Xenopus_tropicalis Locus Mono:8:SNORA69
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Mono:8:SNORA69
Xenopus_tropicalis
Mono:8:SNORA69
scaffold_593
SNORA69
1001..1129
2129
CCTTTTATTGGCTAAGTAAAAATTGCAAGCTTTTGAGATAGTATTATCTATCTTGCGAT
TTGTACTTGCCTTTTATTGGCTAAGTATCACCTAACCCTACATTTTCTGCAGTTTTTCAA
TGGCTAACACGGTACAACACCATGTTTATGAGGAACTTAGTTTGCTTACAGTAACAGCTG
ACAGGGCCTGCCTACGCTGCTAGTAAGTACTGTATAAAGTGTCAACTCTTTCCATAGCAC
TGTACAGTAGACATACTACTACAAATGTATAGTGGGGTATGGGTATAGTGTCCATATAAA
AATATGTAATCAATTCTGGAAAGATGTTTAAAATTACTTCCTGTTAAAGGTATTACAAAT
GTCCTTTGCTATTCTTTGAACTGCAGGTCCAGACAGTATGTACCATTGACAGTGCTTTCC
TCTAGCCAAAACTAAATTTCTCATCCGATTCACACTTCTGTCAATTTCCTTAACAGTTTT
GCACAGAACTTAAAAAACTGAATGTCTGTACCAACAGAGATTTAATATTAAACGGAGTGC
TATTAAGCACTCTTGCAGTTTACACTTTTTCTTTGACGATTCAGCTGTTGGTATGAAATT
CCTTCAATTAGCACCACATATTTTCCTACATATCTTGCAATCTTTAAAATAAATACATGT
AAGTTGCAAGAGTGCTTAACATAGCACTCGGTTTTGCATTCATTTATTTAAAAGGTTTAT
ATTTTCCAAAGGATGTGTTGTAGAGCTGATGCTTGGTCCCCCTATCCTCGTGTGCTCTAG
TCATGTGTACATGGATAAAACCATGGAAGAGATAAATACAATAGTTGTGTTAATCAGACT
AAATGTAAAGCTTGAAAGACAGATGCTTAATAAAGCTCAATAAGTTATTTCTAATTTAGG
TGGCTTATGGTTGTGCTATCGCTTGATAACTTTGGTGTCACATGAAAGGATGTTTTATGG
AAGTTATGTATTAGAAAACTTTTTTGGTGTATCAAAAACCCAAAGCAGGTTGCAATTACA
GTTCTTCATTCTGTGGAGTTGCTGTCATTATCCTGCTGAGAATAAAGATGTCAGACTGAA
TGGTTTCACCTTAACATGGGGGAAATTGTTGCTTCTTGACATTGACAACTAATTGCATGG
GTCTATTCTCTTTTATACTAATGTATACTGTATGTGACACATTTCATGCTTTAATCTTAT
TTGGCTCTGATGCCATTGCTACTGAGTAGCAGCAAGTAGCAGAGTAATGATTTTGGTTCC
TTCAATGCAGGGTTTTTTTTTTGTTTTTTTTAAGGGTGGAATTGCTTATTTGCCCATTGG
TTGGCAACTACTGAGTTAGCCGCCAATTATCTATGTTTGGACTCAAACTCTAGATGTGAT
CCACAGTTGACAAAATATGTGCAGGGTCCCAGAAGTATGTGTAAAAGTGGTAGTTCACCT
CTAACTTTTAGTATGACATAGACATTGATATTCTGAGACTATTAGAAACTATTTTTAATT
TTTTTTGTGGTTTTTCAGTTATTTTGCTTTTTGCTCAGCAGCTCTCCTGTTTGGTTGCGG
GGTCTTGTTTAGCTTAGCAACCAGTCTGTGGTTTGAATGAGACTGAAATATGAATAGGAG
AAGGACTAATAAAAAAAAATATAAGGAATAAAGTAAGAAAAGTTTTCTGGCTGCTGGGGT
CAGTGTCCCCCATTTGAAAGCTGGAAAGATGCATCCTTGCCAAATGAGCACATATCCGGT
ACACTGCAGGCTAAACTTTTAGATTTGTTTATATGCTCTCTAAGATTACCCATAATTACT
TCTCTCTTCCCACAGATATAACTCAAAGAGGAGACACTGGAGAAGGACCAAGCTTGGCCT
GTAAGCTGTAGTGAAGCAAGGATGGCTGAGAGTCGATGGGTTCCTTATGAAAACCTTCAT
TTGTCACTCGAGTCATTGTTACGTGGCAGTTTCTGCTGTATCTATTTGGAAATAAAAAAT
GTCATCTGTTCTCAGTCTTATTGCATTTATGTATAGAAAGGTTCTGTTGTATGCCCTTGT
TAGGTGCTGTTTCCCTGGCAGAAGGCGTACTGTAATGTGCACTTAATACTGTAATGCAGG
CTTAAATTAAAAATTAAGGACCTACGAATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved