Xenopus_tropicalis Locus Mono:5:SNORD53
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Mono:5:SNORD53
Xenopus_tropicalis
Mono:5:SNORD53
scaffold_372
SNORD53
1001..1078
2078
TGTGTTTAATGTTGGGGTGCTGGGTACCCTATAATGGTTTCGGCAGGTTGGTGTTGCCT
TGGGGGGGGGGGGGTCGTGCTGTGATGATGATCAGAGAATGGTTTCGCACACTTCTGAGA
CCTAGTGATGTGCCAATCTCTTGGCTGTCTGAGCATGCCCACTAACCCCCTGCACCCTGG
CCTTGTAAATGGCCGTTGGGCCCCCTCCCCCCTCGACTGTCATGGTACAGCAGCCCATAT
ATATACCCAAGGGGCTGCTTAGATACGTCTCCAATGTGGGGCTCATAGGAAAGAAACAGG
TGTTTGCATGATGGCCCCTCCCTACAGAACCACAGAAATTAGCCCCCCACTTCATTATTG
GACCATGACCACAAAGATTTGCCAGTGCCTCCTTCACCTCAGTGTAGTTCTGTTTCTACC
TTCTTGGAGCCCCAGGTTTGTCCCCACTACTCCTTCAGTGTTCCCCTCCTTGTCCCCCAG
TAGGAGACACGGAGGTCGCCGCCCACTCTTCCTCTGCTCCAGCCTCGCCCTTTATCCACT
CGGAGATACTTAAATCAGCAGAATCCTTTAGCTCCAAACACCACTTTGTTCCCACCCACT
CTAAGCCCCAAAGATTTGCCCAATTGCTGGAGATCCTGTGTTGCTTCTCAGTGATTGGGT
AACGGCACATGATCCTGTGGGCAGCAGTAACTGTTCCCCATTTATGCCCTGAGGGTGGCA
GTGAGTGACTTGTGGCCCATGAGAAGGGCATTGGGGTAAATACCAGCCAGAATGTGCCCA
GTTCATAATAAAATGCACTTTCTCTTCCCTTAAGGTGAAAACTCCAGTTGTAAATTCAGA
CTCCAAAGTTCTAACGCCGGGGATCCCAGGTCACAGCTCGGCAATTTCAGCCGCCATGGC
ACAAACCAAAAAGCAGGAGAGCAAGAGGAAGCCCGGAGACATTGAGGTGAGCCCCCCCCT
TTCCTAAAATGGCCCCCGGGCTTTGCTTTTACCGATTGGTCCTGCAGTGATGAGTTGCCT
CTGGTTTCGCTTGTGTCCGACAAGCTGTGACGACGCATCTCTCTTGGCTGTCTGAGCAGA
ACCACCTGATCCGTTCTATTGCTTGGGGGCCCCTTGCCCGACGGTGCAAACAACTTGCCG
TTAATTCGGGCTCATTAAATAAAGATTGTTTGTAACCCTGTAGCAGCCAGTCAGCAGTTG
GCATTCAATATTGTAAGCAGATTTTTGATTGGCTTCTGTGTTAGGCACTTGGCACTCCGC
GTGGTTCTAGAATGGTGTTCAAGAATATCCGTTATTTATCTTTGCTTCCTCGGTTCCTTC
TGATTGGCTGCTGCCTGTATTTTCCAAGTCTCCATTTATCGTTAATGTGCAATTGGTCTC
TCCCCCCAGGCCAGCATAGAGGATCGGCTCGGCGCTATGGATATAGACACCGGCAAGGCG
CCGGGTAAGGGGGCTCTGCCGCAGACTGACAACTTTGCCGTGTTGCTGGTACAAGGGCTG
GAAAGTAACGACAGCAACATCCTGAATGTAAGTCTTGGGGGGGCGGCACTGTGATTTATT
GGCTGGGGGTGGGGGGTGCTTCATTACTTATCTGCATCCCTTCAGATGTTGGGTTACAAC
TCCCAGCACCCACGGTCTGCCTTTGTGCTAAAGGGCTTGAAGATTGTCCTTAAATTCCAT
AAATTCTGTCCATGGGCAGTTGGTAGGGGGCTGTTGCTATGGAGCTTCGTGTAAGTCAAG
AGAGGGTCATTATGCCTTCAGTGCCTCTTGCTCTGTGCCAAGTCCCCTGTATCAACAGTC
CTCTTGTGTTTGTGTCTTGCAGAAAGTCTTCCAGACAAAGAGCGATTCCATAATAAGGAA
GACGGTGGCCCGGATTCCGGTTTATGCCGTCATCCCCCTGGTGCACGAGGTGAGATTCTG
CTTTTCCCGTGTAACCTGAGAGTCAATGGGGCAGTAAGGCCCCCCATTCCATCCAACATA
TCTCCCCCCCCCCTTCCATCCAACATATCTCCCCCCCCTTCCATCCAACATATCTCCCCC
CCCTTCCATCCAACATATCTCCCCCCCTTCCATCCAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved