Xenopus_tropicalis Locus Mono:11:SNORD14
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Mono:11:SNORD14
Xenopus_tropicalis
Mono:11:SNORD14
scaffold_707
SNORD14
1001..1091
2091
GGAAACTTGAGGAACTTTAAGTCCCAGATTCCATTGCTTTACAGTGGAACGAGGGGAGG
GGTTGGCTGACGCTGTGAGCCTAAGGGGGAAGGGAGTTGGTTCCAGTGAGCACAGACAAT
CTTGGTTTTCTTTCAGTCTGTGTAATAAAGACCCATATTTGATGTCAAAGCTGTATAAAG
GGAAAATAAACCCTATTTTGAGTCAGGTGTCCTATACCCTTAATGTATCCACCATTTGCT
TCTGGGGGGGCTCGTTCAGCTTCCTGCCCCCCCTGTAATTAGCCCTTCTCTCTAATCTAA
AGGCACGGCCTTGTTTTCCCTGCCCCCCCCGGGTGGGTATAGTGGGGGGTATCGTTGGGT
TTGTACAAAGCACTTTGTGGGTGGAGTCTCTCGCTTTAGCCCCTCCCCAGTTCTCCAGCT
CACAGTGATGATTGGTTTCCAGTCATTCGCAGTTTCTACCAGAAAGTTCTCCTGCTGTTG
GACTGTAACCTTCCTTGGATGTCTGAGTGAGCGGAACCAGCGCCCCTGGGAATGTGGACC
TGGTACCCCTTAATCCTTCTGACCGCCCCCCCCATGTTTCTGCCCCCAGGTGTCATCCTC
AGGGACTCACATGGTGTTGCCCAAGTTCGCTTTGTGACTGGTAACAAGATCCTGAGGATC
CTGAAGTCCAAGGGGTTGGCGCCCGATCTGCCCGAGGATCTGTACCACCTGATCAAGAAA
GCCGTAGCCGTGCGTAAGCACCTCGAGAGGAACAGGAAGGTAATTGGCTGCCGCCGGGCA
TTATCATTGGCTCCCAGTGTGGGGGTTGGGTGGGTGTGTATAGTGGGGTGTAACCCCGCC
CCCCAGCCCTGGGTGGTTCTGTACAATTGCCCCCTGCAGCTGTACTGCCTGCCCCACAGC
ACAGATACGGACTCCTCCTACTTGGGAATTGAATCTCTTTCCAATGGGGGTGCACTTTGT
GGGTGGAGTCTCTCGCTTTAGCCCCTCCCCAGTTCCCCGGCTCACAGTGATGATTGGTTT
CCAGTCATTCGCAGTTTCTACCAGAAAGTTCTCCTGCTGTTGGACTGTAACCTTCCTTGG
ATGTCTGAGTGAGCGGAACCAGCGCCCCTGGGAATGGGACTGGGTTAGACAGGGCCCAAT
AGGCTCAATAAAGCACTTGGGGGGCTGAAGGAACAGCTTAGTGTTAGACCCATTCTGTGC
CCCAAGCCCATTGGTCCCTGCGGCTGCCACTCACTTATACAGGAAGTCAGGTAATGTGGG
GTGTGGCTTTCCCTGCACCCACCCCCTTCTGTTCCACATCAGTGCGACTCCTACTGAGTG
AACAGATATATTGCTTCATTTTATGGGGCTCCCCTTCTGTGTTATGTGGTCAATAATGTA
CCCCCTACTGTAAATGATAAGGATATTAGCAGTCACTGAGGGGTTCTGTGCCCCCCATAT
AAAGGCACAAGGCTGCAGGCTGAGTTATACAGGGAACTCTGAGTATCACTCATGTATTAT
AAGGGATAATGTACCCCCTACTGTAAATGATAAGGATATTAGCAGTCACTGAGGGGTTCT
GTGCCCCCCATATAAAGGCACAAGGCTGCAGGCTGAGTTATACAGGGAACTCTGAGTATC
ACTCATGTATTATAAGGGATAATGTACCCCCTACTGTAAATGATAAGGATATTAGCAGTC
ACTGAGGGGTTCTGTGCCCCCCATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved