Xenopus_tropicalis Locus Mono:17:SNORD24
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Mono:17:SNORD24
Xenopus_tropicalis
Mono:17:SNORD24
scaffold_878
SNORD24
1001..1074
2074
ACAGGGAACTCTGAGTATCACTCAGAAATGTACGGAAATAATTGAATGCAGTTTACCTG
TCCCAGTAAGTGATACCGCCACTTCCACTGAGGGGTTCTGTGCCCATATAAAGGCACAAG
GCTGCAGGCTGAGTTATACAGGGAACTCTGAGTATCACTCATGTATTATAAGGGATAATG
TACCCCCTACTGTAAATGATAAGGATATTAGCAGTCACTGAGGGGTTCTGTGCCCATATA
AAGGCACAAGGCTGCAGGCTGAGTTATACAGGGAACTCTGAGTATCACTCAGAAATGTAC
GGAAATAATTGAATGCAGTTTACCTGTCCCAGTAAGTGATACCGCCACTTCCACTCTCGG
CAGCCCCAGCACAAACCCTCACACACACAGTACATCCGCTCCCGCCCTTCGTTCCGCTTT
GATTGGCCGAACCTCCTCATGCTAAAGCGTGATTGGCGCCTCCGCACGTCAATCCCCGTA
CATACAAGCTTGCCTGTTTCAGGTTACGGTGCTACAACAAATCCTCTTAAAGCGCCAGCG
CTTCCAGCAGAACCCCCAGTCACGCAATCGCGGCCGCGGTCCCTTTAAGCGCCCTCGCTG
TACAAATCTCGCGAGATCTCAGAGGCGATACAAATATTACCCACAATGCCTCTTTCTTCC
TTTCTCTGCCCCTGTCCACCATGGTGAGTGCTCGCCGGCGCCGCTCTTGTTATCCGCTTC
CATCCTACCGCTGTTGGCCGCTCTATCCCCCGCCGCCCGGCTCACTTTGCTCCTGGATAC
CTCTGCCTTATATTCCCGGGGATATTTACCGGCCATGGATAATGTTTATACGGGATCCGG
CAACTGGTGAAAGTTCTTCCTCTCCTATTGGCTATGGCTTCCGCAGGCCTGGCAGCCCTT
ATGGGAAACGGGGAGAATTTCTGATATTATCCATTGCTTCCAAGGAGCAGGCCCAGACCC
CGGGCTCTATTAGTTCTGACTGCCGCATTGGGCTAAGCCTGTGCAAGTGATGTGATGAAA
TATTTGCTATCTGAGCCACAGTGCTGACACTCTACCCACCAAGATCGCTGATGCACAGCC
TTATGGCAGGGTTCTGGCCCAGTAGATCCTGTCTGGCTACTGTATGGGGGTGACTGGAGG
ATCTAGTGCAACTGTAAACATTGATGCCCCATTCAGTTGCAATAGCTGACCACATGGGTA
GCCCAATGGCATACTTGGGCACTGTGGGAATCCTGTTTGGCTTGGGGTGGGGGTTGTAGA
GCTATTATTGACTGGGGTAGTAGCCTGTAGCCGTGCTCTTTATCCAGGGGCAATAGACTT
GCCCTGGTATTGAAGCACTAGAGGGTGCCCAGGTGTCACATGTTCTCAGCCTAAGTGGCA
ACTCTGGGTTTGCTTGCTGTCACCCTAATGTAGTGCTTCTCAACCTTTCTTTAATACAGT
TCCTCATGTTGTGGTGACCCCCGACCATAAAACTATTCCTAAGACCATCAGAAATGTTTT
CTGATGGCCTTAGTTGACCCCCGTGATAGGCTGGACCCCCAGGTTGAGAACCGTTGCCCT
AATGCATCTATTTCTCTGCAGCCTAAAGGGAAGAAGGCCAAGGGGAAGAAGGTGGCACCC
GCCCCTTCCGTCGTGAAGAAGGCCGAGGCCAAGAAGGTGGTCAACCCTCTGTTCGAGAAG
AGGCCAAAGAACTTCGGCATTGGTGAGTGTTGCTGTGCTTTACCCATGATCCCTTCATAA
AGTCTTTCCTATAGTTGTGTTGGAGAGATCTCCTACTTGGACATCATCCTGCTGTCAACA
TCTCACTCCTGCTGTGACTTGTAGACTAAGAGTAGGGGAAGAGTCAAGGGTTCCAGATTC
CGGCCTAGGCAGTGACTTGGATCTAAAGGGTCCATATAAGGCAGTGGTTCTCAACCTTCG
TCATGTTGTGGTGACCCCCAACCATAAAATTACTCCTAAAACCATCAGAAATGTGTGTTT
TCCAATGGTCTTAGGAGACACCTGTGAAAGGGTCCCAAAGTGGTCCTGACCCACAGGTTG
CGAACCGTTGGTATAAGGGAAAATGTCCATAGGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved