Xenopus_tropicalis Locus Poly:10:SNORA3
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Poly:10:SNORA3
Xenopus_tropicalis
Poly:10:SNORA3
scaffold_1468
SNORA3, SNORA3
1001..1132, 2119..2250
3250
GGAAATGCACGTGGTTAGCAGGCGGTCTCTTACTTTAACACGATGATCCGCCGCGGCCA
TCATAATGCGGCCTGTAAGTGTGCGGGTGGTGAAATTGCGCTTCCAAAGGCGCTCGTTTC
TGCTTTCCCGATTGGTCACTTTGGGCCGCTTGAAACGTGGCCTTTAGGTGTAATGATCAT
GTGGGGGTCTGTTCTGAGCTCGGTACGGCCCAATGACGTGCTCTTATTACATTTAACTTA
AGTTCCAACTGTGTCCAGTTCTTTGGCTAGTTACATGCTTAAATGCCCTTAATGTAAGTA
CGGTTTGTTCCGCCGTTAGGTCATGTACATTTGCTTAGTGGAATATATGTGAGAAATGTG
TGGTGACTGCTCACGGAGTGTGTGTATGTGCCGGCTTGCCTTCGCGTCTCCTATTCAGTC
CCTATTCATTCCCTTTTAGGATTGTTATATGAAATAACTGTAAGGGCCGCCATGAGAGTG
CCTTGTATTAAAAACCGACTAAAACCGGGTGTTAATTTCTTGGTCTACTTCTTTTAACTT
AGTAGCTTCTTCAGTTCAACTGACTGGTATGGGAAGTCCTCAGCATATATACTCTTCCAC
TAATCCAATCACAATGGCACTTTGTAACTCTTCAGAAAGGTGACATCTGAAACTCACAGA
GGTGTGAATGCTGTGGAGTTACATTGAAAGGATTACCAAAGTATCATGCAACTCTTCAAA
ACAGGTGTTACTTGTTAGTGGCATGAATGGATGTGTGAATAGTTCTGAAACTGTCTTCTG
TAGTGAAATGTCTTCAATGATTACCTAACAAGCCAAGTTGCTTTAGATTTATTTATACTA
GATATACCATGACCTGGATGAATGAAAATCTTCATAGATGTAATGGATGGATCTGAGTTT
GGTGGTGGAAGCTAGTTAGGTGGCTGCGTCAGTAACTGCATCATTGGTTTAGCCTCCGCC
ATTAAGTATTCCTTAATTTAATGTGTACTTAAGCTTAAAATGCTGAGACTAGAGTCACAT
CTTGGCATTTCTGATTGCCTTGGTGTGCTAGAGTACTCGGAGATAAACTACTGGTCTTTA
TTCACTGTTTGGATGTCATTGTCTTCCAACCAGCCACCTGTTCAGTGACAAGTTGATGAA
GCAAAATACAAACAAGAGTTTGTAGTAGTGACCACTGGTTGCTTCTTATTAATATCAGTG
GGAGGTGCAATGAATGTTATTCATGCATATTTGTTGCATGAAGCAGGTAATTGCCTTCTG
TGGAAGCTGAATAGTGCTACTGAGCTTTTTACATCTGCACTCTATAGATTTGATGGTACA
TAACTAAGCACTAATTTAATTGGCTGTTACGCTAGAGTAGCTCAATGCCTGGCTTGGGCC
AGGGCACTATTTGCAAGGACTTGTGTGCTCTGGTTTCTTCCTGCATGCCAAAAACACAGG
GCATGGTATCTGGCTCATGGTAAAATGTACCCTATTATATATTATGATTTTAAGCTCTGA
TAGGGTGTTATAAGTTTTACATTTAGTGATAGTCTTAAACCTAGTGCTGTTAATGAACAT
TGGAGTTACACTTGAAAATAAACGTTTTGCATATAAATGTTTATGCAGTTAGTAAAATTG
AAGTATCTGGGTCTTATTTGTATCTTTAATAGCCTTCCAAACTAAGAAAGACCAGGAAGC
TACGTGGGCACGTGAGTCACGGCCATGGCCGAATCGGTAAGTAAAACATGTGTATTATGA
TGTTCTTGGTTTTGTACAGCTACAGTGGAAAGGCTGAAACTTTGATTGCGGCAGAGAGAA
TATTAGCCCCCTCGTTAATAGAATCATAAGGTGTTTTTCCCCTGGCCAGACTCTTAAAGG
GAATAAAAATGCATCAGCATGGGAAGAATACCACAGCACCATTTACTTAACGCTCCAGGC
AACAGTAGCACAGACTTAGGCTTGCACATCTGGAGTTAATTCTGCAAATGTACCTTTTCT
GCCCATGTATGAGTCTGGGAAGGGTGTCCCAGAAATATAAGGAAAATGGTGGCATTGCTT
AAAGCAAAAATCCTTGTAGGGCATGAGTTTAGCTTGTGAACGATCTGCAGTCCACCCTCC
ACAGTTGCTACTTTTTGTTCCCGAGACTAGAGTCACATCCTGACATTCCTTATTGTTTTG
GTGTGCTAGAGTTCTCGGAGAGAAATTACTGATCTTTATTCACTGATTGGTTCTCTATGT
AGCTCAATCAGTCACCGGTTCAGTGACATGTGCCTAATACTTATGTTCTTATTCTGACCC
ATTTTCTCTAACTTTGATCAGCCCACAGAGCATTTCTTTGAATGTTAATATAACTAGATT
GGTCTGATCTAGCTGATAAGTTCTTGTCTTAAAGGAACAGTAACACCAAAAAATGAAAGA
GCTTTAAAGTAATAAAAATATAATGCACTGTTGCCCTGCACTGGTAAAACTGGTGTGTTT
GCTACAGTAACACTACTATAATTTATATAATAAGCTGCTGTGTACCACGGGGGCAGCCAT
TCAAGCTGGAAAAAAGGAGAAAAGGCACAGGTTACATAGCAGATAGCAGATAACAGATAA
AACACTATTGTATTCTACAGAACTTCTGTTATGTGCCTGTGCCTTTTCTCCTTTGAATGG
CTGCCTCCATGGCTACATAGCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved