Tupaia_belangeri Locus ENSTBEG00000000046
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000000046
Tupaia_belangeri
ENSTBEG00000000046
GeneScaffold_4075
SNORA3, SNORA3
2107..2236, 3384..3515
4752
CAGAGAAGCTTCACAGATGCTTGCCTCCAGCCAAGGTTGGACAGGGGCTCTCTGGTCCA
GGGTAGGAAGGGATCACAGGCATGTCAGATTTCTGAGAATATTTATATGTGGTGTTTAAG
GAAAGGATTTACAGGGTCTGGATTAAAGGGACCAACAGACATAATGTCCCCAAAGCACGG
CAGTTTGTTCAAACTTGGAAGGACGCCCCCCACCTCCCGCTCCGCCAGCTTATCAGTTAA
GCATGGTGCATAGAAGCCAGATTCCATATGGCCAACCATTTTTCGAATCCCACATGGGCT
GCCAGAATTCTGAAAGGAAGTAGAAATAGAGCATTAGGGAGCGGCCAGGCCCCGCTTGGC
GGGGGTGGGGGTGGTGTATTTCTTAAAAAATGAAAAACTTAAGAGGCTACTCAAGACACA
CAAGGACAAAGAGCCCATCTAGGAGTGTGGGCAAGTGAGCCCTGCAGGTGACAGGCATTT
AGGGAAGACACCCCATCCCCACGAGCCATGAAGCGCTTCCAAGGAACAGAGCAAGACACC
AGGTGGGCACTCTGAGGACTAAATAGCGCCAAGCGATAGAGCAGACTCGAGACCAGGGGA
GGCGCGTGTGCCTGCGGGAGTGGGTCATCGGTGAGGAACTGACGGCCACCGAGGGCCTTC
GGGTCGGCCTGGGTGGTCTCTGGGCCAAAACGTCAGCAAAGGGCCTGGCCCGCCGAGGCC
GCGGCGGCGTGCGCCCCAGCGCCCGGGATTCCATAACAGCTCTCGGCTTCCGAGCGAGCC
TGGTACAACAGACCGCACGGAGAAGGGTTCGCGGCCACCAGAACTTCGCTGCGAAGGCGA
CAGCACGCCGAAGAACGAGACAGCCGGCCGACGCGCGAGACAGAAGGAGCCCCGCCCGAA
GCCCGCCTCCCCGGCCGGAAGTGAGGCCATTGGTCCCGCCCCCGCGCCCGATACCTCGCG
AGACTTCACGGCGGCCTCCCTCTTTCGTCTTAGTCGCCGACATGGTAGGTGATCTCTTGC
TTGTGTCCGCCTCCTTGCCGGCGAGCCCTGGTCCTTATGTGCCCTATCCAGCTACCCCCG
ATCTTAATCGGGTATTCCAAAATGCGCTGGACGAGCTGCAGTGCAAGGTGGCCGGCGTGG
GCCCGGAGCGGGGCGGGGAGCCCGGGGCCGCGTGTTCGGATATCCCAGACGCTCAGGCCC
AGCACCCGCGCCGCCCGGAGGAGGCCGCATGGCCGGGGCTCGTCTAACTTTTCCTTTACC
GAAAGTGCCAGAAGGCAGATCCTTGACCCCCTAGGCCTGCAGCACCTTCTCGGGTCGTCG
CCCGCCGCTGTTTCTGTAGGCCCTACCTCTAAATTCGTTTTTCTGCACAGCCATCCAGAC
TGAGGAAGACCCGGAAACTTCGAGGCCACGTGAGCCACGGCCACGGCCGCATCGGTAAGT
GCCGGCTTCATCTCTCGGTCAGCCTTGGGCTCTTTTTCGTTGAGCTTATCGATATCCGCA
GATGGGTAGCTTAGAAGCATGGTAGGGTAAGGTATTTTGGTGGTGGAGTCCTATCGTCTT
GGAGAACCGTCGATTTTCTTCCCTTTTGGCATCCTTTAGTACTTGTGTTAAGTTTCACAT
CAGTGGGGGGAATAAAAAAACCAGCGAGGCACAGAGTACTGCATTAGGTGAAGTGCTTTG
GGAGTGCGGTGCTGGGACGAATAGCAAAGCTGCAGTTGTAACTGGGAACGGCATGAGCAA
GTGAACATGAGGGGGAGGAAAGGCTCGGCTTTGGCGGGAGGCCGTATGGAGGAGCTGGGG
AAAGCTGTGTTAGCCATGTAGCTTTGTATTCCCGCAGGCAAGCACCGGAAGCATCCCGGA
GGCCGGGGTAATGCTGGTGGCATGCATCACCACAGGATCAACTTCGACAAATAGTGAGTG
TTTCTCAGACTGGGGTTTCACTGACGCTGACAGCTTTGGAGGTGAGGGGCAGAGAGGGCT
GGCTTAGAACACCTGAAGCCTAGAAGCAAGGGTTCGGGTATCCCAGACCATTAAGCCTTT
TAATCACAGGCCTGGCCTGTTGCTGGCTTTTACCACATTAATTTGATGTGGAGTGACAGA
ACCCATTCCCGAGGCTAGAGTCACGCTTGGGTATCCACTGTTGCCTTAGTGTGCTAGAGC
CCTCGGAGAGTAACGGCTGGCCTTATTCACTGGCTGTGGGCCTCGTGGCACAGTCAGTCA
CCAGGTTAGTGACATGCATTGAGACCGACCTACACAACTGTTAGATTTGCCTGTATTCAT
AGAGTAGGGGATGATAGATTTTGAATGATTTCTTTAGGAGATCTGTATTACAGGAGTGTG
TGGATTTTCAGTAAATCTGACATGGGACCTGAATTTTAGTTTCAGTCTGTCTCAGATTTT
CTCGGTGATTTACTGCTTCTATCAAATAAGGCTAGCTTTTCCTCCTAATATTCTTTGGTG
TTTCTTAAAGTTTTGTTGAATTCATCCAATGCGCCAAGTGCTTGTCATGTTCTTGTCACG
GATACACCAATGAGCAATGTGTACACTGTATGGGGGAGAGTGCATAATATTACTGTAAAA
CTGATGGACAGTTTTTATCAATAGTTGGAGTGAGGTTATGAAAGTTGTTACTTTCTCTTC
TCAGTCACCCAGGTTACTTTGGGAAAGTTGGTATGAGGCATTACCACTTAAAGAGGAACC
AGAGCTTCTGCCCAACTGTCAACCTTGATAAATTGTGGACCTTGGTCAGTGAGCAGACAC
GGGTAAATGCCGCCAAAAACAAGAACGGAGTAGCTCCCATCATTGATGTAGTGCGATCGG
TGAGTGAACTGGATGTGGGTCCCTCTCTCCCCCTGAGCAAATCTGGGTTACCCTCATCTA
CTTACTCTGCCACCTGACTATCCAGTACTTACTTGTTTGCCTAAACAGTGCCACCCTTTG
GTAAAATTATTATAAATCAGTGTCCAAAGTGGAATTTTTCTCCATCCCACTTCATGCCTT
GCTCCTATTTACCCCCTTAGAAGTGAAAATCCAGGAAATGTACATCCATCAAATGTTTTG
CTTATGGTTTGGGCAAAACATTTTGTAGAATAATCCTCCATTTAGTTCATTTTCACTTGT
TACTCAGGCTATACATTATCTTAAGAAGTTTTACCCCCAAAAGAAACAATTTCTGTATAT
CATTGTGGGTTCTTAACAGAGGTGTAGTAGTCTTTTAAAAGCAAGAACCCTAGAGAGACT
TTAGTAAATGTTAAATCCCCATTCCTAGCCTATTTAATGTCCCTTGAGCAGTTTTTGGTG
ATCAGAACTTGGAGTAACGCTAAAAATGTAGGTGTCCATTTTTGTCTAGCAGGGTAAATG
AGCTGGATAGAGGGAGGGTTTTTTACCGAGACTAGAGTCACATCCTGACACAGCTCTTGT
CCCGGTGTGCTAGAGTTCTCGGAGAGAATCTCCTGGTCTTGATTCACTGGTGGGGGCAGT
CAGTGGTCCCTGCTAGTGCCCAGATCAGAAACATGTCCTACGTGGGTCTCAGGAAATGTG
AGTTGGCAGGTTCCTTTTCTTACACCCATTCTGGAATTGGTACCTGCTGTGGTGTGTAAT
CAACCCTTTTCTCTGCTCTTCTAGGGCTACTACAAAGTTCTAGGGAAAGGAAAACTCCCG
AAGCAGCCTGTCATCGTGAAGGCCAAATTCTTCAGCAGGAGAGCCGAGGAGAAGATTAAG
GGTGTAGGGGGTGCTTGTGTCCTGGTGGCTTGAAGCCACTTGGAGAGTCTGATTAAATGC
TAACAAGTGCTTTTTCCCTTGTGTTTGAGTAGGTCCTTTGTCATGCATCTCTACATCCCT
AACTATGTTGGAAACCAACCTAATTGATTCTCAGAGTTAGGGGGGTGTAAGGGTATGGCT
CCTCTGCTGACTCCCTCTCAAAGTATATGCTAGGTAGCAACATCAGGTGTTGGCCAGTTA
AAGCATTTTTGTTTATAAATTGGAAATGATACTTGGTGATAATTGAAATACCTGATGAAA
GCTTGTTGCATTGTGCTCTTAGTTTTACAGTGAATGGGAAAATTGAGATGGCCTGATTGA
AATGCCATTTGTGTGGTACTCTTGAATTTGATCGTGGATCATCATTTAGCAGTGGATTCA
ATTATAAAAAGCAGCTGTCAGATTCACAGATCCCTGTGCATAGGATTCTTAATGTTCAGA
GAAAGATTTCACATCTGTCACAATAACCCTTTGGAAGACGTTGGGGATCAAATACAAGGA
AGCACAAAGGAGAGACTGAATTGACTTAGGAGTAAAGAATTACTAGGAGTCAGGGACTTT
ACCTGATTAGATAATCTTATAATTGGATCATTTTGGTTTGCACGTTCTGTTATGGTACTA
ATGTAGGAGAGTAAAAATAAGGGCTCTCCAATAAAATCTTTCAGAGGACTTAAATATGAA
AGCTGAATACAAGGATCTACAACATGTCAGTAGTTACCAAAGAATTAATAGACTAAATAT
TTGAATTTCCCAAGTGGGGACCTGGAAGCCAGGACTTTGAAAAAAAAAAAAAGATTTAGG
ATGGAAAAAGGATTCTGAAGGTATATGGAAGGGGGTTTGGGAATAAGGTGTTAATGGTTA
CATTTATTAGGAATTCGTTGGTGTTTGGACTTCCCCTGTGGTAGGTAGCATGACTACAGA
TAGGACAAGAGATGGGACAGAACCCCACCCCTAGATGCCAGTGCTAGTGGACCTGCTAAA
TGCAATCACAAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1370..1433, 1837..1912, 2644..2818, 3624..3752
1001..1003, 1370..1433, 1837..1912, 2644..2818, 3624..3749
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved