Tupaia_belangeri Locus WDR57
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri WDR57
Tupaia_belangeri
WDR57
GeneScaffold_295
SNORA5
1387..1520
44903
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGTAACCCCCCCCCCCACTCTTGGTCACTAGGCCCTTCAATCCATATGCTCCCGGCC
AAATATCGCCCGACAGGTGGCGCCGTCTCCAGAGTCCCAAAGGCATCTCAGGAGTGAAGG
GGCCCTTCCCGCTGTCAGGCATCTTCCCTTCGCTGTATGTACCGACAGCCCTGTCGCACA
GCTGCGCGAGCATAGGGGTTCAGCATATTTCACCCATAAAAAGCAGCGCGCGGAGGAGGG
ACGCAGCTCGGTCACCAATCTGGCATCGTCTTCTCCTGACGTCAGGAAGATATGGCCAAT
AACAAAGGACTATCTAGAGGGCGGTGCGGAAGGGAATCTTGAGAGCCGATTGGTTTATCC
AAGCCGGAAATGATGGAGGAAGAACTAAATTAGAGCCAATCGCGCGGCGCGCGAGGGTGT
CGGCGCGGTTAGTGGCGGCCCTGAGGAGAGCGACTGCCGCCATGATAGAACAACAGAAGC
GCAAGGGCCCCGAGTTGCCACTCGTGCCAGTGAAGCGGCAACGGCATGAGTTGCTGTTGG
GAGCGGCGGGGTCGGGCCCCGGAGCCGGGCAGCAGCAGGCGACGCCGGGAGCTTTGCTGC
AAGCGGTGAGTGAAGAAGCCGGCGGCCTTCGGCCCTCGGCTCCCCTTCCCCTCAGCCCTG
TGCCGGGTGAGCCCTCGCCGGCCTTTTCCCGCACTGCGGAGCGGATCGAGGATGTCTCCC
TGCACTTCAAGGGTGAACGCCGTACGGATGCCCATCTCCCCCGGCGCGCCGTACGTGTGC
GGGCTACAGCCGGTTCGCGGCCCCCCGGCCCCCCGGCCCCGAGGTAGCAGGTGAAGCAGG
GGTAAGCTGCAGTCTAGTCAAATTCAGCCCCATTGCTCCGTGGTGGGCGCTGGCCAGATG
GCTGCCACAGCAAGCTCCGCAGCTCATGGGCCCCGGCTCCCCTGCGCTGGGACCTGGGGA
TAAGTTTAGCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTTTGTTGTGAATGACGGAAGAAACGGGAGATTAATGATGCT
GGCGCTGGGACTTTGAGCAGATGCCTTCCCCGTTCATTTCGCTGCATTAATTTTTTTTTT
CTTTTTGAGAGAGATTTTTGGTACATGGTGTGTCCACTCGAAGAGAGGGAGGGAGACACA
GAGAGACAGAAAGTGAGAAATCACTCCCCAGCGGATTGGCCACGCGAAAGCCCTTCTCCA
CCCTCTGCTTGGGATTCTGGACACGCATGCACACACACTTGGGTAGTTCAGCCACATAAC
CATTCCTCCATCTGCTGGTTCCCCTGCATTAGTATTATTAACAACTAAATAACTGCTAAA
TATTCCTAAGAGTCAGAAACTGCCATATTCCCATTTTGCAAGTGGGAAAACAAACTTACC
TAGTAAGTGATAGAAACATATTTTGAACTTAGGATCTATGCTCTTAGTTACATTTTTTAA
AATTATTTATTTGTCCACTCGTTTATTTTTTAATTTGGCCAGAGAGATACAGAGAGAGAG
GGAAAGTGAGAAAACAAGCCACCAGGTCCAGGACTTGAGCCGTGGTGGGCCATGTGAGAA
TGTCCATCCAGCACCTTAACCACCACACCACCTGCTGGTCCCCTTCGTTACATTTCTTGT
ACAATATAGTTCTGATCACGGCTCTCCTACTAGGCCTGGGCTCACAAGAGGAAATAGGGG
ATTCCTTCCTCTCAGTTCAACCAGCCTGTTAGCATATCCTGCTAGCACTGTCCTCAGATA
TGTCCAGAATTGCTGCACTTTTAACAACTCCATCACTGCCTCCTAGTCTAAGCAATTATC
TCCTCTGGCATTATTGTAAGCAGCAGCTCCTAAATTTGCTTTCTGTTATTCTGCTCTTTT
AATGGCAGTCTGTTACCAACTTGGCAGCCTGAGGAATCTTCTAAACCACAGATCACATTC
TTTCTGTTGGAAACTCTTGACTTTACACTTTATTCACAGTAAAAATCAAAAAACTTGATA
ATCATTTGTCCTCTTTCCCTTTACCTCTGACCCACCACTTTTTCATTGTTCACCTAGCTA
CAGTCCTACCTGTGTCATCCTCCTGCTTTGGGACCTTTGCATTTGCTGCTCCCACTGTCA
GAATTTTCCATGGTTTACATACTTAGCTTCTATAAATCCTTGCTCAAATACCTCTTTTCC
TTTTTCTTTTTAAGAATTATTTAAGGGCTGCCAGGTGGCTTGGTGGTCCCACATGGCTGA
CTGTGGTTCCAGTCCCGGACCTGGCAGCTTGCTTTTTCATTTTTCCTTTCTCTCTCTCTC
TCTCTGGCCAAATTTTAAAAATTAATAAGTGGAGATCAGCAGATTGCATAATGCTTATGT
TGCTCGACTCCCACTTAGTCAACCACTGTTCCAGACCCTGTGGCTTAAAGCTCAAACCAG
GGAGGCCAGCAGGTGGCATAGTGGTTAGGGTGCTGGAATTCCCATGTGGCTAACCAGGGT
TCAAGTCCCAGGCCCGACAATTCGCTTTCTCATTTTCTCTTTCTGTCTTTCTCTGGCAAA
ACGCATGTGAAAAAAATATAATAACAACAAATAAATAATTCTTAAATTAAAAAAAAAAAA
AAACCTCATACCGTGCATGCATGTGGAGATGAGCAGATGGATTTGATGGGTCATTCCCCG
GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCAGGGGTGATTTCT
CGCTTCTGTCTCTCTCATCTCTGGCAAGTGCACGCACCCTGTAGCAAAAACTCTGAAAGA
AAAGGTATTTTACCTTTTTGCACACAATAAACTTGTTTTAGTTCTATAGAGAACATATGT
TTGTGAGATGGGGGTGAAAAATCACCCCCTGGGTGATATCTATACTGCATTCCCTTCTCT
TGTTTCTTCTCTGGATTTTGGGCATGCACAATACATACCCAGCACGGTTTTCTTTTCCTT
TTTTTTTTTTTTAAAGACTTATTTATTTTTGGGCCAGCAGGTGGTGTGGTAGTTGGGGGC
GCTGGACTCCTACATGACCGACTGTGATTCAAATCCCAGACCTAGTGGCTTACTTTCTCA
CTCCATCCCCTTCTCTCTCTCTCTCTGTCTCTGGTCAAATTAAAATAAATAAAAAATAAA
TAAAGTTCAATTAAAAAATTATAACAGTTCTTAAAACGTAATGATTTATTTTAATTTAAT
TTATTCATTCATTTATTTTAATTTGACCAGAGTGAGGGAGGGAAAGTGAAAAGGCAAGCC
ACCCAGTCTAGTATTTGAACCATAGTCAGCCACATGGGAGTGCCCAGTGCCTTAACCACC
ACATCCCCTGCTGTCTCCCCCCTAGGATGCTTTTCAAGCTGCTGAGTACAAGACTCAAAC
CACACAGCCAGCCCAAGTGGGATTCAGCTTCTGTGCTACATGCTGGCTCATACACTTGTA
TTTTAACTGTTTTTCCATGAGCGTTGTGAAGTCCCTTTGTACAACAGAGTTAATGGAATA
CAGCTGGGCATGTGGGATGCTACTTGAGTTTAAGTGACCCAGAAAAGACGTTCTGAACAA
AAAATAATTCAAAAGGAGCCAAAAACTAGTGGGGGAAGGATTTCTGGTGAGAGCAAATAT
AATTGTAAAGATCCTAAGGCAACAGTGAGTTTTAACACGTTTGAGCAGTCAGAAGTTGAC
TGTGGGTAAGAGCAGAGTCAGGGAAGGGGAGAGTCCGTGTGGTAAGAACCCATACTGGGA
AGTTCTGGAGAGTATCAGATTAGAAACATGAGTCACATGAGAAGAGCCAACATTGTCTAA
ATTGGTTGAAATCCCCTTAATTACTATTTGTGTGGTCTTTTCCCTCTCCTCCTGCCATGT
ACACACACAGATTTTGCTCTTTCTTTTGCCTATATACAATGGCTCCCTCATACTTCTCTT
TTGTTTAGGGGCCTCCACGATGTTCCTCCCTTCAAGCCCCAATCATGCTGCTCTCAGGAC
ATGAAGGAGAAGTGTACTGTTGCAAGTTTCACCCCAATGGATCCACCTTAGCATCTGCAG
GATTCGACCGACTGATATGTAAGGCATTGTTTTTTAACCTGGCTTAATTACTTTCTGTCA
GATTATGGTTTGTTTACCTTGGATGCCATAGAAGGTTATTGATCTAAGTTGGCAACATAG
CAAATTACATGGCTAGCATGCCAAAAAGTTGGAGTGTGAAAATGCTAAATGTCTTGGCTT
ATTGTTGTAGAGATCAGGGTTCATGTGATAAGTACAGAAGGCAGAAGGAAGGATTTGATT
TATTATAGGTTGAGTATCCCCCATCTAAAATGCTCAAGACCAGAAGTGTTTAAGATTTTT
TTATTTTAGAACGTACATGTATACATATTGAAATTCCTGGGGATAGAACTTGAATCTATA
CAGGAATTCCAGTATGTTTCATAAATAACATACAAATTGCCTGAAGAATATTATATATTT
TTGTATTGCAGCATTTTTTTAGTGCAACATGTTAAATGAGGTTGGGTGTGGAATTTCCCA
CTTCTGACCTCATGTTGGTACTCAAAAAGTTTCAAATTTTGGAACTTTTTGAATTTCTTT
TTTCTTTTTTTTTTCTTTTTTTTTTTTTTCTGAGAAGTTTTCGCTATAGGGCGCGTGCGC
TCGCCAGACAGACAGAGAGAGACATAGAGACAGAAAGCGAGAAATCACCCCCCATGGGGG
ATGGTCACACCGCAATCCCTTCTCCATTCTCCTCTCGAGATCTTGGGCACACACTCACAC
GCCCGGCTTGAGTTTTAAACCACCGGGTCCAGGATTCGAACCGCAGTCGACTACGTGGGA
GTCCAGCAACATAGCCATTACGCTAACTGCTGGTTCCCGGATTTCTTTTTTCTTTTAAGA
TTTTTTTTTTTTTTAAGAGGTTTTTGCTATAGGACATGTGTGCTTACCGGAGAGACAGAA
AGTGAGAAATCACCCTCTGGGGAGAATGGCCACACCACAATCTCTTCTCCAGTCTCCTCT
TGGGATTCTGGGCACACATATGTGTGCCCAGTGTGAGTTTTAAGCCACCGGGTCCGGGAC
TCAAACCACGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTTTGCTATAGAGAGCATGTAC
TTGATGCTAGTAGAGACAGAGAGGGAGAGAATGTCTTCCCTGGGGATTTTGGACTACGTA
GGAGTCTAGCGACATAGCCCTTACGCCAACTGCTGGTCCCTGTTTTTCAAGCCACTAGAT
CCAAGACTCAAACCTCTCAATCAGCTGTATGCGATCAAACTGCCTTAGCCACCAGCTGGC
CCTACAAATAGTTTTGTCAAAAAAATAACTATCGTATGCATGTGCCTCCTTGTTTGTGTA
GGTAATTCTTAACATTCACGGGGTAAAGCAGGTGGTATAGTAGTTACAGTGATGGCTTTT
ACATGGCCAACTGCGGTTCACGTCCCAGACCTAGTGGCTTGAAAATCATGGCAAACGCAT
GTGCATTCATGCTCAAAATCGCAAGAAAAAGGGATTGTAATGTGGCCATCCTCCTTGGTG
GTGGGAGGATGATTTCTCACTTTCCATCTCACTGTCTCTCTCTGGTGAGAGCACATCCCC
TATGACAGAAATCTTTTTAAAAAAATAGGCTGGGGCCAGCAAGTGACATGGTGGTTAAGG
GCACTGGACTCCCACATGGCCGACCATGGTTTGAGCCCTAGACCTGGCGACTTGCTTTCT
CACTTTCCCTCCCTTTCTCTTTCTCTCTCACTCTCTCTTGCTCTGTCCCTCTCTGGTGAA
ATTAAAACTAAATAAGTTAAATTAAATTAAATAATTCTTAAAAAAAAAAAAAAATGGTGG
CAGGTGGCTTGGTGGTTAAACGTGCTGGACTCCCACATGGCTGATCATAGTTCTAATCTT
GTACCTAGCAGCTTGCTTTCTCTCTCTCTTTCTCTCCCTTTCTGTATCTATCTCTGTTCA
AATTGAAGAAAAAGAAGAATAAATAAAATTAAATAGTTCTTTAAAAATTAAATAAATAGG
GACTAGCAGTTAGCGTAATGGCTATGTCACTGGACTCCCATGTAGTCCCCTGTGGTTCAA
GTCCTGGACCCCATGGCTTAAACTCATGCCACACGTGTGTGCATGTGTGCCCAGGATCCC
AAAAGGAGAATGGAGGAGAAGGGATTGCCGCGTGGCCATGCCCCCTGGGGGGTGATTTCT
TGCTTTCTGTCTTTCTGGCGAGCGTATGCACCCTATAGCAAAAAACTCTCAAAAAAAAGG
CAATGATAATAATGATAAAAGAATTACTTTAATAAATAAGTAAATAAATAAATAAATAAA
AATAACATTCATGGAACTTCACTACTTGTTAGATCAAATGCCCTGAGGAACCGTTTCTAC
TTATTTACTTCAAGTCTAAAGTCATTGCCATTATAATTTTCAAGTTGTGGCTTCCTAGGT
TTTCCATAATTTATATCATTTTGCAGTCAGAACAGACAAGTAGTAGTGGGTCCCAACTTT
AAATTACAGGAAAAAATATTTTCAAAAATTATATCCATCCCTTTTCTTTTTTAACCTTAT
AAATTGTAAAAATATTGCCACTTTTATTTTAGTGTCAGGAAAGTTGGTCTACTTGATAGG
ACCATTAGTGTTCCAAAGGAATATAATTTGAGAACTATTGTCTGTTAAATTCGTAAATAC
CCTCTCAGCAGCCAGTAATTCAGTTACTTTTTGCCTAATAACGCTCAGAGAACTCCTGTC
TTCCTACCAGTGTTGTGGAATGTGTATGGTGACTGTGATAACTACGCCACGTTAAAGGGG
CACAGTGGAGCAGTGATGGAATTGCATTACAACACCGATGGCAGGTGAGTACTCTGAAGA
GTGGAATGGCTCTTCTCTTACTGGCCCTTCTCAGCATCTTCGTACTTTTCATCCTTAAGT
TTCCTCTCAGGAGACCTCAGCTTCAAAACTTGCTCTATGTTGGGTAGCTTCTTATCCTTA
TGCCTGTCGCCCCAAGTGAGGGGTTTATTGTCCAGATGTGCATAGCTATAAATACGTAAT
TTCTGTCTTCTCACATCTCAGCGCCCTTGATAGATTTTTCTGTTTAAGAATATTGTGTTT
CATTTTATTTATTTCATTTTACTTTTAGTTTTACTGTAGGGCATCTGTGTTCACCAGAGA
GAATAAGAGAGAGAAAGTAAGAAGTCACCCCCCAGGGCAGGAGGCCACACCACAGCCTTC
CCATGTTCTCAGTCTCTTCTCAGGATTTTTAGGTGCACATACACATGTTCCCAACGTGTT
TTTCAAGCCACTGGGTCCTGTACTCAAACTGCTCATTTGGCCATGTGGGATGCAGCTGCC
CCACCACAGTGCCACTGGCTGGCCAGTTTTCTTTTTGAAGACATAAAGCAAAATGTAGTT
TACATGTTAAAATCAGCTACTTTTTACTATAAAAGTAGTAAATACTTTTTTTTAGGTTTT
TGCCATAGGGCACATGCACTCGCTGAAGGGATGGGGGAGTGAGTGATGCCTTTTAGGGGG
AGGACCACACCACAATCTGTTCTCCTCTTAGGAGTTTAGCCACACATGCACATGGGCCAA
GTATGGTTTTCAAGTCACTGGGTCCGAGACTTCAACCGTGCTCAGCCACGTGGGAGTCAA
ACACCTTAACCACTGTGCCACCTGCTGGCCCAATAAAACACCAAACACCAAAAATACTAT
ACATTTTTCTAGAGCCTTTTTTCTACTCAGAACTATTAGAATTTTACATATTTGCTAGAG
CTGCTTGCACAATCTCTGCTGCTTTTTTTTTTTTTTTTTTTTTTTTGAGAGGTTTTTGCT
ATAGTGTGTGTGTGCTCACCAGACAGACAGACAGAAAGCAAGAAATCACCGCCCTCCCCC
CCCCCCAGGGGGATGGCCACGCTGCAGTCCCTTCTCCTCCATTCCTCTTGAAATCTTGGG
CATGCACGCACACGCGCCCGGCGTGAGTTTTAAGCCTCCGGGTCCCGGGATGCAAACCAC
GGGAGCCATATGGGAGTCCAGTGACATAGCCATTACGCTAACTGCTGGTCCCTATCTGCT
GCTTTTTTTCATTAACATTATTCCTCTAGGGTCTGTTATCATAAGCATTGTTTTAATGAC
TTCATAATTTTAGAATGTCTATAGATAATATAGAAATTCAGTTAATCCCATTGTTGAGTA
TTTCGGTAAACATTCATTGATTTTACAACTCTGATCTCTAAAATCTTAGGGTGGTTCATC
AACTGCTGTATCATCTCATGTACATTTTCTTGGAAAGAAAGCATAATAAAATCAGTTGTA
AGTTACTTTAATTGAAACAGAAGGGGGAATAGCAATTGGTGTCGTAGTTAAGGTGCTGGA
CTCCCATATGGCTGACCACAGTTCAAGTCCCGAACTGGGCAGGTTCCTTTCTCATTGGGG
CTGGCAGGTGTCATGGCAGTTGGGGCACTGGACTCCCATGTGGCTGACCACGGTTTGAGT
CCTGGATTTGGTGGCTCACTTTCTTACTTTCCTTCTTTCTCTCCCTCTCTCTGGTCAAAT
TAAGTGTAATCATAAATAAAATAAACAGAAAATTTGTTTTAAAAGAGAGAGAGAGAAACA
GAAGAAAAACTGCTTTTTAGAGAAAAGTTCAGAGATACTCAGCTGTCGGGTTCAGAACTG
CCATAGTCTGACCACAGAGAAGGCCATTTGAGTAGGTTCAGAGTGCCAGTAGGATTTTGG
AAGCTAGAGTAAGGGATTCCTGTATTGTTTGCCAAACTGGCATAGCACAGCTAGGCAGTG
ATCTCGAACAATTTGGCACGTTTTGGCGAGTGGGAAAGATAGGTTATTATTTTTCTTCAC
TTAATTCTTTTTTGTTACTCTTTTTACTTTCTAGCATGCTCTTCTCAGCATCCACAGATA
AAACTGTGGCAGTGTGGGACAGTGAGACAGGCGAGAGAGTTAAGAGGCTGAAGGGACACA
CTTCTTTTGTGAATTCCTGTTATCCAGCCAGGAGGGGCCCCCAGCTGGTCTGCACTGGCA
GTGATGATGGTACAGTTAAGGTGGGTGTCCTCTGTCTGTGCTATCTTGTTTTCTTTTAAA
GTGTCTTCCTGTGTCCCAGTCCCCTGAGTTGCTGGGATTTGGGACACACATTATTATGCC
CAGCCCGTGGTGGGCAGGGAGTTGAACCTAGACCTGTGTTAAAGTTACAGAGGTGACGTA
TGATGAACTTCATCTTGCATTCCCACCTATGTTGTGCTCCTCTCTGTGCAGCTTTATTTC
AGCAGTCACTTCCCAGAGCATAAATGTTTTCTCTTCCATGGTCTGTGTGCTCACGGCAGG
TGGGGAAGAAAAGACCTCCAGTAGAGTGTGGGTGGCTACACTGCGGTCCCTTCTCTATCC
CTTTGGGATTTGGGAAGCACACATGCACATTTGTCTTTAAGTTCCTCAATTTAGGGTTCA
AACCATGATCAGCCATGTGGGATCCCACTTTAACCACTGGGTTATGGGTCTGTGCTCATG
GTTTGGTTTTTAATATTTATATTTTTATTTTTATTTGCCAAAGAGCACATGTACTTGCCA
AAGAGAGAAGTGAGAAAGCTCCCCCCAGTGGGCCATGGTCATGTCACAGTCCCTTCTTTC
TATCCTGTCAGGATTTGGGGCATGCATGCACACACACACACACACTTTTTTTTTTTTTTG
ATGGCCACTGGGGCTGTGACTTGAAGCATATGGTTATCCATGTAGGATCTGGCTAGCCTC
TTTTGTCCCTCTAGCTTCATTTTAAGAATGTAGTATGTAATACATACAACACATAAAATA
GTTGTTAATGGACTGTTTGTGTGTGTTATGGTAAAGCTTCCAGTCAGCAATAGGCTAATA
GCTCTTACATTTTGGAAGAGTCAGAAGTTACTCACCTTTTTGGCTGTGGAAGGGCATTGG
TACCCCAAGCTCCCATATTGTTCAAGAGTCAGCAGTATTGCCTAGCTGTGCACTTAAAAG
GTTTCAGAGCAACAATACCCCAAGAACACAGAGTCTTTGCTTTCAACTAGTATTTTTATA
AAGATGTATTTATTTAATTCTACTTGTTATTATTTTTTTATTTGACCAGAGAGAGAGAGA
GAGAGAAAGGGAAAGTAAGAAATCAAGCTACTAGGTCCAGGACTCAAATCGTGGTTGTCC
ATGTGGGAATCCAGTGCCCTTAACCATGCCACCTACTGGTCCCTCCAAACTGTATTTAAA
TGAGCTAGAGGGATTGGTGGGTAGGAATGTGTTAAGTCTGTAGGGAAAGAGTGAGGTACT
CTTTTTGAATCATTTATCTAACATCTTAAGCTTTGTTTTTTGTTTGTTTGTTTGTTTTTT
AAGTTTTTTTACCATAGGGCATGTGTGCTGACCAAAGAGAGACACAGAAGACAGTGAGAA
GGAAAGTGAGAAATCACCCCTCAGGGGGAGATGGCCACACCACAGTCCCTTCTCCATTCT
CCTGGGATTTCAGGCATGGGCACATACGTGCTCAGCATGATTTCTAAGCCATGGGGTCCA
GGACTTGAACTGTGGTCAGCTATGTGGGAGTCCAACAATATAACCAGTATGCCATCTGCT
GGGCTCCAACCTGAGCCTTTTTAGCTCATGTTTCTGTGAATGAAGTAAAAATTAGTTTTT
ATTCCAAGCCATGAGAATTAAAAGATCGTGGTACAGGTCCTCCTACCCAGGCTCTACTTA
CTGACCACAGGGTTGAATTTAAGCTAGAGGGCACGTGTGCATACAGGACGGTGGGGGCAG
GAGGGACAAGAAAGCACCCCCGTAGGGAATGGTCACACTGCAGTTCTCCATTTCTCCCTT
TTAGGATTTTTGGCATGCACACATGCTCTCCAGTGTGTTTCTCAATCTGCCTGGTCTAGG
ACTCAAACTATGCAGCCAGCCATATGGGATCCAGCCACCTTACCACCACAGCACNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTGTTCTGAACCTTGATTTTTCCT
TTTCTTTTTCTTTCCTTTCTTTCCTTCTTTCTTTCCTTTTTTTTTTTTTTTTGACTTATC
CCACTTTTTCCTGTGCTTCAGCTTTGGGACATTCGGAAGAAAGCAGCCATCCAGACATTT
CAGAACACGTACCAAGTATTAGCTGTGACCTTCAATGACACAAGTGATCAGATTATTTCT
GGTGGAATAGACAATGATATTAAGGTATGTTTGATATTTGTTGTATTTTTCACTGATTTC
TACCCCGAGGAGTGAATCTTTTCACTTAGTTTTTCACTTAATACCAACTAACAGGAAGGT
AGTAATTCGGAGCATGCTTTTGTTTTCTCCTGTTCCAATCGACTTACTAAGTCAGAGATT
GCATTGTAGCTCATATATATGCCATCAGGGACCAAGCTATCAGTGTGAAGTCCCTGGGTG
GGGGATGGTGGAAAGTAAACTGCATTCCTTGCCTGGAGGCACTCAAAATTTGCTTTTTTA
ACTGTCTTGGTTTAATGAAATGGTAGTGAATCAATTTGCAATTCTCTACTCTTACATTTT
CGTTGTCTTTTTGGTAAGTGGAGAGAAAGTTTTCTACAATTTTGTAAGAATGAGAGAAGG
TGATTGTACTAAGAGGCAATAAACCTTGTGGCAATACAGAGTTGCTCAAGCTTTCAAATG
ATTTGAGTTCTGATCCTGGTTTCACTATTGTCTAGTTTTATAACATTAAGCAAGTTCTTT
AACTTCTTTGAGGCTCTATTTTCTCATGTGAACAAAGAGGTCAGTAATAACAACCGTAGG
ATCTACCTTGTAGTGTTGCCATGGAGATTAACGGAGCCTAATATATTAGCACAGCTTGCC
AAGTTCCTGGACCTAGCAAGTACCTGTGAATGTGAATTGTTATTTTGAGACTGCATTTTG
TGCCTGCCTTTGCAGACACTTTATGGCTCCTGTTAAGGCTCTCAAAGACTTTAATCTTAC
CTTGTGCTTTATCATGAGAATAGTAACTGTCAGCAGTGCTCAGCACCCTGTGTTTTCCCT
ATGTAGCAGTTGGACTGTGTCCCCATCTCTCTATGTATTCTTTGCTGTTGTCACTGTGGA
GGAAATGTCCGTGCTTCTCTCTAAAGCTATTCCCTTAAATCAGCAGTCCCCAACCTTCCT
GATACTGGCGAACAACCTCATGGAAGAAATCCATCCACAACCTGGGTTGTGGGGGGTCTT
GTTCCTGGAATGAGCAAGCATTCACATTTACCATGCGCCTCCTCCCACTACCTCCACCAT
TGCAGGTACGGTCAAGACCAGTCACCCAGCAGTAGGATTTGCTCTTCCCGTGAGAAGCCA
GTACTGCTGCTGACCTGCCCAGAGACAGAGACCAGGTAGCAATGTGAAGGGTGGGGCGCT
ATAGACCTAGACAAAGCCTTGCTGCCATGCCTACTTCCCACTCCCTCCCCTACCCTGCTG
TGTGGCCGGTGGGGAGAGGGGGAGTGGGCAGCAGCTGTCCACAGACTGATACCAGTCTGT
GGTGTGGCTTGGTGGTTAGGGATCCCTGCCTGAAATGGAAAGATTTCAGCCCTTCTTCCT
TTCTACGACCTCTTCTCATCAGTTCTTTCCTCCTTTGCTTTTCCTATTTCTTATCATCAT
TTCATCATGTGTAGGTCTCTTTGATAAGGGAGGAAAAAAATTCTTTCAATCTCTCCTTTA
CCTCCCTCTAAGTCTTCTCCTTCCCTGCCAAACTCCTGTATTTATTTATTTATGATATTA
GGCACGTAAGCTCAGTGGAAAGAGAAAGTGAGAAATCACACAGGAAGGCCACACTGCAAT
ACTTTCTCCTCCATTATTCTCTCAGGATTTTGGGCACGTGCACATGGGCCTGGCATGATT
TTGTCCCCCCCCCCCCCAAGATGCCAGGTCTAGGACTCGAACCGTGGTCAGCCATGTGGA
AGTCCAGCATCTTAACCACTACACTAGCTGCTGGCACCTCACAGCCAGATTAAAAAAGGA
TGACGATGCAATGATAGCAGCGATGATATCACCACCATCACCCAACATGTAGTGCATAGT
ACTTTGTCTCTGGTGCTCTCAGAGCTTATTGATAACATTCTGAAATAAGTACCGTAACCA
GCAGATGGCGGAATGGCTGCGTCTCTGGACTCCTATGTAGTTGACAAAAAATGTAGTCCA
TGAAAAGACTTTATGGAAAATGTAGCAATTAAGGTGCTTATATACAAACACTATGGTATA
GAAAAGACTGGGAAGATGTACACTGAGATGTTAAGATCGACTGGATTTGGATGATGAGAC
TACAGTGACTTTTTTTTTTTTTTTTTTTTTGAGAGGATTTTGCTATAAGGCGCATAGGCT
CGCCGGAAAGAGAGAAATCACCCCCAGGCAGGTTGGCTACGCCGCAGTCCCTTCTCCTTC
ATTCTCCTCTTGAGATCTTGGGCGCACACACACGCGCGCCTGGTATGAGTGTAAGCCACT
GGGTATGGGACTTGAACAGCAGTTGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCGCCGGGTGCGTGTGCGTGCGTGCCCAAGATCCTGAGAGAGAATGAGGAGAA
GGGATTGCGGCGTGACCATCCCCCTGGGGGGTGATTTCTCGCTTTCTGTCTATATGTCTC
TCTGTCTGGTGAGCACATGCACCCTATAGCGAAAACCTCTCCAAAAAAAAAAAAAAAAAG
ATTTTCGAGACTAAAGTACGCCCTTCACAAGTTGCTGTCCCTCTTATTTTTTCCTTAGTG
TTGTAGTTAGAATCTTTTTTATTCTCCCACTTAATTGCTAGTTATGTGATCTTAAGAGAG
TTATTTTAACCTCCGAGTCTGTTTCTCATCTCTGTATGAGATTAATCAGCCTATCTCATG
TCATTGTTCTGGATTAAGTAAAGGGTGTAATGTCCTTAGCACCAGGACAGGCATGATGTC
ATGCTCAGTGTAGTCAGCTGTCATTGTCATCATCACTGTTACCGTTAGTATTAGGATATT
TAAGACTTTAGTAACATCATATTGCTGGCCACTTAGGCTGTTTCCTATTTGTCATTATCA
CGGACTGCTGCTATGGACGTATTTGTGCATGAAACTTTTATCTGTGTTTCCTTAAACTAG
ATTTCCAGATGAAAATTAATATCAAGTATAAGATGTTTTAGATTTTAGGTATAGGCTGCC
AGGTTGTTTTCTGGCAGCAAAATTTAATACAGTATTTTAAGTTAGATTGCTGTAGTTATT
CGTTTTTATTTTTGCTCCTATACAAATAAGAGGTGTGCTAGAGAAATGTGAGATTATGTT
AGAATTTAGTCAGAAAGTAGTCTGTATCTAAAAACACCCGATTAGTTATATCCTTATGGA
AGAGTAATTACTCCGGGACTCAGAAGGACTCTTAATTATCCTCAGGCCTGCATAAATTTC
TTTTAGCTATGTGAAAGAGAGGTTATATCCGTGTGGATATCTATCTGTACATGTGCACTA
GAAGTACATGTGCTCGCCGGAGAGAGAAGAGAAAGCACCCTCTCTGGGGAATGGTCATAT
GGCAATCCCTTCTCTTTTTCTCTCTCTCTCTCTCCCCCCCTCCCCCCTTCCTTCCTCCCC
CCCTCCCTCCCTCCATTTGGAGTTCTGGGCATGCACAAACACATGCTGGCATGTTTCTCA
AACTGTGCAGGTGGCCATGTGGGATATGACTGCCTTGATCACCAGGCCACAAAGCCAGCC
TGAGAGACTACCTTTTAACCAGAAATGGACTTGAAGAATGTCAGACTTGGGGCCAGCCAG
TGGTTAGGGTGGCTGGATCCCAAAGATCAAATGTGTGGTGCCCGGCAGCTTGAAAAAGAC
ACCGGGTACATGTGCATGCCTGTCCCAAAACCCCAAGAGGAAAGCAAAGGAGCAAGGATT
ATGGTGTTGCCATCCCTCTAGGGGTTGCTTTCTCAGTTTGCCTCTGTCTCTGTATGTCTC
TCTTGGTAACTATCTCTGGTGAATGAATGTGCCCTAGTGAACTTAAAAACCAAAAAGAAA
AAGAATGAGGAATGTCAGACCTGAAAATTACCTTATGTATCTGGTCCATCTTCGTACTTT
GCAGTTTTGTTTTTGTCCAGAGGGCAGGTGCTCTTGGCAAAGAGAAGAAGACGCATCCCC
CATTGAAGCATGGTCATGCCACAGTTCTTCCTCCATCCCTGTTTCCCATCAGAATCTTGG
CACACACGCCCAGTGTGTTTCTCAAGCCACCAGAGTGGGAACTTAAACCATGGGTTGACC
ACGTGGGACCTAGAACCTTTAACGTGCTGACTTACAGGGCCAGCCCTTATTCTCTTATTT
TGTAGATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCACTCAGTCTAGCAGGGA
GAAGACGAATTAGATGGCTACGGAGAGGCCAGGAAAAAGGTGCAGTAGCATGAGGGTAGG
AAAGGAATGAGAGTGAGAGATGGGAGAGTGAAGACTCTCAGCAGGGCTGGGGAAGAGAGA
CATTGTTCTCTTAGACAAAGTGGCAGTCACGGGGGTGGGAGTACGGCTGTGCCGCAGTGG
AGGACCAGGGATGCAGTGTGGCCATCCCCCCAGGGCGTGATTTCTCACTTTCTGTTTCCC
TCTCTCTGCCGAGTGCACATGCCCTTGAGCAAAAATCTCTCTCTCAAAAAAAAGAATTGT
CCATGTAATTTTATGTATTATTATTGTTGTTTTTAAATTTGCTATAGGGCATGTGTGCCA
AGAGAGAGAGAGACCTCTGTTCCAGGACTTAAACTGCAGTCAGCCATGTGGGAGTCCAAC
ACCTTAACCACCCACCACGCCACCTGCTGACCCCGTTATTTTTATCTTATAGACCAGGGC
ACAGGTTTTGAAGGGGTTAGAAATCCAGTTACACTTAGCTGTTAAGTGCCAGATACAGGT
TTATCCTGACCCTGAGTCTCCACTCTGTCTTGTCTGCTGCGTGAGGATGCAGAGTATTGC
AGTGTGCTCACGACTACGCCACAACAAACCATCGCTTTTTACTTTCCCTGTTTCACATTT
AGGCTATATCCAACTAAATTCTTTGTCTTTCCTTTCTACACAGATAATAGTAAATCTGCA
TTTTTTTTTTTTTTTAAATAAATATGGGCTAGCCGTGTTGTGCGGTGGTTAAGGGCTGTA
CAGAGGGAGCGAGGTCCCACATGGTTCACCATGGTTCAAGTCCCAGATTGGTGGCTTAAA
AAAGCACACCAGGTAGGGGGCCAACAGGTGGCATGGTGTTTAAGGGCGCTGGACTCCCAC
ATAGCCGACTACAGTTCGGGTCCCAGACCTGGCGGCTTGCTTTCTCACTTTCCCTCTCTC
TCTTTTCCTCTGTCATCTCTGGTCAAAATAAAGAAAAAAAAAATGGGAATAAAGAAAAAC
ACTAGGGATGTGTACCCAGGAGATCCCAACAGAAAAGATGAATGAAGAAAGGAAGATTGC
GGTGTGGCCAGGCCGCTTTGAGGGAATGTGCACATGCTACTTTCTCTCTCTCAGTTTGGC
AAGCGCACATTCCCTGTGTCATTAAATAAATACGCTTTTTCATAGTGTGTGTATGTGTGC
ATGCGCGCACGTGCACATGTACACACACGTTATTATGACATAAGTGAAAACTTTATTGTG
ATTTGAAGATAACCTCTATTCTGTTATTTTATATCGGTATTCAAACGGTAATTTTAACTC
TCTTCAGATGAAAGGTTTTTCTTGTCTGGCAAAAATCCGTTTGTGGTAAAGCAACATTTG
GCCCAGAGCCAGGTTAAGAAGGGAAGACAGTTTCTTTGGACAGTTGACTCTCGAGTAGTC
GATTTCTCTGCTGTTCTCAGTTCTGGCTTCTGGAAGCACCGTTTTGCTGTTGCAGGTCTG
GGACCTGCGCCAGAACAAGCTCACCTACACCATGAGAGGCCACGCAGACTCAGTGACCGG
CCTGAGTCTAAGTTCCGAAGGCTCCTACCTCTTGTCCAACGCAATGGATAATACAGGTAA
CTCTGGAGAGGAGAACAGTGGCCAGTCACTGTGGACCTTAAAGGGAAATGGACATGGGGT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCGTGTCTACCTTCCGGCTGTGTCCTCTCTCAGTTGCA
CACTTTTATGTATGGCTTTGCCTTTTTATGCCTGACTGTCTCTAGGGGAGGTTATTACGT
TTTTTGTGTGTTTTTCTGTTTTTATTTTGTTTGTTTGTTTTTAAGAATTATTCACTTAAT
TTTTATTTAATTTGCTACGGAATACATGCATGCACTCACCAGAGAGACTGAGTGGGGAGC
TGGGCTCCGTCATGTGGGAGCCCAGCACCCCAATCACCATGCCACCTGCTGGCCTCATTA
TTACTTTTTTCACACTCAAATAAGATGACATCACTCAAATTGAACTGCTGGTATAGCTTC
AGTTTCAAGAGCTGCATCTGCTGCTTGCAGTAGTTGTTTATCCAGATGTCTATAGATTTA
CCACTGACTGATCCTGGCTTGTCTTTTAGCGAGGAATATTGAGGTTCCCTAAATAGTTAT
TGAAATAATAGGATTTCTTGTTACGAGTACATAATAAAATGACAAATTCTTAGGCCAGCC
CATGGTGTGGTAGCTAATGTGACCGAATCTCTCATAGCCCACTGTGTGACCAGAGTACCA
GAACTTGAGAAACACATTAGACTTGTATGGATACATCCCCCAAATCGCAAAGGGCAGGAG
AAATGGAGGAGAAAGGACTACAGTGTCACCATTCCCCATGGAGAGTGCCTTCTCTCCCCC
TACCCCCCGTTCAAGCCCTGTGACAAAAAATAAAACTAAAGTGTCCTTTATTTTTTTATT
TCCTCCCATTTTAAGCTTATTTCCTTTCATGAGAGAGTGCACCCTGAGCAGGATCTCACA
TTGCGACTCGCCCCCGGCCTTTCCAGCCAGCCAGGATCGCGCACACGTCTTGCGTGTTGG
TGCCCAGTGTGTACGATCTCCTCACAGTGGCATTTAGATTGTCATATCGAAGCTTTGGTG
TGACTCTGAGTTGGCAGAGGGATGGCTTACAAAACGTTTTATCAGAAGTTAGTGTTACAG
CCAGCCGCACTGTGGCGTCCAACGGTGTGTGCGACATCCCCCCCCCCCATTCTCAGTTTT
TTCTGTGCCCTGAGTTCCTGTCAATGAGACTTGGGTGCCTTCTATTCTCACTAGCAAAAG
AGCCTCGGGAGGTAGCAGTGTGTCATTTTGAACCTCCTCCACCCAGGAAGCCACCTGCCG
TTGCCATGATGCTGGTTTCTGCTGGGCTCTCAGGAAGCCTCTGGCTGATAGCTGCTTGTT
TGGCTTTGTTTGCAGTGCGTGTCTGGGATGTCCGACCATTTGCCCCTAAAGAGAGGTGTG
TGAAGATATTTCAGGGGAACGTACACAATTTTGAGAAGGTGAGTTCTGCATGCCAACGGA
GTTCCACTGTCCACTTAAATCTAAGAAACAGGGGCCAGCAGATGGCACATGGTAGTTGAG
GTACCGGACTCCTACATGGCTGACTGCTGTTTGAGTCCCAGACCTGGAGGTTTGCTCTCT
TACTCCCCCGCCCCGCCCCGCCCCCCCCCCACACACACACACATACTCTTTTTCTGTTTC
TTTCTGGTCAAACTTTAAAAAATAATAATAATAATTAAATAAATAAATAGATTAAAGGAA
AATTTAAATTTGTGGTGGTGCTGAGGATAGAGAGCTGTAGCTTTGATAAAAATGGGCTGC
ATCGCATTGACACTGTTTTTCATCAAAACTACTTGGGAAATAAAACTAATAGACACATGG
GGAGTGGGTGTAGCAGTTAGTGAGGGAGCCCACCCTCAGCCACAGACATCTGACTTTAGT
CCCCCAAGACAGCATGTTCCTGGTTTCTTTTTTTCTTTTTTTTTTTTCTTCACAGATTTT
TACTATAGGGCGGTACACTCACTAGACAGACAGAAAGTGAGAAATTGCCCCCCCACCCCC
ACTCCAGGAGTGGCCACACCACAATCCCTTCTCCAATCTCCTCTCAGGATTTTAGGCACA
TATGCGGGCACCCGTGTGAGTTTTAAGCCGCTAGGTCCGGGACTCAGACTGCAGTTGACT
TGATGGGAGTCCAGCAACATAACCACTAAACCATCTGCTGGTCCCAGTGTTCCTAGTTCC
TTAGTTTTTTGGAACTTCAACCCTTTTTGGTCCACGCCCCACAGAGGACCTGGACTTCCA
TGGCTGTTACAATAAAAATACATCGCTTCACCTCAGTTAGCCCCATGGCCCCAGTTTATT
ATTTATTTATAATTTTTTAAGAATTATTTCATTTAGGGACCAGCAGTTAACGTAACGGCT
ATGTCGCTGGATTCCCATGCAGTCAACTGCAGTTTAAGTTCCAGATCCAGTGGCTTAAAC
TCATGCCGGGCGCGTGTGCATGCATACCCAAGATCCCGGGAAGAGAATGGAGGAGAAGGG
ATTGTGGCATGGCCATCCTCTCTGGGGGGTGATTTCTCGCTTTCCGTCTCTCTGTCTCTC
TCTGTCTTTCTGGTGAGCGCACACACCCTATAGCAAAAATCTCTTTAAAAAATTATTTCA
TTTAACTTTATTTTATTTTATTTTGACCAGATAGAGACAGAGTAAGAAAAATAAATGGAA
ACTGAGAAAGCTAGCCACCAGGTCCAGGACTCAAACCACCATCAGCCCTTCGCCATGCCA
CCTGCTGGCCCCTATTTAAAATGTTTTAAATAATTATTTTTCTTCCTTTCTTCTGTCCAA
TCCTTCTGCTCTTTTTGCCATAGGGCATATCCACTTAACAGAGAGAGAGAGGGAACATGA
GAAAACAAGCTGCTGGGTTCGGGACCTGGACCACGATCTCCCACATGGGGACCCAGTGCC
ACAACCACCATGCCACCTGCCAACTCTAGATTTTTTTGTTTTGTTTTTCTTTATTCATAA
CAGAGCTTGCACTCATTGCATGTGAGAGAGATGAGCACTCCCCACAGGGTCTGGCCACAC
CGTGATCCTGTTTCTCAAGCCCCCCAGGGCACTTGCTTGTATGCCTGGTGTGCTAAAGGA
GAGCCAAGCTGGATAACAGATTAAATTTCAGAACTAAAAAGACAGAGATAGTCTCAATAG
ATGAAAAATAGAAACTCTCTATTTATTTCTAACAAGAAACGCACCTCATTGAAAAAAAGC
ATACATAGACTGAAAGTGAAGGACTGTAAAAATTCATCTCATGCCAACAAAAATGAAAAA
AGGCAAGGATTGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGC
ATGCTGCAATCCCTTCTCCATTCTCAGGATTTTGAGCATGCATACACACGTGCCCAGCGT
GACTTTTAAGCCACCAGGTCAGGGACTTGAACCACAGTCAGTTATGTGAGAGTCTAGCAA
TGTAACCATTATGTCATCCACTGGCCCTTTTTTTTTTTGCTACTGGGTATTTGTTCTTAT
CAGAAAGACAGAGAGAGAGGAACAAAGTGAGAAAGCAAGCTGCCAGGTGCAGTACTGGAA
CCATGGTTAGGCATGTGGGAGCCTAGTGCCTTAACTACCATGCCACCTGCTGGCCCCATT
ATTATTATTATTATTATTTTAATTTACTATAGGGGACATGCACTCACAGGGGCGGACAAT
GGGTGGAAATAAGCTGCCAGGTCTAGGACTTGAACCACAATCTGTCATGTGGGAATCCAG
CGTCTTAACCACCATGTCACCTGCTGGCCCAAGACGGAGACATTCGAAACTAGCTTTTTC
CTTCAGAAAATTTGTTAACAATGATTAATGTTTTTTTTTCAAGGGCTTGTTGAGATTCAA
TTTCACTTTATAAATTAAATGTCTTTTGTTTGTTTTTTTGAGAGGGAGAGAGATTTTTGC
TATAGGACGCAAGCATTCACCAGAGAGATAGAAAGCAAGCAATCACTTCCCGGGGTGAAT
GGCCACACCACAGCCCCGTCTCCATTCTCCTCTCAGGATCTTGGGCACACAGGCACACAC
ACCTGGTAGAAGATTTAGGCCACTGGGTCTGGGACTTCAACCACAGTCAATTGCATGGGA
GTTCAACAATGTAACCATTACGCCATCTGCTGGTCCACGATTAAATCTTATTTTGGGGGG
GACCCGCAGGTGGTGTGGTGGTTAAGGGTGCTAGACTCCCACATGGCCAACCATGGTTCA
AGTCCTAGACCTGACGGCTTGCTTTTTCACTTTCTTTCTCTCTCTCTCCCGCTCTGGCCA
AATTAAAACAAATAAATAAATAATTAAATAAAATAATTCTTTTTTAAAAAATCTTATTTT
TATTTTCCTTCAAGATAAAAATTTTTTATGAGAATCAAGACAAATGGAGCAAAGAAAGCC
TCTATATGCAGAAGAAAGTTTGTGAGCAGGTCCAATCTCATTGACTGTAAATTAGCCACT
TTTTACAATTTTTATATGATGTAAACGTGTGCTGGCATGCTGTTCGGGGTCACAGAATAT
AAGAAAATTGTTTCTCTTTTTTATTATTATTATTTTATTCAACTTTATTTATGTATTTAT
TTTAATTTGACCAGAGGAGGAACACAGTGAAAGGGGCAGAAAAGAAAGCAAACTGCCAGG
TCCAGGACTCTAACTGCCATGGGGGAGTCCAGCACCCTTCCCCACCACACCACCTGCCAG
CCCCAGTGAGCCTCTTAAGAAATTTAAAGTCTTGGGATCAGCAGATGATACAGTGGCTAA
GGAGCTGGACTCTCCCACGTGGACATGGCAACTTGAGAATCACACCAGGCACATAAGCAT
GTGTGCCCAAAATTCAGAGAGAAAAATGGAAAAGCAGGAAATGCTGCTTCGCTGTCCTCT
CTGGGGGTGATTTCTCACTTTCTCTCTGTCTCTGATGAACATATGTTCCCTATGGCAAAA
ACCTTAAAAAATAAAGAAGCTAAGGTAATTTAAAGTATCTCAGTGATTCTGTAGTTTAAC
TTAAAGGAGTTTGATATGTTACTGTTAATGGAGTTCTCTTTATTCATCGTTATAGAATCT
TCTGAGGTGTTCTTGGTCACCCGATGGAAGCAAAATAGCAGCCGGCTCAGCTGACAGGTA
AGGACTCTGGACCTGAGGGAAAGGGTGATGTCGCCGTGCAGGTATTTTCTCACGTTTACT
TCATGCAGTGTAGGTCCAGGGCAGGAGCAGACTACACTGTACTAAGACGAAGCCCCACAC
AGCGTGGGGGCCATAAGAGCCATGTTTGGGGGCCAGCAGGTGGCGTGGTGGTTAAAGGGG
CTCGATTCCCACGTGGCTGACCACAGTTCGAGTCCTAGACCTGGTGGCTTGTTTTCCCGC
TCTCCCTTTCTCTTTCTCTGTCTCTTCCCAGTCAGATTAAATAAAATAATAATAATAATA
ATGGAACCAGCAGTTGACGTGATAACTGTGTCGCTGGACTCCCATGTAGCCGACCGCGGT
TTGAGTCCCGGACCAGTGGCTTAAACTCACTCCATGAGCATGTGCAGGCATGCCCAAGAT
CCTGAGAGAAGAATGGAGGAGTAGGGACTGTGGCGTGGCTATCCCCCCCAGGGGGTGATT
TCTCTCTTCTTTCTGTGTCTTTCTGGTGAGTGCACACACCTTAGAGCAAAAAAAAAAACT
CAAAATAACAATAACAACAGCAGCAAATGTAATTAAATAAATAATCCTTTTACCAAAAGA
AAACATGTTGGGCAGACATTATTTCTATCCTCTGGATATATCTTAGAGGGTCAGCAGCTT
TGATTCTGTTGAATTCTTTCTGCCATGAAAATTCAGGCTCATGATCTGTCTTCAGGCTCT
GTCATGAGATTCTTTTGCATTGTTCAGTTTATTCAAATATATGTGCAGCACTCGCTCCCT
GCCCATCACCATCGTGCATCACATGCGGCCTTCTCCCTGTGCCAGTCTACACTGTTCACG
CTCACCTCCAGGTTCTCTCATATCCTCTCTTTATGCACGCTCCCATCTCTCTCCAGTAAC
CTCCTCTGTGTTAGGTCTGTGAACTTCCCCTGGCCCTCTTTCCTCCTTACCTCTCAGGCA
TGACTTAATACTCTGTTCTGTGTGTTGCACTCGTACTTCCTACAGCTCCCCTTCATGGCC
TCTGTTACATCTTCAGTCAGACGGACACGGGCATTCCCCTTCCCACTGAATTATTGACTG
TGCTCCTAGAGGTCAGGGAATGAGCTTCCACCATCTCTGTTAGCCCAGGGCAGTGCTCGT
CATGCATGAGCTGCTCTAAGTACTTGGTCAGTACTACAGTGATGGGACTCCTGACTCCAG
GGTGGCAGTCACAGTTCGCCCTGCCTGTCAGCTCACTGTTGGTAAGGGCCACCTGTGTTG
AGGGTAATTCCCAGCTAGATGTAGGTTCAGTGGGCATTGCCGTGATTGCTAGATGAAAGG
TCTGTCAGCATGTAGACTAGGTATTTTCCACCCTTGCACTGAATTAATAGACTGGGGCTT
TTTAAAATGTGAATTTAAACTGACTCAGACAGGGGCCGGCAGGTGGCATGGTGGTTAAGG
GCGCTGGACTCCCAAATGGCTGGCCACGGTTCAAGTCCTAGACCTGACAGCTTGCTTTCT
CACTTTCCCTCTTTCTCTTGCTCACTTGTTCTGTCCTTCTGGCCCTCTTTTCTTTAAAAA
AAAAAAAAAAAGAAAAAGAAGAAAAAACTGACTCGGACGTAAAGAGGTGAATGAGAGCCA
GAAAGGACAGAATTCCGGGCCACCTTGTCATACATGGTTGAGCACTATGTATCAGGGACT
GAGGGACTGGATCCCACATGGCTGACTGTGATTTGAGTCCTAGCCCTAATAGCTTAATAA
ACACACCAGGGACATGTGCGTGCATGCCCAAAACAGTGGGGAGGAATGAAGAAAAAATCT
TTTTTGATTGCACGGTGTCCATGCCCCTAGCAACCAAACACAACCTCTGCCAATTGCAGG
GGTAAGGGGGATCAGCTGGTCCTGTATCCTACTGGTTAACAGAACCAAATCCCACATGGC
CATCCGTGTTTCTAATTCCAGCCCTGATTGTTTGAGGGACATGCCAGGAAGGGATTGTGA
CATGACCAAGCCTCTTTAGGAAATGCTTTTCTCCTCTCTGTCTCTTTTACAAGCACACAC
ACAACCTGACAGAAAAGAAGGGAAAGAATTATTCTGAGATGCTGCTGTATTTGGTACATC
TTTGGTGACTTGTCTTGGGGGAAAATCAGAGCTTTAATGGTTGAATAGGGATGTCCAGGT
GACAGGAAAGATGGACAGGGTTTTTTTGTTTGGTTTTGGTTTTTTGCTTATTTGAATTTG
CTAGAGGAGGCCAGCTGTTGGCATGATGATTGAGGCAGGTGGATCCTCCATGGATGACTT
TGTGGTTCAAGCCCCAGAAGCAGAGGCTTGAAAATCATGCCAGGTTGCATGTGCGTGTGT
GCATAAAATCCCAAGAGGTGACTGGGGGAGAAGAGATTGCAGCATGGCCATTCCCTCTGG
AGGGTAATTTCTCACATTCTTTCACACGTGTGCTCTCTCTCTTGCTCTGCTTTGCAGTGA
GCACATACACCCTCTGGGGAACTAACAATTTGCTAAAGGGCACATGCGCCCACTGCAGAG
GAGGGAGGAGAGAGAGTGAGAAATCACCCCCCCAGGGGTATGGCCATGCAACAGTCCCTT
CTCCATTCTCCTCCTGAGATTTTGGGCATGCACACACATGCACCTGGCATAATTTTCAAG
CCGCCAGGTCTGGGGCTCAAACTGCACTCAGCCTTGTGGGGTTCCTGCTCCGTAACCACC
ACATCACCTGGCGGCCCCAAGAGAGGGTCTTAATTAGGGGATTTTCAGTTTTCAAGTAAC
TACAAAAGGCCTTCCGAAACAGACTAAGATACCTAGAAATCTGACAGAGTGAGAACCATT
TAAATATTTTTACATAATTTTAGCGGAGATTATGTGTATTTCCTATGTGATTAGTCTTTA
ATTTTTATATGTATAAAGTTTGCTTTCTGACGGTGCAGTTCTTCTTGCTTACTGACTTCT
AAGGTACTCTCTTCTTCTGTCCCTCCCTTCCTCTTTAACCTTTACCTACGGAGGCGTGGC
TCTGGCCTGAGGAAGCCCGCCTCTCTGCCTGCTGCGGGTTGGCCAGATTTCACAGGCCAT
CTTTCCAATTAGCCCCAAGTCACAAGCAGCTCTGTTACATAAGGAGCCTGGGTCCTGTCC
TGCTGCATGTTGCCATGCCAAAAGAAGGAGAGGACCAGGAACCCCTCTAAATTTAGCTCC
TAATTGGCAGCTATCAAGAACGAGGCCTTGAAATAAACCCTTGGAGGTCTGGGGTTCTGC
TGTCTTTCACGTACCTCGGAAATGTATCCTTCCTTCTCAGAAGGCTGCTTTCCAGCTTGT
CCTGGATTTGGAGACTTTTCCTCTCTAGGTAGAAGCCCTCTCACCTTGCTGAAACCCTCA
ACGAGGGCTGTAACAGGGCTGGCCAGCCTCGGCCAACAGACTCGCTCAGTCTGATGACTT
CATGTGATAGTGCTTTCGTGGCAAATGTAGCTCCTATTAGCAAGAGCTGTCATGAATTCT
GTGGGCAGCTGTATATGTGATCTCGTTTTTTACAGTGGGTCTGCAAGAACAGTATTTTCT
CTATGATCGTAACTGAGGACAGAATCTCAGAGAAGTTAAATAATAGTGTAAGGTTACTTA
GCCTGTAAATAGTTGTACCGAGACTTGAACCCAGGTCTTCTTGACTCCAAAGCTCATATT
CATTCACTGTGCCACACTACGTAGTTGAATTAAAGAGGACCCGTCATTTGTACTTGGCGG
GAAAGAAGAGAGTAGGGGGAGGGCATTAGCATCAGAGCCAAGGAGTCCAGACAGATGAGC
TTCCTGCCTCTCTTCATCTAATCTGGAACTTTTATTTAGTTCCTGTGGAACCAAGCCCGT
GGGAACTTAATTACTTGTAATTAAGAAGCTCTAGTTTGTTCGCATCGTAACCAAAATTGT
AGTGTTGGATCAGGACTAGGTGTTGTATAACCCAGTTCTGGGGAGTGTGCCCTTTATTTT
CCAGGACAAGCACTACTGGGTTACAAAACAAATAGCGTTCCTATTGAAAACCCAGCAGCT
CTTTTTTTTTTGGTGGGGGGGGCGGATAGGTTTTTTGCTGTGCTGCACATGCACTCACCA
GAAAGACAGACAGACAGAAAGCGAGAAATCACATCCCGGGGGGATGGCCACACCGCAATC
CCTTCTCCTCCATTCTCCCAGCATCTTGGGCACGCACCCGGTGTGAGTTTAAGCCATCAG
GTCCGGGACTCAAACCGCAGTCGGCTACATGGGAGTTCAGCGACATAGCCATTATACTAA
CTGCTGGTCCCAAATCACCAACTCTTTAAGTCTACTAACATTACTTTTGCATAGTCATAT
GAAGGTAACATATATATATATTTTTTTTTAACCTAAACAACTAAGGCAAGGTTGAGGGCC
AAAGGAACTTTTTTTTTTTTTTTTGACCTAGGTATTTGAAGATAGTAAGAAAAGAAAATA
TTAGAATATATTAAAAGTTTTAGTTTTATAGATGAGCTGTGTCACCTTGGAAAAGCCCCT
GAATCTTGGTTTTCTTATTTGTGAAGTGAGTTTAGGCTAGCTGATTTCTGTCGGCCCCTT
CCCATTCTAGAATTCGTGTTTTTTCTTCCCGTGAATTTAGTACAAGTTGGGCTCAAGGGA
ATTTGGGGTTATGTTTATAAAATAAACTCTCTATCCCGTCTTCGGGGTCTATTTGAATAA
ATATAGTATAAAAATTTAGTATTTGGGGCTGGCATGTGGCACAGTGGTTAAAGCACTGTC
CTCCCACATGGCCAACTGCGGTGCAAGTCTTGCACCTAGCGCCTTGCTTTCTCACTTTCC
TTTCTCTCAATCTCTCTCAGGTCAAATTTTAAAATGGAATAATAGTAACAATGGAATTAA
ATAAACAATTCTTTTTATTTGTTTGTTTATTTAGAGAGGTTTTTGCTATAGGGCACATGT
GCTCGTCAGAAAGACAGAAACAGAGAAAGTGCAAAATCGTCCCCAGGAAGGATGGCCACG
CCACTATTCCTTCTCTTCCGTTTTCTTCTCGGGATCTTGAAGTGTTTGAATAATATGGGA
CTGACAAGTGCTTAGGACGCTGGACTCCCACATGGCCACCCATAGTTTGAGTCCCAGACC
TGATGGATTGCTTTCTCATTTTCTCTCTCTCTCTCTCTCTCTCTCTCTCCAGTCAAATGG
AAGAATAAGAAGTAAAATTAAATAATTCCTGTTTTAATTCTGTGGTTTGAATACAATACT
AAACGTTCAACTGGATTGACAGCGTAGTCTTTCTGTCTGCCACAAATCGGATCATCTTTC
ATACAGACCTGCATAATTCTGAGGTTCGCGGTAGCCTAGGCGGACTAGATGCCCTTACTT
TTTAGTTTTTGCCATAGGGCACAGGTGTCACTGGCGAAGAGTCAGGGAGAGAATAGGAAA
GTGAGAATCACTGGCCTGGTCAACTTGTGACGTGGTACCTAGCAAGTTCTTCAAGCACCT
GTGTCCAGGACTCGAACACACAGCAATATGGGTACCAGCACACACAGCACACTGGGTGGC
CCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTTTTACCTGTACCT
CTGCATCCGTGAGGATTCAGGGTGCGTGTCGCCCAGCCTGTTTGTCAAGCTGCAGTCGGC
CACGTGGGATCCCGCTCCAGTGCATAACACTGCACCACTGCTCCACCGAGCCAGTCCTGT
ACCAGGTGTTCTTTGATGATGGCTTCTCCACTGTCTGTCCCTCTCAGAAAGCCTGCATTT
ATAAAAATCAGAAATGCCTTTATTTTTAGCTGTTCTTTCTCTACTTAGTTACTCAAGGGT
AGGGTCCATGTCTTACTCAAACTCTTATGTTCCAGTTTCTAGAAGCTACAACTGCATTCA
GTAGATGTGGGGTGAGTGATTGGTTGGTTGTTGCTTCCGTTTCCATTAAAAAGCCATGCG
TGGGGCCAGCAGGTCGTGTAGTAATTAAGGCTCTCGGTTCCCATGTGGTCGACCCCAGAA
TGACTCCTAAACCCAGCAACTTGAAACTCATGCCAGGTACCTCGCCAAAATCCCGAGAGG
AGGATGGAGAAGGCATTGCAACGTGGTTATCCCCCCTAGGGGGTGGTTTCTCACTTTCTG
TCTCTCTGCCTCTTTCTGTCTCTCTGGTGAGTGCGCACACCCACACCCTATAGCAAAAAT
CACTGTCTTTAAAAAAAAAAAAAAAAAAACAGTTCTCTCTCAAAAAAAGAGGTCATGTTT
GTGCCTGTGCCTGCCCTGGGAGCCTCACCCTGTTCTTCATGACACCTCGCAGGTTTGTGT
ACGTGTGGGACACCACCAGCAGGAGGATATTGTATAAACTGCCTGGCCACGCAGGCTCCG
TCAACGAAGTGGCTTTCCACCCCGACGAGCCCGTCAGTAAGTCCGTCCTGAGTGTGGGGG
GGTGGGTGCCAGTCTCCCAGAGGGGCCCTGGGAGTACGGGAGCAGAGTGGAGTTTGTTTT
ACGTGAATTTCCGCATATGAGTGTGGGGAGGGGGTGCCGGTCTCCCAGAGGGGCCCTGGG
ATACGGGAGCAGAGTGGAGTTTGTTTTACGTGAATTTCCGTCCTGAGTGTGGGGGTGGGT
GTGCCAGTCTCCCAGAGGGGCCCTGGGAATACGGGAGCAGAGTGGAGTTTGTTTTACGTG
AATTTCCGCATATGCTTTAATCTGTATCAGTGGAAATCTCGATTGTTCTAAGTGGGAAGG
GCACAATGTTCCATTTTCTTCTCACTTTCAAACAGGTTAGTTGGTCTACCTAATTCTAGG
TCTTTTGAGTCTCTCTTTGAAGTAAACTCAAAAGAATAAAATAATTCTTTCAGAAGGGTG
GGGGGCAGTAAGTGGCATGGTGGTTAAGGGTGCTGGACTCCCTCATGACTAACTGCAGTT
TGAGTCCTGGACCTGGTAGCTGGCTTACACGCGTGCGCGCTCGCACACTCGCTCTCTGTC
CCTCTCTGGTCTAATTAAATAAATAAAGTTAAGTTAAATAAAATAATCCTTTTTTTTTTT
TTTTTTTTTTTTGAGAGGTTTTTGCTATAAGGCACGTGAGCTCTCCAGAAAGAAAAATAT
TTCTTTTAAAAATAAAAATGTTATTGGCTAGGGGCCAACAGATGGTGTGGAGGTTAGGTG
GCTGGATACCATATGGCTAACTGTGCAGTTCAAGTCCCCAACCCAGTGGCTAGGAAAACA
CGCAGGGCACATGTGCATATATGCCCTAAATCCTGAGAGGAGAGTGGAGGGGGAGGAGAA
TGGAGGATTATGGTATGGCCATCCCCCCGGGACCTTTCTCACTGCCCCGTCCCCGCTCTC
CCCTTCAGCAAATACATATTCCCTATAGCAAAAAAAAAAAAGTCTTGGCTAGATGGACCG
AGTAATGCGCCTTGAATTTAAAGAGAAAGCATAGCTTTCTTCATTCAGGGCTAAGTGTAA
CAAGCAGAGGCACAGACGTGGACTGCCCTCTCCTAGAATGACTGGGAAGGTCTTTCTCTT
GGGGTTTGGCTTACCCGGACATCAGACATCAGGATTCAGCACCTGATAATGTGCTTCCCA
CAGCACGGCGAGCCTCCTGCTTCAGAGAAACTTGGGGTGAGAAGCTAGGCTACAGCTCCC
TGGGGCTGGTGTTCAGGAAGGGACTTGAGCTCGATCCGGTGCTCTTTTATATCAAAACCG
GCTCTGGGGACCAGCAGTTAGCGTAAGGGCCTTGTCGCTGGACTCCCATGTAGTCGACCG
CGGTTTGCGTCCCGGACCCGGTGGCTTAAACTCACGCTGGGCGCGTGTGCGTGCGTGCCC
AAGATCCCGAGAGGAGAACGGAGGAGAAGGGATTGTGGCGTGGCCATCCCCCCGGGGGTG
ATTTCTCACTTTCTGTCTCTCTGTCTCTCTCTGTCTGTCTGGCGAGCGCACGCGCCCTAT
AGCAAAAACCTCTCAAAAAAAAAAAAACTGTCTCTTGACACAAGAGCCCTCGAGTAGCAC
ATCTCCTCGAGCCTTCATTATGTCTGGTGATATTCTCTGTTCTCTTTATCTCAGTTCTCT
CAGCATCCAGCGACAAGAGACTGTATATGGGGGAGATCCAGTGAAGATGTGGAACGGAAG
ACCCCAAGGCTACTTGAGCTTGAGACCACAGACCGCATCAGTGGCATAGAACAGTGAGTG
CCCGGCCAGCACCGCCCTGCAGACGGCCTTCACTGGCAAGAAACCAGGCGCGGGCCAGAC
CCCAGCGACCGCCTGGGCCTCCTTTCACCAGGATGACATGGGCACACTCACAGTGGCCTC
CCAAACCCACCCGCCAGACTTCAGGCTTCAGGGACTGTTTGGGGTTTTGTGTGTGTGTGC
GTTTTTTGTTTTTGTTTTTGTTTTAAATCAGTTTTCATCAAAGAAACAGATACTGGCTGG
TTTATAGCTTCCCATGTTCTAATCCAGGTGGGACGTGGGAATGTGACTGAAATTCATCAG
TTGGGATTTAATGTTTTTGCTTTTTCCTGATTCACTTACTGGCTTGTATGGTATTTTTCT
TTCTGTGTGTCTCTGAGTCGTTTTATATTAAAAGCCAAATAGATGCCTTTTTACGAGCGC
CACGTGGATTGGATTTATTGCTGCCTTTTCTTTGGCACTGGGTTGCATGATGTGGCCAGG
TGATCCTGTCCATTTGAATTTCTAGGAAGCTGTTTGCCTGGGCATTTTTTTCCACCCTTT
TCTGTGTTTTTAGGTTTTCTCATCTCCATGAAAATGACAAACAATAATTATTTACAGGTA
ACACGTTTTTTGCTCCTATTAGAAGTAGAGCTGCTGAAAAGTGACAAAGAAGACCTACAA
GAGCCTGTTCTTAGGCTTGGCCCGCACAGACCTGAACCATCGTTAGTCTTACGCTGATCC
TGGGACGTAATGCTTCTACACGCCAGCCCCCAGCATGTGACAGACATGGTGGGTTTGCTG
AGATCAGAGATACAGTGCAGTCCTTCTTTAGCCATCGTTTTCGTTTGCTGGAGGTTTTGT
GTTTTTTGTTTGTTTTGTTTTTGGAGAGATTTTTTTGCTATAGGGCGCATGCGCTCACCA
GAGAGACAGAAAGCGAGAAATCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1144, 12668..12797, 16330..16423, 18454..18619, 20721..20843, 28915..29035, 31935..32017, 35695..35756, 42112..42215, 43854..43903
1001..1144, 12668..12797, 16330..16423, 18454..18619, 20721..20843, 28915..29035, 31935..32017, 35695..35756, 42112..42215, 43854..43900
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved