Xenopus_tropicalis Locus Mono:21:SNORA3
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Mono:21:SNORA3
Xenopus_tropicalis
Mono:21:SNORA3
scaffold_8786
SNORA3
1001..1132
2132
CTTATTACATTTAACAAGTTCTAACTCTGTCCAGTTCTTTGGCTAGTTACATACTTAAA
TGCCCTTAATGTAAGTACGGTTTGTTCCGCCGTTAGGTCATGTACATTTGCTTAGTGGAA
TATATGTGCGAAATGTGTGGTGACTGCTCACGGAGTGTGTGTATGTGCCGGCTTGCCTTC
GCGTCTCCTATTCAGTCCCTATTCATTCCCTTTTAGGATTGTTATATGAAATAACTGTAA
GGGCCGCCATGAGAGTGCCTTGTATTAAAAACCGACTAATTAAAACCGGGTGTTAATTTC
TTGGTCTACTTCTTTTAACTTAGTAACATCGGAACTCTTGCAATTGAATGTTTACAAAGC
CTGTTTATCCTGGGTTACATGGGTTTAAAATATTTATTCGAGTTCCTTTTGGTTTACTGC
TGTAATATGACTGCACATATACATTTTATGAATGTCCCCCTGTGATTTTTTTACTACCAT
CTGCATTCATTTTTTCCCCTTCCTGTGATGTTAAGGTAATGGATGGATATCTAGTATAAA
TAAATCTAAAGCAACTGGACTTGTTTGGTAATCACTGAAGACGTTTCACTACTCATCCGA
GCAGCTTCTTCAGTTCAACTGACTATGTAACTCTTCAGAAAGGTGACATCTGAAACTCAG
AGGTGTGAATGCTGTGGAGTTACATTGAAAGGATTACCAAAGTATCATGCAACTCTTCAA
AACAGGGGTTACTTGTTAGTTGCATGAATGGATGTGTGAAGAGTTCTGAAACTGTCTTCT
GTAGTGAAATGTCTTCAATGATTACCTAACAAGCCAAGTTGCTTTAGATTTATTTATACT
AGATATACCATGACCTGGATGAATGAAAATCTTCATAGATGTAATGGATGGATCTGAGTT
TGGTGGTGGAAGCTAGTTAGGTGGCTGCATCAGTAACTGCATCATTGGTTTAGCCTCTGC
CATTAAGTATTCCTTAATTTAATGTGTACTTAACTTAAAATGCTGAGACTAGAGTCACAT
CTTGGCATTTCTGATTGCCTTGGTGTGCTAGAGTACTCGGAGATAAACTACTGGTCTTTA
TTCACTGTTTGGATGTCATTGTCTTCCAACCAGCCACCTGTTCAGTGACAAGTTTGAAGC
AAAATGCAAACAAGAGTTTGTAGTAGTGACCACTGGTTGCTTCTTATTAATATGAGTGGG
AGGTGCAATGAATGGTATTCATGCATATTTGTTGCATGAAGCAGGTAATTGCCTTCTGTG
GAAGCTGAATAGTGCTACTGAGCTTTTTACATCTGCACTCTATAGATTTGATGGTACATA
ACTAAGCACTAATTTAATTGGCTGTTACGCTAGAGTAGCACAATGCCTGGCTTGGGCCAG
GGCACTATTTGCAAGGAGTTGTGTGCTCTGGTTTCTTCCTGCATGCCAAAAACACAGGGC
ATGGTATCTGGCTCATGGTAAAATGTACCCTATTATATATTATGATTTTAAGCTCTGATA
GGGTGTTATAAGTTTTACATTTAGTGATAGTCTTAAACCTAGTGCTGTTAATGAACATTG
GAGTTACACTTGAAAATAAACGTTTTGCATATAAATGTTTATGCAGTTAGTAAAATTGAA
GTATCTGGGTCTTATTTGTATCTTTAATAGCCTTCCAAACTAAGAAAGACCAGGAAGCTA
CGTGGGCACGTGAGTCACGGCCATGGCCGAATCGGTAAGTAAAACATGTGTATTATGATG
TTCTTGGTTTTGTACAGCTACAGTGGAAAGGCTGAAACTTTGATTGCGGCAGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved