Xenopus_tropicalis Locus Poly:8:SNORD26
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Poly:8:SNORD26
Xenopus_tropicalis
Poly:8:SNORD26
scaffold_782
SNORD26, SNORD27, SNORD28, SNORD22, SNORD31, SNORD29, SNORD30, SNORD31
1001..1071, 2064..2135, 2276..2355, 3113..3238, 4176..4242, 4395..4459, 4954..5026, 5661..5728
6728
GTGTTTTGAATTTTGGCCCCCTGTGCAATTGAGTTTGACGACCCTGCACTAGAGGGACG
GTCCTTTCTAAGGATGGGAACTAGTCACAACCAGGGTGCTATGCCCAGCCTGCCTCTTCA
CCAGTAAAAGTTAATCCACAAATGATGGTCAATTACCTGTCATATCCACCCATAACACAG
AGGCGCCTACTGCTCTTAATAAGCCGCTACCATAATTAGTTATATTGTATAATGGTTCCA
GCTATGTAACACGCATGCGTCGGCAGAATGTTTGCAATACCCTATTTGTGTAACAATAAA
GCATGTTGATTAAAAAAACCTCTCGGGCGCTGCGGGAACTTCTTCGCATGCGCATTGCTA
ATTTACCCGACTATCTGTGCGTTTCTTTGGCTATATAAGCTCACCGCGCCTATGCAATCG
GCCATTTGAAACGTGCTTCGATCTGAGATGGTGAGTAGCAGTCTTTATCTGTCCCTTGTG
CGGAGCGGGCCGCATAGTTCGCTGATTTCTGTTGTTACTTGGCTCCGGTTACACAGTGAT
AAGGGTCCTTTTGTTTATTTTCTATATTCATCAAGCCTGCATTTATTTTTTTTTCTCTTT
TTGGGATTGTCTTATTATTGTGAATAATATTCCACGCTGTTATACGTATTTATCTGTAGT
GTGCTTTTTACTGGTGTCGCTGCCTTTCAGCGCCAGGCATTCCCTACCTGTAGGCACAAC
TGGCATTTTGTGACCCATTGCCCTCTGCATAGATCTTGCATGTACCAGAGACCTTTAAAC
CCGATGTGCCAATGACGAGACCAATCACAGACCTGTTCTGAGAGCAATGAGGACAGCTTA
ATATCTCTGAGGCCCCATTAAATAAACCTACCTTTGTGTTTGTAATATCCACATCTTGGT
TCTAACCATGTCTTTTATGCCATTGCAGGCTGCAGCTTATCTCGCTGGTTTGGATCTGGT
AAGTGCCTTTCTCTGACTGTCGCCTATATTGCAGCCATGTGCTGCACTGATGATAAAATG
AACTCTCTCTTACTGAGTTTACAGTGGAGACAGACCTTATAATCTGAGTAGCACAGTTTG
GCAAAGGTGTAAAACTCATTTTTGTAAAAAGCAGGTTCTCTCTCTGAATTTAAGGGCCTC
CTCATAAGTCTTTATGCTTTCTTCCCTATAAACCATTGTAACTGGTAACTAATTATAATC
AAGTACCAACTTTGAAACTCTTCTGTAGTCCATTTAAAAGCAGGGATGGATGTCTCATTC
TCACCACCACCAGGCTTTAGTATTTGTGGCCTGAGATGTTGCAAACAAGTCACACTGGAA
ACTTGAGAGGCAGGATTTATTTAGGCAAAAATAAACCTTAATTATGGAGAGTATTGGGGC
AGCATATTTAACCTACTGCCTTTATAGCCTTGCAATGGCTGCATGATTAAAATGCTGTGA
AAGGTAACCCTTTGCTATAGCATTTTTTCCTAAAGTGCATAGTGCTGCTTGGTGGTGCTG
CTGCAACAACTTGTTGTTGGGGGTGGGTGCTAGAAGGAACATTTATTTCTAATCTTAGAG
TTTCAGTCATTCAGTTAACTGCCTTGACTGTGCTTACCAGTGGTCTTACATACAATAACC
TGTTCCAGATATCTGTGCCTTTTACCAAGGCTGTTTTCTAAGATGTTCAGTCCTGCATGC
ACCTCAATAGCCCCATATAATGTAATGCATACATAGCTGCTATGTGCAGAACGTAAGGTA
AATATCTATCACACCTGCATCTAGATGTTCTGGTAAATTTCATAGCTGCAGCTTAATGCT
GCTTTGCAGGGAGATTAGTAGTAATATGCAGCTCCTTACATATAATCCTTCAGCCCTGTT
AATGGTTGGAAGGCAGCACAAACTTTAACCACATTGGGATAAATGTAAAGTAAGATGTGA
CAATTATCAAAGTTTTGACTGCAAGTCGAAGTCTTATTTAAATTTGCTTCCCCCCCTAGG
GTCCCAAAGCAGTAGCTCAAATGGTGTTGATAAAAAGACTGTACAGGTGAGTAAGACTTT
GCTTTATGGTAAATTTTCATTTGTTGTCAATGATGAATAAAATAGACAAGCATATGTCTG
AATAGTATGTGTTGCCATCTTATTTTTTCTGAGAAACTGGTCCTTATTTACTCCTATTGG
GAGTCCTTACTTTCACTGACTTAATTTTTTTTTTTTTTATATTTTTGTCCAGGTGCATAA
CATGAGGCTTAAGCAGGTATGTATGCAGTCTGTTTTAACATGTTGGCTAGCCTTGTTCCA
AATGATGACTGAATGAAGTCTCGTTCGTCTGAAAATCTTTGAAGAATACTTTTAGCATGG
TGGAGTTCTGATGGAGCAGAATTCTGCTTAGTTGGGCCACTTGTGGCTTTAAAATGAACT
TAAGATGTTGCTTTTTTTCTTTAGGTGTGAGTGGTGCTGGAGTTCTGTGAAAGGTAAATT
AATGGTCTGCTATGAAATACATCTGCCCTAAAACATACTTTGTTACTCTTGTTGCTCAGA
TGTGTGCCATGCATGGGGGACTGCAAATGGGAAGTAGGCATTAGAAAAGAATCACAAGGA
GTGCAGTTTTGGCTTAGCCCTTAATGGCTTTATGTGATATGCTTCCCTGCCTTCTAAACG
TCTTATCTAGATGCTTTGTGGGCATCACATTTAAATACTGATCGCTCAATACTTACATGC
CTAGGCACATGCTTTTTTACTTTCTGCTGACCCTTATATATTGCCAAACAAGTTGGCATA
CACAGTTGGATGTCATGCGCTCCATGCAGCAACAGAACAAGAGTTGCCCCAGTTGCTTTT
CAGGTGTTGGTACACAGTTCTGTATAAAGGTACCCCCTTTTAGTGTTGAGGTTTTATTAT
TCAGTATCCAATTATCTTCATGGTCTGAAAGGATGAATGGGTTTTACCCATTAAGTACTG
GACGACAAAAGTCATATGGCATTAAGTCACCAAAGCACTGATCAGACTAAAAAGCATTCA
GAATATTAATATAATGCTTAAGGCTGTTGCTGATAGAATTCTTTATTTCACAGATGCCAA
AGCTGATGGCTCTTCTCTACAATCAGGTACTATATGCATTTTATTCAGATATGCCCCAAT
GATGAAACCTTCACATGTCCGACCAGCTGCCTGGTGCCAGAGCCTGAAAAGGTGAACCCA
CTGGTACCAACAGCTGGAGAGGAAGGAAGACTTGTTCCAGCTGGAACTGTCTGAGGGCTT
ATTTATAATAAACTGGATGTCTAATAGAAACCTTGCAGATTAAGGGGATTAAGTCCCTTA
AAAGCTCTGTACTGTTTCACAGGTTGGCACTGTTGTATACAGTAGCTGCAGTTGGTTGTG
CCATTTCCATCCTTCTGCTCATGCATTTATGGACTGGAGATCTGGAAACCCTTCATCTGG
ACCCTTCGTCTTGACCTGCTCTGTTGCAGGTATGTTACTATTGTCAACTTCACCCTGACA
TTTTTATCATACTGACTTGTCACTATGTGGTCTAACATGAAGAGCTTTGCACTGGGTTGT
ATACCACCTGGCTTGTAGAATTCTGGCCTCATCAGTTAGACTTCATATTCTGAATGCTGT
GCATTCCTGTTGCCTGTTACAAAAGGGGTGCCCTAAAGGTAGTTTGTAGTCTGTTAGATG
ATGGGCAGAGGTGATTCATGCACAGGAGAAGGCCTGCAGATTTTTGCTGCCCCCTTGCAC
TGTGGTGCTCCTGCCGGAGGCAAGTTTATTAGCGGAACACTTAAAGTACTTGAAGATTGT
CTTGCTGCAATCAACTAGTTTTGGTTCACACGGTTAAATGGGATGTAGCAAAGATGATTC
TATGTGAACTACAGTGTTCTGATGGTGGGGACAGTCCCTGAATCTTAAATATTGCCATGC
TATCATCCACTTTGTTTTCAATAAAACATTGGCTCTAACACAATGTAGAAATTATAAAGA
TGTGTTAGCAGTATAAAGTACTGAAATTAACATTTTGTCTACCTTAGGCAAAGCTATTGC
CTACCAGGCACAAGGGGAGCTTAACTAGAGTGTTAGTGGTCCCCTTGGCATAATTTATCT
TGCAAAGATACAATTTCATGAGCAAACAAGTAAAATCGTGTTATAGCTAGCTTGGCATAT
CTGGGTCTGTAGTACAGGCATAACTATAGTCTGGCTAAAACCTGATGAGTTCTATTACCG
CCCCAGTCTGATTATCTGTGACTGAATGGTATCTTCTGATTGCCTGCCAGCTGTAGTGGT
CTACATCCTTTAAATCCTGAATTACACATCACTTCTAAACTAAATTCTTCTTTTTTTTTT
TTTTTAGGTCTACTATAAGGTGTCAAACTATGCCAGGTATGTGGCTCTACTGGGTAAATA
GCTGTAGAATTCTGGTTGCTGTGATGAAACTAACTAGCTCACTTTGAATAAAGATGAAAA
GTTAAGAACACCTGAGCATCTTTTGCATAATTTTCCTTTTTTGCCCCTTTTTTAAAGTGT
GTAATTTTTAGCCTTTTCATCTGCAGATTACATGCTGTTATGTGGTTGAAACAGAGCTCA
TGGTGAGTGCTTGTAGCTTAATCTTCAATACCCATACCATAGCAACTTTTGTGGCTTTTG
CTAAACTGTTCTCCTGAAAGGCAAGCTTTATTACTCCCCAGGTAGTTGCTATGGCTGACA
CTAGGTGTAAACTGAACTGCTCCCTGATTGAATTTCAGTAGCAGGCTGCTAGAATCCAAC
CTACTCAAACGACTAGGCAGCACTTTAGTTGAGACTGGAATGTTGTGGGCAATGCATAAA
AAACGTATTCTAGTTTTTAAGCTGGAAAGAGGCAGAAGGCAAATTCTATAGATCCTAAAA
AAGACAATTTAAAACAAAATTGCTAAGAACGCTATAGGTTAAATTTAACATGAACCACCT
CTGTAACCTGATGCATAGTTTATGCCTAATGCACTGACGTGATGAATTCAATCTCATGGA
ATCTCGTTCGTCTGAATAATTCTGATGAGACTTATTATCTGACTGTGTTCTGTGTTGAAA
GTGCATGTTGCACAGTCTTATGACACTGTATAACATGCCTGTATGGTATTTGCAGGGGCT
ACTGACAAGATGCCAAACTGCCACACCGTTGATATTCAAAAGGACAGATCATTGAAGGTA
ATGGAAAGTGTGAATCGGACTATTTCTTTACACTTTTGATATGCAGTGCCTAACACTTAT
ATTGAATCAGGCACATAGCTGTTCCCATGTCTGGGACCATATGATGTGGGGGGGGAGCAT
TTTCAGTGGGGTCTCCAGTGATGAATCATCCACTATACCCTGAGCTGACACATGTTGGCT
ATGACAAGGATCGTCGCTATACTGAAGAGATTCCCCTTAGCATAAAGCAGAATACTAGGT
GGTTGGTACTATCTAACGGGTATTTTTCTTCTCCTCAGCTTGTGTTCCGAAGCTGCACAA
CTCTGGTGAGTATAGCCTGCAATCACTTAACTTGTTGTCAAACCTGTAAAGTAAATTATT
GGTCAAACATACAGTATTGCCTAACTTAAATACAATAAGTAACCTGGTGCAGTGTCAGTA
GCACTTCTCCTACAATTCAAATTTTATTGGCTTTTAAAATGATGGGGGGGTTTTAACAGA
AAAAGTACTCCTAGAAATAGGTTCAGCTGTGATGATCGTATACCGCCCCAGTCTGATGTC
CGTGACTGAGTGGTACAATCTGAGCTGCATTTAATCACTTGTGGTTTCACTTACTGGGGG
TCCTCAACAGTCTTACCCATGAGCCACATTCTAGTTTAAGTTGTAACATGAGTTCCTGTG
GGATCCCTAATAAAAGCGGATTGGCTATTTGGTAGCCATCTACTGGGCACATGTAGGAGG
CTGTTTTAAAACCAAAACTTCCCTCCAAGCAAGGAAATAAAAAAAAGCACCTGCTTTCAG
GCTACTGGGAGCAGCATCCAATGGTTGGTGAGCCACTGGTTGGATAACTGGCTTGGGCAT
TCAACATTGCTGGTTTAATTAGCTTAAGTTTAATTGTAATTTTAAGAGCCCTAACTGTAA
TCCTGTTTTCAGCTTCTACACATGGCAAATCTGCTATCCTGCTGAGGTTCTGGTGCCAAG
CATGAAACAAGACTGAAGTCTACAAATGTCATGTGGCTCTGTTGATAACCTGTAAATAAA
CTTATTCTGACTGACCTTGGTCTGTTTCTTGGTTATCTGTATTTTTTGACAACACTGGGG
CTCATTCATCAGCACTGGGCAAATTTGCCCATGGGCAGTAACTAATAGCAACCAATCATT
GATCAGATTTTTTTTTTTTATAGCCAGCTGCAAGTAGAACAATGAATGCAACAATCTGGT
TGCCATGGGTTACTGCCCATGGGCAAATTTGCCCAATGTTAAAGGACTCTGGAGTCCTGA
CTGCCATTAAGGTGTGAAATGATGGGGGGGGGGGGGGGTGTCTGTCCATAGCAATATGTT
GCAGGTAAGTGTTAGAGTGGCAGCAGAACCACATCTGGGGTGGGCCAAGCCATCTGGGTG
CTCTAGTAAACACAGCCAGCTTGCTCACAACTCTTTCCCCCCTACATGTGTATGTGGACA
CATGCTCTGATCTGGATGGGGGGGGGGGGGGGCACAATCCTAGACTAGGGGGAGCCAGTT
CCACCCTAGGCAGGTGCCCTGCCTACCTTTAGTTCCTGCCCTGACCCTCATGCTCTTAAA
GGGGTTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved