Xenopus_tropicalis Locus Poly:3:SNORD93
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Poly:3:SNORD93
Xenopus_tropicalis
Poly:3:SNORD93
scaffold_56
SNORD93, SNORD93, SNORD93, SNORD93
1001..1076, 1313..1383, 1796..1874, 3179..3257
4257
CTTTTTACAAAACAGAAGGATTTCTGCAGTCTCTAGGGATAATGTCAGGCAAATGTGTG
GCTAATGCAGCCGCACTGTTAATAACCATATTCCTGGCTTACTAAGCTCTCTGCCAGGGG
TGTTATGTTATTATAGATTCAGTGCCATCCTTATTAAAATAGCACTTAACAAATTTCTCG
CTCACCATTTAATACATTTGGGTGCCTTGTTCTGGACCCTTCACTTGTGGAGATGCATTT
TTAAATAAACTTTAAAACTTGTACAAATATGGCCACTCACCACGCCACTCTAATGGCCCA
GGTGCAGCACCCCAAACCCATAGTTAGGGTAGATTAGAGAACTACAACAGCAGACAGACA
CGCATATTGGGGCCCAGTAGAAGAGGTTAAACTAGAAGCCAAGAGGAGTCAGGAGGATTA
ATGTAAAAATAAAGCTACTATTTTAAACACTTATACTGGGCCCAAAATGTGTGTGTCTGT
CTGCTGTTGTAGGTTTGCTGGTTCAGAAGATCAAACACATCCCAATGCAACCTCTGCACT
CCCTTGTCTTGCTATAAATGCAGCAGGGAACCTGGGACTCCTTGTGCACCCAAGCATGCC
AGGTCCTCTGTACTTCACTGTGCCCATAAAGAATTTCCCGTTATCAAGATAAATAGCATA
ATATAGATTTTTAACAAACCACCTTGGCAATCTCCTCAGCATTCTCTTCTCATTTCTTTT
TCTGTATAGAAATGTTTCAATGGACAAGAGCTGTGGCAGTGGAGGTGATAAACAGGTAAG
TGAGCCATATTTTCACGTTCTTTGCAGTTGTAACAACTGTTCTAAAAAAGTCAGAGCCAG
CTGCATGCAGTGACTGAGCTGCGGCATACAACTTGAAATAACCATCCGGGAATTATACCA
TGCATTTGGATCTGAATTTTTATTCAAGCATTTGTTTAAACTATACTTTTCTAGGACCTG
CAGGTTAATAGGAGGCCAAAATGAAGAAAAGATGATTAAAGTAGCCAGTGATGAGGAATG
TACTCCTGAATGTAGATAATTGTGTCTCTGATGCACTAAAGGATTTACCTGAGGCTACTT
GTGGCTTATAGCCAATACTAATGTTTCTAATGGTATTCATCTATCCAAGGGAAAACAAAG
ATTGTCTGAGTGAGAAATCATATTTCTGTTTCTAACCAAATAGTGTGACTGAGAAATAAT
GGTCTTTATTCTCTAATTTAGCTAATTTCCAGCTCATCCCTGCACTACAAGACATGACAA
ATAGGTAAGCGGTTGCCTGAGTTCTTTGATTTGGTTTTACAAGAATATATGCATAGCCAT
TGATGAGGAATGTACTCCTGAATCACTTCTGTATTTGATGTGCAAAAGGATTTACCTGAG
GCTAATTAGTCCAGTAAATGTTGCTAAATGAAAGATTTGCAGTGAAATAGATTACGGAGT
GTTTTACAGCTGCTAGTCTGGTATTTTGACCACAGCAGCCAAAGGCCTTACACCCACCGT
CACTGTTTCCTGATAAAAAGAATGGGAAGTGCTCTTCCTATGGCCAATGCTGGTGGTGAG
AGACAGGCCCCTTTTAGTAACACTCACTTCAGATGAGCAGTATTTACTGCAGAAGCATAA
CATTCCTAGAAAATTGTATCAAGACATGAGTTAAATATTTTTGTATATTTTGAGACTTCT
CAATTTTTAATATTTTTTTTCAACTATACAGGCATATATGTATGGCATTATGGAAAATCT
AAAATGCGTAAGTACTCCTTCCATAGCATACTTCCTCTTGTAAACAGAACTGTATGTAGC
CTATGATGAGGACTGTACACCTGAATGTAGCTATAACATCTGCATTTGATGTATTAAAGG
ATTTACCTGAGGCTACTTTGTCCGTGGCTAGTAGTGTCTGTGTAGCAAAGGGCCAGTTCA
CATAATCTTCATCCTGTTGTGAGCGTTATTTTGGCTGCTTCTCTCGTCTGCACAGCTTTG
TGTATTAGTGATGTTATTGTCTTAATCCCATTTATTGTACATTTGGTTTTATATGTGGTT
TTGGCATTTGACTAATTTGATATCTTGTCCATCACACCACTGAATATACAATCTAATTCA
TTAATAATTTCTCTATGAAATTATTTTCCATCCAGGCAATACACAGCCTAAAAACACTTA
GGGGCCTCCCTTATTGTCCTGCTGAAAGGCAACACAGCCTTATTTAAGATGTCTGTTTGT
TTAGCCAATGCCAATGACTGATGTACATTTTATTTCATAAATTGGTTTCAATGGACTTGA
GTCCTTGAATGTTTATTAATGGTGAAAACTACCCATACATTCTGCGGTCATGTTACCAGA
TACAATCCCATTATAATATAGTGCTGTATGTCTATGTTTACATTGAAATATATGTATTAT
AAGAATCCTAGCTCTATCCAAATCTGTCGCTTTAATGGAAGTACTCAAACAGAATATTTA
TTACTTATGGAAACAGCCTCTTGGCCATTAATGTTTAATACATGAAAACCAATGCAATTA
CTGTGGGTGATTTCCGACACCGCACTGATTTATCTTGTAGATGTGCTACAGACATTAGCA
CAAACTGCAAATATATATGGGTGCTATATAAATAAGGGGCAGTAATAATTGTTTGTGGCA
TGGTTATTCTGCTCTCATTTGTTTTACTAGCTTATGTTACGCAGGGCATTTTGACAACTG
CTAGCTGTGACAGTGGGCACTAGATGCTTTAGGTTGGTTTCAGTGGCTTATTCCAGACCT
GTTATTATACATGCATAATTTGCCCATACAGGTCGACTCATAGCACTTTCACTGATGTCA
GAAGGAAGCAACCCACAGTGAGCAGCTGGTGTTTGGGCCAACAGAAACAGTGAAGAAAAT
GTCCTGTGCCACATCATTAAAAAACAAATGTAATCCTACTGAACAAGGCATGTAAGAAAA
CCTTCCCATTTTACATTAATTTTTCTTATTTTAAAAACAGTGTAATATAGAGTTTAAAAA
ATCACCTTGCAAATCCAGTAGGTATGTGTATTATTCATTTTATTTTTAATACATTTTCTG
TCTAGCCACAGAGAAGTCTTATAATGAAGAAGAGCTGTGGAGCTGGACATGAAACGCAGG
TAAGAAGGCGATCTGCCTTTGTGTATATTTTAGCCTTGCAAAATAAGTGTGATGCATCGT
AGCCAATGATGAGGAATGTACTCCTGAATAGAGATGTTACTTCTTTATTTGATGTCTCAA
AGGATTTACCTGAGGCTACTTTGGCCAGCAAATATTACTAGAAGAATCCTGAGGAGGAAG
CTTGCAGATTTGTGTTAGAGATTTTTAGATTGTATCAAAATCTTGGTTACTTACAACCTA
GACTAACGGTGTTTGTTTCGCTTTCTGCTAGTGTATTTGGATGGCGCCCTCTACAGTTCA
GCTGCAAGGAACACGGTCAGAAAGAGTTTTGTTCTGTAAATCTGATGTGATCAAGTTCCA
TCGCTTGAGCTTTTCTTTGAAAAATCTGAGATGTATAGTGTTCTGTAAATGAATAGAAGC
AGAATTTTTCACAAATTAACCCACTGTGTTCCATCTCTTCACTATAACATGGAAAAGTAG
AAACTTCGGCACTGGCTACTTTAGTGTCCACATCACAGATTGCCTGGGATGGGAAGGGTT
AAACTGGCATAATTACACAAATGGATAGCCAAAGGTGGGCATGTGATATATTTTATAAAA
ATGATTCTAATAAAGTTTTACATAAATATCCTCACCTGTTCTGTTTGTATGTTTTATGTA
ATGCAAAACTACACAGCACATTGAGAATTTAATTCTAGACATGCAAAACATGAAAGGGAA
TCAAGTAACATGAGATGTCTTATACAGGCACCTCTAATTGTATCTGACTTGCTACAATGG
CACTTTGCCGAAATATAATTTACTGGCATGTTTTGCAGATTTTTATCCATATACTTTTCT
CCCTATTATAATTGCATGGTGCTATGGCAGTACAAGCACACTTGAATAGAGTGTATCACA
TGAAATGTTCCAACTGTTGCTTTAACAAATTGGCAGAGCGATATACTATTCTATAATAAT
GGATACAATTGTTTAATTATCTCCATTTGTCTTAACTGCTTTTCACCTTGTTGAATAAAC
CAATTGGAGATTTGTAATAAATATATAGATCAAATATTATTATGTACATCTGCCCAGGGC
AATAAATAAGCCATTTTTCTTCTGTAATACCTAAATCTGACTTTATGTGGAATAGATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved