Tupaia_belangeri Locus RPL3
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri RPL3
Tupaia_belangeri
RPL3
GeneScaffold_5877
SNORD43
1479..1542
13369
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACTGGGGTTTTATCCT
TTCAAACTTCGAGCCGCTGAGCGCAAAGCAACTCCTTCTAGCCCAGTGAGCCTGCGTCTT
CAACGCGGGATGACAGCGACACTGGCCTGCTGTGTAGGACTGAAAATGGAACCGCGACCC
TTTGGAAACTGGAGCGCACAGCAAGGTTATTCAAATCTAGAAAGCGACCCGAAATCGCAA
AACGTAAAGGGACAACGCGGCCCATTTTCCCTTCATCGTCATTAAGTTTGGCTGCTGCCG
AACGCCGTAGATAAGGCCACACACCGAAAGCCCTTACTAGATTTTGGCCTCGATTACTCT
CCGTACAGCTCCTCACTGGTGTCTCGGAAACAGACGTCTACCTCGGAACGAACGCCGGGT
ACGGAAGAGCGTGCGTGGGAACACCACCCAGCACGCGCCCCCTCGATCCGGCGTCCGCCG
CGGACGCGCGCACGCACGCCGGAAGGGGCGGAGCCAGCCCTGGCTTTATAAGTCGTGGGA
CTTGCACAGGCCGACCTCTACCGGCGGGTTTTGGCGGCGAGATGGTAAGTGTTGTTATGT
CGGCTTTCTTTTTGCCTCTCGCGCCGGCAGCGCACAATCCGCGGCTAATCCCGGCCATCT
CCGCCTGGCCGACGCTGGCTGCTGCTCTAGGAGCACAGCGGACGCGACGGGGCCCGCGGT
CAGACCTATTTTCTGGAAACACGCGAGGCCTGTGCAGAGGCGCGTGGAGGCTGGGCCTTG
GGCCTTCGTGTAGGCGGAGGCAGGCCGTGAGGCGGGAGCAGGCCCAGAGACTGACTCTTA
CAAGTCTGGTCATTTCTGAGACCTGAGCGCGCACGTTTTGGCGTTAGTAACGAACGGCTA
GGGCCCAAGAGCGACTTGGCCAGGAGGGCCTTGGGCACTGCGTGCGCTGTTAAACCGGAG
CAGGCAGGGGAAAGGGGAGACTGCCGGCTCTCGCAGCCCCCAGTCTGAAATACCTGGGCG
GTCGGTGCAATTCGTAAGGCCTCTGGAGTTCTCAGGAACCACATGTGATGAACTTATTGA
CGGGCGGACAGAGACTGTGTGCTGATTGTCAAGTTCTGATTTGGCTCCGTGGAGTTCTAG
CGGCCTTCGTTTCTTATCCTAGCTCCTGTCGAGGAGCCGGAGGGAGCCCGGTGTTTGATG
CCAGTACTAATGGCGTTTTCGTCTGGTGCTAAGAAATGTAGAATGAAAAATGAAAAGATT
TGGCATGTTTAGCACATGTTTTGTTGGACATTACTTTCTGGATGTGTGATCCTGGAAAAG
CAAATTGAAAATGCTAGATGATCCCATTGCTGGGCTGGGTGTTGGGTCGGGATTGGTGTT
CTTCTTGGGAACGGTTAGCACCTGGGCAGCTGGGTGGGCCAAAAGCAGTGGCTGCTTTGA
TCTGGTTGCTAATACTGGTCATTTCTCCCTAGTCTCACAGGAAGTTCTCTGCCCCCAGAC
ATGGGTCCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATTTCTGGCGGCAAGGT
GGGCCGAATCACCTCGGACGAGAAGGGGAGAGGCCAGGGTCCAGTACGTATACACTGTCT
CTCCTGAGTTGGGGGGGAGAGGCTCGGAGAACTGGGGCTGCACTGTCTGAAGGGCAGGTT
TAAGGGGAACCTGTGGGTTGTCAGAACCTTATTGCAAGCAGAATAGTGGTGGTCACTTTT
AGGGCTGATGAATTTTTTTCTTTTTCTTTTCTTTCTTTTTTTTTTTTTTTTTTAAGAATT
TTGTTTTTTAAAATTTGTTCAGAGAGACCGAGAAAGCAAGCCATCAAGTCGGGTGCTTGA
ACCGTGATTAGCCATGTGGGAGTACAGTGCCTTGATCACCACCACCTGCCAGCCCCAGGG
CTGATGAGTATCTAAAGCTGTTGATGGTCAGCACTACTCTGTTGAGGCAGATAGGTTTGT
TAGGGTCAGGAACTGACTGTTCAAGAGCCACAACATAGAGCATCTCCCTAACCAAAGCAG
TCTGAGTTGCTGAGGCCGGAACACCACCATTCATTCTGTGGCATGCTGGTTGACAGCCTC
ACCTGAGCTTGAATGATGCCCACGTGGCTGGGTTGTGGGACGTTCAGAGAAGCCACTGGA
ACACAACACTGGCTACTGAGCCATGGCTGATACCGTGTTAGACACTGCCTGTCCCCAGCT
GAGGTCAAAGCTGTTTCCTTGGTCACTTGTTACAACTCAGGCTGTCTGTGTCATGTAGAT
GAGTAAGCCTGCTTTTAGAGAGTAAGGTTTGATAGACTGAAGCCAGCAGGTATGCAGTAG
GGACAGTCCAGGCTGCTGGTGTTAACCCCACTTCTGCAAGTGCCCTGTTCTCTGAAACAC
CTTGCCCTCTTGCCCTAAAAGGGCACATTTTCCTACGTAGTGCTGCAACCTGGAGGAACT
TTTATCTGGCTGCTCAGTCCATACGTTTTCTTCACAGAGGTGAACAAGAAGGAAGTAGTG
GAGGCTGTGACCATTGTGGAGACGCCACCTATGGTGGTGGTGGGCATTGTGGGCTATGTG
GAAACCCCTCGAGGCCTCCGGACCTTCAAGACCATCTTTGCTGAGCATATCAGTGATGAG
TGCAAGAGGCGCTTTTATAAGAACTGGTAAGTGAGGAGGTGGCCAGGCCTAGGGCCTGAA
GGCCAGGGGCTGGAGAGCAGGGCCTTTTCAGTCTAGCAGAGGAGGAGCTGCTTTGATTGC
CTCTTGAACAGAAATTTAGCTAAGGGCACCTTGACCAGGGATTTCCGAGCTAGGAATTGA
CGGCTGTTGTGTCAGCCTAGTGGATGCTGGCTAAGGCTACAGGACAGCAGGATGAGTCTG
CCCATGTCTGGGTGGCAGGGCCTTCAGTCCTGACTTGAGATTCCTGTTTTGTCCATTACT
GAAAGCTCCTACCCTAAGAGGTAGAGAAGGGAGCCTTCTAGCACCCGGAGCGAGTGTGTT
TGAACATATGCGACCTCTATTAACCTGTGGACCTCTGCTCAGCTCCGCTCGGCTCTGCCC
GATGAGCTCCATCCAGGCTCCGCTTGCCGGTGGAAAAGGCTCCTTAGAAGCCGGCAATGA
GCCCCATCCCCATGTGCCAGTGTGCCTTCCGCTCACCCGCCACGGGTGATGAAGGCCGGC
ACCCGGCCCTGCCCCAACTCTGCTCTGCTCCTGAAGGCATAAGTCTAAGAAGAAGGCCTT
CACCAAGTACTGCAAGAAGTGGCAGGACGACGATGGCAAGAAGCAGCTGGAGAAGGACTT
CAGCAGCATGAAGAAGTACTGCCAGGTCATCCGCGTCATCGCCCACACCCAGGTAGGTGC
CCGTGGGTGCGGGAGCACGAGCAGTTAGTTGCCTGCTGTTGGGTCTTGGATGTGACCCTG
GTGACTTGAGGTTTCAAATACCACATGCACTTTTGGGGGATGGGGGATCAGTTATCTTCT
GGTTGCTCCTCAGCTCACGGGGCTTTTGTGTCAAACCTCAGGATTCTGGTAGGAGCTAAG
ACTGATCTGGGTTCTTTAAACCGTGGAGGAGATAAGCCTGGGAGCAGATTGCTTGAAGTT
GGACAGAAACATAGCCCAGCAGTTGCATTTCCCATAGGGTCTGGGTTCCGGGGGCCATTT
GAAAGACTGCGTTGTCCAGTTCCCCCATGTTTGTGGGTAGTCCCATCCTTACCAGCAGAG
GGCACTGTGTTCTTACTGGCTGTTAGGGAAACCACTCCCGGTTGTAGGCACATTTAACCA
AATGGCCATAGGTAGTCCATCTGGTAACTCAGGATTAGGGTGGTGAGATACAGCCGTCCT
TCCAGTCTGACTTGGTCTGAGAAGTCCTCTTGCCTTGGTTTGAAGGGGTGCTGTGAGTTG
TGTTCAGTGCAGTCCATGTGGTTAGGGGCCAGTAGGTTAGGGCTTATATATAGCACATTT
ACACCACTGGCAACATTGTTTCTGGGTTCTGCATTGGCTCCCAAAGCCAGCTGTTGGCAG
AGTGTGGGAGATGGTAAGTTCAGACTAGAGCATGATGCCAGAGGAGTGGCCCAGGACCAA
GAGGAACCATGGACTGCATGGGTCCCAGATTCTGCCTAAATTTGCTTGTCTTGACGTGGA
CCTCGTTTGACTCATCTCCACAAGGGTGCATTTAGCACCAATTATGTAAAGTCCCTTCAT
TTCGGTGAGGGCCAGAGTGGTGCTAAGTTAACCACGGGTCGCCATGTCCTTGACATCAGC
CCACATGCCCCAGGCTCGGTTCCTCCACCGGGGAGCACCAGAAGCTCCAGTTTCTGAGCC
ACGTCTGTGCCTCCTAGATGCGCCTGCTTCCCCTGCGCCAGAAGAAAGCCCACCTGATGG
AGATCCAGGTGAACGGGGGCACTGTGGCCGAGAAGCTGGACTGGGCTCGGGAACGGCTGG
AGCAGCAGGTCCCTGTGAACCAAGTGTTTGGGCAGGATGAGATGATCGATGTCATTGGGG
TGACCAAGGGCAAAGGCTACAAAGGTGAGTGGTGCTGTGGCCCCGGTTGCTGTGGTTACG
GGTTGGGGGGTCAGGATCTCGGGCTCAGCTGTTCAGTGATGAGGCCCTGGAATGAGCGCT
GGGCACAGCGCCCGAGACAGACTGCGGAACTCTTCCTTGTTGCCTTCCTTCTGAGAACAG
CCTTGTGGTCAGAATGGCGGGGATGGGGGGCAGAGGACATCTCTTAGATGCAAAGGGGGC
TTCCCATTATGGAGAGCTTCATGGATGCCCTTAAATAGGACCACACTGCTTCAGAGCTAT
GTCTTTGGTCTGCTCTCATGCCACATCAGAAGATGGGGTGTGCATGTTGGCAGATGGCTT
ACTCAATATGCGCAGAAGTAATCTCACATCTGTTCCTCACGGTCACGTACTCGTTGGGTG
GTAAGAGCACGCCATGTTCTAAGAAGTGCCAGAAGTGAACTCAGGTTGGGCACTCACAGC
AAAAATTATATATTAGAGGCCAGTGCCAGGCCCCTGACGGTAGAGTAACAGCATGCATCC
CTTGCAGGGGTCACCAGTCGCTGGCATACAAAGAAGCTGCCCCGCAAGACCCACAGAGGC
CTGCGCAAGGTTGCCTGTATTGGGGCATGGCATCCTGCCCGTGTGGCCTTCTCTGTGGCA
CGTGCTGGGCAGAAAGGCTACCATCACCGGACTGAGATCAACAAGAAGGTGAGAGCTTGT
CAGGGCAGCATCCTGGGAGGGGAGTGACGAATCTGCCCGTGGCAGTGGGTTCCATTCCTG
GCGTCACTGTTCTTTTGACTGTACAGCTTCCGAGCTTCATGTGGGTCTTAGCTGCTCCTG
TTGGGGTTTGGGTTTCTGGGTCATGGGCATCAGGATGAGTGAGTAACAGAACACAAGGGT
GTATCAGGCTGACGCTGCTGGGACTAGGGTGGGGCCTGCCCTTGGTCCTGTCTCCAATGT
GGTGGTTGTTTTTTTTTCGCACGCACATGCGCTCACTCGCCAGAAAGATGGATAGACAAC
GAGAAATCACTCTTCGGGTGATGGCCATGCTGCAGTCCCTTTTCCTCTATTCTCGGAATC
TTGAGTACGCATGCACAAGCGCCTGGCGTGAGTTTTAAGCCACCAGGTCCAGGACTTGAA
CTGCAGTCGACTACATGGGAGTTCAGCGACGTAGCCCTTTACGCCAACTGCTTGGCCCCT
CCAAGGAGGGTTTTGAGATGGCTGCGTGGCTGCACAGATGGAGCCGAAGTTACAGTCCGG
CGGCTCACAGTCCAGTTTTTGCAGACCACCCTACTTTTTTGTTTGCTTCGAACCTGGGTA
CCTGGTTCCTGAGGCCAGAGCCATATTCCTGCTGGCGAGCTGTGTCCCTGATGCCTGCCT
CCTGTCCCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATGGCAAA
CTGATCAAGACAACCGCCTTCCACTGATTACGACCTGTCTGACAAGAGCATTACCCCCTG
GTAAGGCGTGGGCACTGCAGTTTCCCCTTGCCTGCTTCGGGCTCTGCTGGGGGACTGATA
ATGTTGGGGCCACGCTGACTCGGGGAACTCTTCATAGGGTCCTTCTGGGCCCTTGCAGCA
CCCAGCTGTTCAGTGATGAGGCCCTGGAATGAGCGCTGGGCACAGCGCCCGAGTCATACT
GCGGAACCCTTCCTTGTTGCCTTCCTTCTGAGAACAGCCTGGTGGCCAGAATGGCGGGGG
CTGGGCAGAGATGGGACTACGGAAACTGAAGGAGTCATCTGTGGGATGGTTCCCTGTTGT
CCTCCGTGATTTCTGCTGACCCACAGCTTTGTTTCAGGGTGGCTTTGTCCACTATGGTGA
AGTGACCAATGACTTCGTTATGTTGAAAGGCTGTGTGGTGGGAACAAAGAAGCGAGTGCT
CACTCTTCGCAAGGTGGGTGAACTGGGCCCTTCCCTGTGCCAGGGGTTCACCACCTGGTG
GGGTGGGAGGAGAGTTCAAAAGGAGGGTTTGATGTAGCTTTGAAGTCCTGGGACCAGGAA
ACGGCCAGTCTGGCCTTGAAGAGCTGTTTGCTGCTCTGTCCTCATCCACAGGCCTCAGCC
GGTAGATGGTGTCTCTGTGGGGCTGGGTTGATCTACGACCTCTCCAGTGTAGGAGACACT
GAGATCTTGAGTTGGCGCGGAGGAAAGCTGCTTAATGCCAGAGGTTGTGTGAGCGAAGAC
CCCCAGTGGGCCTCGCCACATCACAGACCTCTTTTCCTCCCAGTTCTCTGTCTATCAGGA
TCCTGGGCACACGTGCACTGGGCATGTTTTTTATTGAGATCTCTGGTGTAGGACTCATGC
TCTTGCCAGAGAAAGTGAGAAACGCCCCCCCCCCCTTGGGGATGATCACACCACAATCTC
TTGTTCATTCTCTGGGGATCACAGGTGCACACACCATGGACCCAGCCTGAGTTTTAAGCC
ACTGGGTCTGGGACTTGAACTGTTGTTGACTTACTGGGAGTCCAGCAATGTAACTGTTAC
ACCATCTGCTGGTCCCGTGGGCTTGTTATTCAAGTGTCAGATTCAGAAATCACAACCAAC
ACCATGGTTGGTCGTTGAGTACCCGTTTTCTGCGCACATGCCATGAGACCAGCCTCTTCA
CTGTCTTAATGCATCGCCCTCTTGGCCCACAGACCTTGCTGGTGCAGACCAAACGGCGGG
CCTTGGAGAAGATCGACCTCTAGTTCATTGACACCACCTCCAAGTTTGGCCATGGCCGCT
TCCAGACTGTGGAGGAGAAGAAAGCATTCATGGTGAGGCCTCTCATTTGCTCATGCTGGG
CTTGGTGGGGCTCCCGGTAGCCAGTGCCAAAACGGTGCTTGTAATGCTCCGCCTTATTCC
TGTGCCAGCCTCTTGGTCCCGTGTGCCGGACTGTGGTGTCCACCTCCTTCATCTGCCTCT
AACCTCCCACCGCCTCTCTCCACAGGGACCACTTAAGAAGGACCGAATTGCAAAGGAGGA
AGGAGCTTAACATGAGCAAAACCGGCAGCCGGTGGCATCTCAATAAACACTGCTTCCTAG
TGACTGCCTGTGCCTCTCTCTGCAGGGCCTGTGCTCCCTGCCGCCTGTGCCCTCCTTAGC
CTTCTCAGGCTGCTCTTAACACCTGCCCGCCTCCAGCCTGCTTGGAGGGAGGTAAAAACC
AAAGCAGTGCCTGGGTCTGCCCTGCCCTGCCCTGGAAACCAGCCCGGGGCGGCGGCCTTT
GTGCAGTGTTTGTCACCAGGGCGAGGCAGCTGTAGAAGTTGTTTGCACAGCTTGGGTGAC
ACTAGGGCTACAGAGGGGAGGAGGGAGGCAGAGACTTGACATTCCCTGGTGGTGCTGACT
GGCATGTGTGCTGCACCGTGGACTCTGGATCTGTTGGGTGTATAGAGAAGTAATTTACTT
AGATTCCAGTTAAGGCTCACTGAAGTTCTTTATTACTTGAGCCTAGATCTGGCCCTCGGG
AGGGTAGTGGCACACAGAGGCCTGCAGGTCACCTGGATCTTTCTGGAGTATCCCTGGAGA
GGCCTCTGCCAGCTTTATACAGGGGCGAGCAGCCAAGTGCAGCTTCGCCCGTAGGTGGTG
GGGCTGTGTCCATGCTGAGTGTGGGTGGCTGTCCAGAGGGCCCTGAAACTGAAGTGCAGC
TTCTTCCCCCATGTGTGGACCATCCCTTGTTGGGTTGACCTAGCACAGTCTGGCTGGCTG
GTCTGAAGCCAGGTGGCTTCAGCCACACTTCTGCCACCTTGGAGAACAGCTGATCTGGGG
CCGTCTGAGCTGGTTTTGTTCCAGTGGTACCCTGGCCTGGTGTGAGGTCCCTACCCTGCC
CAGGTGGCTCATCCAGCTGGGGTGGGAGAGCCTGTACTAGTACTTCTAGAGGGACTGGTG
CTCTGCCCCAGGTGTTTCGGGAGTCTGGGCCCAGGTGGTTTTAGTTCAAGGAGGTGAGTG
GTGAGGCCCTAAAATGTCCCAGCAGGTGGACTAGAGGTTGGTGGTTACAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1892..1928, 6235..6340, 6354..6363, 6366..6402, 7297..7465, 8016..8151, 9137..9323, 9847..10007, 10758..10817, 10819..10851, 10854..10859, 11197..11292, 12032..12079, 12083..12151, 12325..12369
1001..1003, 1892..1928, 6235..6340, 6354..6363, 6366..6402, 7297..7465, 8016..8151, 9137..9323, 9847..10007, 10758..10817, 10819..10851, 10854..10859, 11197..11292, 12032..12079, 12083..12151, 12325..12366
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved