Xenopus_tropicalis Locus Poly:11:SNORD99
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Poly:11:SNORD99
Xenopus_tropicalis
Poly:11:SNORD99
scaffold_1546
SNORD99, SNORD99, SNORD99
1001..1077, 1699..1775, 4335..4411
5411
GCCAATAGAGACGTTTCCTTGACGGTCGCTGGTCAGACTGCTGGGGGGCTAATCAGCAA
CATATCGGGAAACAACACCCGTGGCCCTGATTGGTCACTCCTGTAGCTACTGACCCCCCA
GCCAATGGGGGGGAAAACCCTGTGTGAATGTACCGCTGGGTCGGGTAATACAGAACCAAT
GGATTTAGGGCTCACTTAGTGTTGGTGCCGCAGGAAATTCTAATTATCTTGCACTCATTT
TCTTATAGGAGACTAACGAGTAATGAGACCTGAGTTCCCGGACCCTACGGTACGTTGGTT
GCACTTTTATTTGCTGTTATCTAGAAAGGACATTAAGTGTATCAGGTGTCCCTTAGCTTG
GCCTTTAATGCTCATGTCTTCCCACGTGCTGTGTGGGGGCCCAGGCCCTAAAGGTTCTAT
AAAAGTAGCCCAGACTCGAGTTGGGGTGCAGAACTGTCTCTGTAGGGTGTCACCCAAGCA
GTGGAAGGGGTTAATAACGGGATTTGGGTGGTTGCGATGATTCCCACCCGGCATGTTATC
CGAGGGCCACGGCTGCCCCCATAGCTGCGGCAGCTCCAACAACATGCGAGAGAAACAGAG
GGGCTTTGTCAGCTTGTGTCCTTGTCCCACCGGCTGTCACTCTGCTCTCATACAGAAACT
CAGGGTAAGAAGTCACACTGTTTGCATATGGGAACCAATCCGCAGGCAGTATATAGCGAC
CCCCAGTGGATACAGTCTGGAAAGTGGACTTGTGAGTTTTTGTGCTCATTAAATTACATT
TTGTTCCCACAGACCATGGGCTCTAACTCGTGCGTCAGATGAACGGCTGCCGCTTCTCTA
TGGTAAAGTTGCCCTTTAATATTCCCTTCTATCTAACCTTGTGTAAGGAGCCTGTGTTAA
TGGGGGGGGTAGCATTCATTTGCTAAGCAATAAGGATGCTGTGCTGCCATGTTGCTGCCG
GTGGGTATAAGCGCCGTTGGGCAAGCCGGGGCTCATTTCTGGCTGCGCGGGGATGAATCT
CTTATCTGGAGACGGTTGGATGAATCTTGCGGATATGGGACTGAGCGCAGCCGTTGCCTT
ATCCGAGGGCCCCGCGGTGGGTTAAATCCTATTGGCTAATAACGTGTCCCTCTCTTTCCT
TCAGTGCCAAGTGGATCTCTCGGCTCGGAGATGTTCCAGGTAAGGTGAATGGTTAGTGCC
AGTTACATTGGCAGAGGGTTTGGTCTATTTTCTTATTGGTTCTATCCGGGAGGGGGGCAA
ATTGCACACGTTGGCATCCCTGGCACCTCCTGATCCCTTTCCCATCAGGTCTGGCACCCG
ATCTTGTGGTCATAATAGGAGGGGGGAGTAGATTGGTGCCACCCAGGCCTGTTGGCATTG
TGCTAAAATGGAAATGGGGGGCATCCGACATGATTAATGCGCCATTGAGGGCTTAGTGGC
TTATTATCTAGAGCCAGTCGGGTTCTAGAACTTGTCTGTTTGGTTGGAACGTTCTTGATG
ATTGTCCTCCCCCCTCCAGGCTGTGCCGCCCACCTCAGAACTCTGCGCCATTCGGATGTA
ACTGCTGCCCCCGGATCAGGTCAGTTTGGCACAGGTTCGTTGATGCCAGTTTGGTGCTGA
GCTCTTAGTCCCTGGGGAGGGGTTGGGGCCACACAAGGGGGATGCTGGGAACTGTTAATA
AGGCTCAGCTTGAGGTTGCTCTGTGTGGGGATGAATCCCTTATCTGGAGACGGTTGGATG
AATCTTGCGGATATGGGACTGAGCACAGGCGCCTCCATTGGTCGTGAGCCGTGTCCTACA
TTAAACCTGCTCCCCCAGCAGTAACCGTGGGAGATCCACTTGTCTGACGGGGCCCCCAGC
CGGTGTCTGGGGCTGATGGGCCAATAGATTGGGTCGTACAGGGGCTCTTTAGTTCATTCA
GTTCAGGAGCTCTCCTGTTTAGTTTCAGCAGCTATTTGGTTTCTAGGGTCCAAGTTACCT
TAGCAACCAGGGAGTGATTTGGATGAGAGACCTGAATTGAAAAAGTAACTAACAAGTTGT
AGCCTCACAGAGCAATAGTTTTTTGGCTGCCAGGGTCAGTGACCCCCATTTAATAACTGC
AAAGATTTGCAAATAGACCAATTGAAAAGTTGCTTAGAATTGTACGGAGGGGCGGTGTCT
GCACATTTATTGCTCTGAGTTACGGTGGGCTCTGACCAATGGGGTTGAGGGGGAGACCCC
CAACAAGTAATGCTGCCTGTGCCTCTCTGATATATAACATAGGGATTAATAATGTCTTTC
TCCTCCAGGTGCTGATGCCGCATTGGTGGGATCTGTACAGAATGCCCCAATGGGCCCCCG
GGGAGGGCAGTTGCCCCAGGTAGGTTATTTAGTCGTCTGTCTCCCCCCCCCCCCCGAGGC
CCTGATCGAAGCCGGGTTAGTGGCGCCAGTAACTGCCCCGGTCAAACAGAGGCCCAGATC
AAGTTTCCTCTGACGGTCGCTGCTCCGGCTGCTGTGCTGGGGGGTCAGCAACATTGAGGG
GAAATACAGGCAGTGCCAGGGGGTCTGTGCCCCCCCCATACTGTGTATCCCAGTGCCCTT
ACTGCCCAGGAACCCTTCTGCCTCCTGTAGCTCCCCCCCCCCCCATAGAACTGTGTTGCA
CGTGGGCCCCCCACTGATAGTGGCACTGAGCTGCTTTACTGACTGTCACTTTCCTTTGCT
CGTAGCTGTCGTTACCGGGACGTCACTCACATGTAAGTATCCGTATGGCTATGGGCTGGG
TATGGGGCTGTGATATAGTGAGTGTATAACCACTGCGCCCCCTGCTGGTGAATATAAGGA
GGGATCCAATGGCCGTATAAAGTGCTGGGGCCCAGGCCATTGGCCATGTGACGGCTCTAA
TCCAAGCCATAGTGGCCCCTTTATAGCTGCCGTGGATAGTAAAGAGCCAATAGAGAAGTT
TCCTTGACGGTCGCTGGTCAGACTGCTGGGGGGCTAATCAGCAACATATCGGGAAACGAC
ACCTGTGGCCCTGATTGGTCACTCCTGTAGCTACTGACCCCCCAGCCAATGGGAGAAGCC
CTGTGTGAATGTGCAGCTTAGTGCTGGGGGTTAGGTCTGGTAGTAAATATTAATACGTGT
TCATTTTGTATTTTTTGCAGACCTGACCGCTCCGGCGCCTGTGCGACTCAGCCCAAGGTA
TGTGGGTTGGCTGCTACAGATCGCTGTGTATAATGGGCACTCGGCATGGCACGTCCCTTG
GCATCATTAGGCCGCAGGCAGTAGGTGCCTAAATGTTCTATAAAAGCAGCATTAGGGAAG
GGTTAATCTTTGCAAAGACCCCTGTCCCACCCGGCATGTTATCCGAGGGCCACGGCTGCC
CCCATAGCTGCGGCAGCTCCAACAACATGCGAGAGAAACCGAGGGGCTTTGTCAGCTTGT
GTCCTTGTCCCACCGGCTGTCACTCTGCTCTCATACACCCTGTGCCCTGCCATGTACACG
GGGGGCAACTAGATATGGGGGGGCAGTCCAGTCATTTGGCTCCTGGGCCTATAGTTGGCT
TACAGTAGGAACCTGTGTGTGCCCATTGGGCAAGGGCTACATCCAGTGGGCATGGGCACC
CATGGGGGGGGGGGCTCTGGAACCTGCCCAGATATGGGTGCAAATTCTCACTCTATTGTA
AATCTTCTTCCCGCAGATCTGGGCACTCACTGGTGCGTTGGAGATGAATGGAATCTACGG
TAATGTTCCCTTTTGTCTAACATAGATATCTATTATTTATATCTACCTATCATCTGTCTG
TCTGTCTATCTATCTCTGTCTATATCTATCCATCCCTTCTATACAGTAACTCTGACACTT
CCTGGAAATGGGCAAACCCAGTGCAAGTCCCTGGCACCTCCTGATCCCTTTCCCATCAGA
TCCGGCAACCGATCTTGTGGTCAAAATAGGAGGGAGAGCGAGTTGGTGCCACCCGTGCCC
TGTTCAGCCCCGTGCTGGGTGGATGTGGGGGGCACCAGACATGGTTTATTTGCCACCGGA
AGGGGTAGGGTTGGATCCCCTGGGACAAAACTGATTTCTACAGTAGAGCTCATGTGATTG
GCTGGAATGTGTTTAATAATTCTCTGCTCCCCTATAGGCTGTGACCCCCACCTTGGCTCC
ATTCCTACATAACTGCCATTAGGGCATAAGACTGAAGCCTCATCCACTGGAAGAACTTGG
GAATTGGAAAGAAATTGTAAGTCTCTACATTTGCACTCTAATGGGGTCATGTAGCAACCA
ATCAGAGGAGACCTGTAAATGCTGTTACTTCATTGCAGGGGAGGGGCTTGAGGCTGTGCA
GGGGAGGGGCTTGAGGCTGTGCGGGGATGAATCTCTTATCTGGAGACGGTTGGATGAATC
TTGCGGATATGGGACTGAGCGCAGCCTTTGCCTTTAGCCCCAGGGGTGCTGTACATGGAA
CCATACACACCAGCTGTAACATGTCTTGTTTTTTTTCTTTTCCCCCCTGGCAGTGCCCAA
TGGATCACTCCTGGCCACATATTTCAGGTAAGGCTTTTAGGTTAATTGATTGGCGGGAAT
GGACTCCCAATCTGCTCAGTGCAGACTGGGCCATGGGGTTAAACTGTAAATGGGCAGCTC
TGAGGTTTCTCATTGGGTAAATATAAGGCCGATAGGGGGGTAATTAGATTGTGAGCTTCT
CAGCAGCAGGAAATGGTAAACCTTCTCTGTAAAGCGCACAGAACTGGCCCAAGTGACCCC
TAGGCTGTGCTATTGGGTTTCCGGAAGGAATAATCACTGCTTTCTTCCGCCTTTGGCCCC
AGGAATGTTACACAACTAGAAATGGCGGTTCTTGTTGGTATGAGTTTTGGTAGCCTCCGA
CTGAGCCCTCACAGCGCCAAGTGCTCTATTTAGGGACACTTGTTACTTTGGGGTTTTTAC
CTACAAGAAAATTGAACTTGTATAAATATATTTGAGCTGAAAGTGGTAACTACCTGTCCC
TTTTCTGTTCTAGTTCTGACTCATGAAACAATGTAGCAGGAATAGTTCTGCTAATTATCT
GCCTATTGCCCTGCGTCCCTCGAGCAAGTCTTCCAGCATGGCTGGGTTTGCCGTAGCCCT
GCCCATTCCTGTAGAACTTGCCAGATCAGCCCTGAGACGGTTTGAGGCCTCCTGCTGCCC
CCTCCAGGGGGAGGTTATAGAACTCTCAGACACTTGCGTATAAATAGTCCTTATGGTCCC
TTTGACTGACAGAGCAATAAACGTTTGCTACTATTGGTGATTGTGTGTAACTGTTGGTTC
TGTTACAGCCCTGGGCCCGGCGCTGGTGCTTATGAGAGTGAAGGATCCATCGGCGGCGAG
ACAGTCCCATGGCGAGGGGTGGAGCGACGAGACTCTTCATTAAACTGTTATTTGATTTCT
TGTCTGCATCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved