATCTGTCATTTGTTGACCAGATGAGTTGTACAGAATCTCTACTTGAGGCTTAACCTCTAA
ACTGAACAAGTGATGAATATCAGGTAGTTATTGCCTGAGAACATACAGTACCTGACTACC
GATAAGTGTCTTCATGCTATGATCACGGGGCCAGTGAAATTCCTTTTGCGCTACTTAAAT
TACTTTGGTGAATGCACTTTCTCAATACTTATGCCCTTGTTTTGTCTATCTAAAAACTAT
GTACTTTATTTTTTCAGGCATTGATCTGGAAATGGCATTAGATAATATGCTGCTGATTTT
TTGCAGGAAGAATACTGTTCCATGAAAACAAGTGAGTTAATAGTATTTATAAAGAGCCTT
TCTGAACCTAGCACTTATTATTCTTATTTGGCCTACAATGGGTACAAAGTTAAAATAAGT
GCTTATATTAAAACCTTTTCTTGCAACCCACAACTAATTGGGTAGTATGAGTTGTGTTAC
TTATGGGAAGGGACACTATCTTGTTTGTTTGGCTAGGAATCAAATTTTCCTTTCTAGGGT
CACTAGTTGACATCTGGCATCCTGACACTTGTATCTCTTTTTCAGTAATGCAAACTGAAC
ACTGAATTGATGGGTCGATCCATATTGCTTGGCTTACAGTTGATGCACATGGTAAGTTTT
GCACAAAAGAGTGGCCATATAGTCCAAATAGCTTGTCAGTCCTTCCTCTAGTATTAAACA
CTTTGTTCCATAGGATGAACATGTTCCACAGATATAATGGAAGCAGTGACTGGTGATAGG
AGATTCCTTATACTTCAAGATGTTAATACACTATTTTATGGCTTTGTTCTGATGAATGGC
AATGTTCAACTGCTCTGAACTAGAGTGACTGACAAAAGCCTCTCTGAACTTATTGCATTA
GAAATGTGCACTTATCCTGGGTGTTATTAGCATTAACAGGCTTTTCATTTCTCTACTTCT
AGGGGGTTATGGAGCGCTAAAGATGCAGTTAAAAGGTTAGAACATACTATTTTATCTGAT
TGTTTGTGAGGTCTATCCCGATGGTGCTTTGATGTAAGTTCATATCGTTGGAAACGCCTC
ATAGAGTAACCCTTGTAGCTTTGAATTACCTGCTATAACCTTTAGTGGGGTAAAATCTGC
ATAACAATTACCCACTAAATGTGTTCAAATGACTTGTCTAACATATTCATCTTTTTCTAG
CTTGAAGCAAGCTTTACAAGTCTGGGAGTAGGTGAGTTAAATAACAGTTGTCCAAATTTC
CTTGCTGCCCCAGTGGCTTAGGGTACATGGTAAGCCTGCAGGCATCTCAGACTAAAATAT
ATTGTCTTCTAGCAGAGATCTTTGTATGCTGTAAAGAAACCTTTAATTTATGCCTGCATC
TGACTTGTGTGCAAGAACCTCCCTTCAGTATTTTTAAACTGTTTTGAAAGGAGTGGTGGA
GATACAGAAGGGAAAATAAGTTTCTATTAAAGAATCTCTCCAAACTGGAACATATATTTC
AGTAAATATTGCTTTTATGTACTTCCCCTGATCCACCATTTAGTGGTGGGCTGTGTGCCC
CCTCAGATCACATGACCAGAAATAATGCAGCTCTACCTGTAACAGGAGTAAGACAGAACT
GTGTCCATTCTTTAGCTTGTGGCCTAGCATGTATGTGCCTTTGCTTGTTTGTGTGCAGTG
TGAATCCTGTCATCCCAGGAGGCGGCCCTTAATTCTTAAACTGGCAGTTTCCTATTTAGG
GTTACCCAATAGTACATACTAAAGTGTATTTATGAAAATGGGTTTATTTAGATGAAGCAG
GGTTTTACATGTGAGCTTGTTTATGCAATATATTAGAGACCTACATTGCCTGGGGGTGTA
GTTTTTCCTTTTTAAGCAGTCTTCGAAAGATAAAATGTGTTAACCGTTTTTATAGTAGAG
GTATTTGATCTGTTATCCAGAAACCATTCAGAAAGTTTCAAATTATGGGGAGCCCATCTT
CATAGACTTTTTTTATTTTTTTTCTAAATTAGCAATGCTGTTGGGTTTATGTCATATATT
TTTTTTTTAGTAGACTTAAGGTGTGGGGATCCAAATCACAAAGTACCTGTAAGTGTTAGA
GCAGAAGCTAACTAATGCAGTACAGGAGCAAAGTACTCGGGCCATTACTTTTCTGTGCAT
TGTTAAACTGTACTTGACACTGCATATTCATTTCAGGTCACTAAATTTCTGACAATGGAG
TATATTCAGCAAAAGTGGAAAGGCCACTAGGTGGCCCTCTTAAATTCTAAAACATAACTT
GTTAAACAATGTCTGACTGTCCAGCTGGCTGCATTTTTAACTCTGTTCATATGATGACAT
TTTAAAGTTCAACTGCTGTATGACTAAAGTATGAACAAATGCATTAACTACTGACTAGAA
CTGACTGCAATATTGCTGTACCATAAAGGCATATTTGCAACATTTTGCCATTTACAGTCA
TGTATCTACTACTTTGCAGGCACATCCGTGGTATGAAGATGCAAACTGAGAAAGCAGAAA
TTCAAATCTGAATGATGGATATCCTTTCAGGTGAGCCTGTTTTAAATTTTATATTTTTTG
ATTGAGCACTGGATGGTATCTGCACCCAATGGCATATACCTGTTGTGGTGTTCAATAGGC
AGTGCTACAGTAACTCTGCAATTGGCATCGTTGGTTTTAAGGCTTTTCTATGCTTTAAAT
CCTGGTTTTTCTGCTGATACAAATTAAAAGCTGTTTAAGATGGACTTTGCTGATAGTAGT
TAAAGCACTAAGAATTTTTCTTTCCCTGATCAGGTGCTGCATGCAGACATGTGGGAGCTC
TGGAGAGGTAAATGTACGAGTCATAGAACAACATATTGGAGAACTGATAAATTCAGATAC
CTTTCATATACATTATGTGGTCATTACCAAAGCTACTATTTATGCAGTTGCTAGTGTGCT
GTGGACATGACCAGAAAGTAATATTTCAAATAGTCTGAATTGTACCTATGTAGGAGTACA
ATGTGGGACCTTTTGAAGAACAAAACTTTGATGGGTGGTCAAAGTCTTCAACTGGCTTAA
AGGTATATAACTAAATGCTGCTTTTCTGTTTTTAGAAGCTGCAAATGTTAAACTTGCTAT
GGAGAAAACACAAAGCATACTTAAGGTAAGACTTGTTTTAATGACAGCAAGACTCTACGG
TCACTTCAAAGAGAGCTTCTTTGGCATACAACCAGCTGTTCTTACGCTGTGACCCATAGC
ATAATCCTCTACAGGATACTATGGGCACTCTGTGTGTACCATGGTCTATTATAGAGGAGA
TAAGCACATTTAGTACTTTCAGTTTGCCCATTGATGATTAAGCTCGATTTATGCCTTCTG
TGTAACATGTTAAATGAGGCCAGGGTTCTTTTGGCAGTCCAAATATGGAAAACAAATGGT
AATTGTCTCTAACTGGTCCCTGTCTTAATCTCAATCTGCAGGCATACCTTCAGTTCTCTC
AATAGTGCCCTTAAGTCTCCATATTTCTCCTGTTTAGATGACCAGAAGCCTCATAGGGGG
AAAAAATGCTGATCTATGTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved