Xenopus_tropicalis Locus Mono:4:SNORD16
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Mono:4:SNORD16
Xenopus_tropicalis
Mono:4:SNORD16
scaffold_363
SNORD16
1001..1100
2100
GCCCATAGGGACAGCATGCGAAGGCCTTACCTTGCCGGTTATAATGTAGATACTATCGG
AGCTGTCGTACTATGTCCTCTATCCCTGCCCCACTAATACATGTGCTGCCTGGGTGGATA
GTCATCAGATGAGCCGCCTGTTTAACCATGTGCAGAGTTACTCGCTTCTCCCTGTACAGA
CATGTGTATATATACAGGAGACTGCTGTTAAAGGGGAACTTCGACCAAAAACTGATTATT
TTTTACTTAAAAAAAGTCCAAGCAAATTTTCAAAATACATTAACTGTTATATTAACACTT
AATAGTTAATGTATTTTAAAAAATTTGCTCGGCTTATTTTTTTTTTTTTACAAATAAACT
TTAACTTTGTTATATTAACACTAAATTAAGTTATTTGTAAGGAACTTTTTTTCAGAATTT
TTCTTCTCTGGTTCTGACTTGGGACAGTGTAGTAGAATGGGGATTGTGGCCTTCATCTGT
TCTACAGCTCACAGCACCCTCTGGGTGCCAGTTCCTAGGAAATCTACCCCAGTAGCCTGT
GAGCTGTAGGCCTGACATCCTACTTTATGGTTTTGTCAGACTTGTCACCAACATGCCTTT
TTTGTTCCTAGGGCTGATGTGGCTTGTACCAGTTACAGTTCTAAAGTATTTTCTAGTGTC
CAGGGAGAAGCCACTAGGCCATTGTGACATGGGAACATTTCTTTAGACCAGGGAGAAAAA
ACATTTTTTTCTTTAAGGTCTAATTCTTCCATTACTGTAAAAAAACAATACATTCCCTCC
CCTGTGCAAACTTAATGTGACTGAACCAGTGCTTGGAACCATTCCCCCTAATGCTTTCAG
GCTTTTATACTGTGTTCAACTTAGTAGATGATGTATAAACCGCCTTATTGTGTTTGCCTT
TATTTTATCACCAAATGAATCTTTATTGTGTGAGCTGTGCAAGTGCGAAAGAGAAGTAGT
TAAGCATAAAGTGGGGCAAAAACTGTTCAGTAATGAACATATGCAATGATGGTGTAATTT
GCGTCTTACCTGGTATTCAGCGACAGTTGCCTGCTGTCATAAAGCTGGTGCCAAGGGGTG
ACGATAATACAAGTCTGAGCATTTTGATACACCTTATAAATATTTGGCCTGTCTTTGGAT
CCTATTTTTTAACATGTTTCTTGTTTTCTGGTTTAAATGTAATCTGTTGCAATTTTGGTT
TTATCCCCCCCACCCCAGGCCTGCGCCCGTCCGCTAATATCAGTATACTCTGAGAAGGGG
GAAACATCTGGCAAAAATGTCACCATGCCTGCAGTGTTCAAGGCACCTATTCGGCCTGAT
ATAGTCAACTTTGTCCACACAAACCTACGCAAGAATAACCGCCAGCCATACGCAGTGAGC
GAGCTTGCTGGTATGTAGTACTTTGATCATCATAGTTTACTTGGGTGAACAAAATTTTAT
GTCAGATGAATATGATGAGTTCCACTTCATGGTCCGTGTTTCTGAACCCAGTGATAATAA
TGGAAGTTCTGATTATAAACTTTTATATCGGTTGAGAGGCTACCTATGTTGCAGTCTAGT
GTAACAAGTTTTATTTCCCAGGTCACCAAACAAGTGCTGAATCATGGGGAACTGGTCGAG
CTGTTGCCCGTATTCCCCGTGTGCGTGGAGGAGGAACTCACCGTTCCGGTCAGGGTGCCT
TCGGAAACGTATCCTTTTGGATTAAAATGAGTGCGTTTTTACATGCTATGATGTCGTAAT
TTGCGTCTTACTCCACATCATGCGACAGTTGCCTGCTGTCATTAAGCTGGTGTGGGTGAC
TGACGAATATCGCGTTCTGAGCAAAAATACTTCTCAAATCAAGTTTCAAATATGTTAATA
GAAATGGCTTGCCAAGAAAAACTTCTCTTTAGATCAGTTTTTTATTTTTTAGAAAATTTA
ATTTCCTTAATTGGATATGTAGATGTGTCGTGGAGGGCGTATGTTTGCCCCAACTAAGAC
CTGGAGACGCTGGCACCGTAGAGTCAACACAACCCAAAAGCGCTATGCAGTCTGCTCTGC
ACTGGCCGCCTCAGCCCTTCCTGCTCTTGTTATGTCTAAAGGTAATCATTTTCTAAGACA
T
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved