Tupaia_belangeri Locus DKC1
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri DKC1
Tupaia_belangeri
DKC1
GeneScaffold_3620
SNORA36, SNORA56
2588..2719, 7187..7310
10049
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAGTCCAGTTCTAGGTTTGTTGCCCTAGGCTCTTTTCACTTCTCTTACAGCC
TCTCCCTAAAATGCCTTTCTCTCATTTTCATCTGAACACATTCTCCTACTTTGCAAAATG
TTGGCCAGTCAGGCTCTGGACTGGGGACTCTGGCTACCAGCACATTTGAGTGTCCCACTC
CTGGTGTGACAATATTTCATTCCTTTTCCACATCAGCAGTGTCAAGTATCTTTTTTTTTT
TTTTTTTGGAGAGGTTTTTGCTATAGGGCGCATGTGCTTGCCAGACAGAGACAGATAGAA
AGTGAGAAATTGCACCCCCCATGGGAGATGGCCACACCACAATCCCTTCTCCTCCATTCT
CCTTTTGGGGTCATGGGCACACATGCACACGGCACCTGGCATGAGTTTAAGCTACCAGGT
CCGGGATTCGAACCACAGTCAGCTACATGGGAGTCCAGCGACATAGCCATTACGCCATCT
GCTGGTCCCTCTAATAGCTTGATGCAAATCTGACAGAAATGTGAGGTAAAATTACCTGTT
CTTCCTGTCATGCAAAATGGGAGCAATTGAGCATATCAAGAGTAGAGAAACAAGAAAACT
CGGTGGCTGCACCTGACTACTCTTGTCTTTTTTTTTCAGGCAAGGAATATGTGGGAATTG
TCCGGCTGCACAATGCTATTGAAGGGGGAACCCAGCTTTCTAGGGTAAGCCTACAGTTGT
AGAGATGGTGCCCTTCAGTGGTATGGGTCTCTGAGCTTCTAAGCATCTGAGACAGGCCAG
CTTTCCTCACTGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTT
GATTATATTTAAAAGTTCATGTGATGATTGTGTTTGTTTGGGTTTGTGCTTATTCTTAGG
CCTTAGAAACATTGACAGGTGCCCTGTTTCAACGACCGCCACTTATTGCTGCAGTCAAGA
GGCAGCTCCGAGTGAGGACCATCTATGAGAGCAAAATGATTGAATATGATCCTGAAAGAA
GATTAGGTGGGTCTCTAGGCCTGTGAGGAAGTGAGTTGGCACAGGCCACAAGTGGGTGAG
GATGCTCTCAAGGATTACATTCTGTTGTTAAAATAGATGCTCTCGGGACCAGCAGATGGT
GTGATGGTTATGTTGCTGAACTTCCACATAATGACCATGATTCGAGTCCTGGACCCAGAG
TCTTGAAACTCAGGCCAGGCGTGTGTGTGTGTGTATGTGTGCGTGTGTGCGTGTGCATGC
CCCAAATCCTAAAAGGTGAATGGAGGAGAAGGGATTGTGGGATGGCCACCCCCTAGGGGG
ATGGTTTCTCACTTTCTGTCAGTGTCTCTCTGGTGAGCGCATGCGCCCTATAGCAAAAAG
CTTTCTCTTTCAAAAGAAAAAAAAAAAAAGATGACCTCAGCATGTTGTGTAAGCATGGCC
TATATGTGCCATTTCTAGTCCCAGTGGCTCAGATGGAGAATAACCTTGGGTTTCTTTTTC
TTTTTCTTTTCTTTTTTTTTTTCTTTTTTGAGAGATTTTTGCTATAGTGTATGTGTGCTT
GCCAGAGAGATAGAAAGCAAGAAATCACCCCCTAACGGGGATGGCCACACTGCAATCCCT
TCTCCATTCTCTTGGGATTTTGGGCACGCACACACGCCCAGCATGAGTTTTAAACCACGG
GTCCGGGACTCTAACCATGGCCAACTATGTGGGAGTCCAGTGACAAAACCAATAATACAT
TAAAACCATCTGCTGGTCCCAACCTCAGGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNACCCAGTCATGTGTTTACTCTGAAAGATAGGTGGACTACACGTGTGTA
TGTGTATCCCTCTTAGGAATCTTCTGGGTGAGTTGTGAGGCTGGCACCTACATTCGGACA
CTGTGCGTGCACCTCGGTTTGTTATTGGGAGTTGGCGGTCAGATGCAGGAACTTCGGAGG
GTTCGCTCTGGAGTCATGAGTGAAAAGGTATGTCTGCTATTACAGGACCAGAAGCTTTTG
AGCTGGTTTTTAATATCTTCCCAGCCTTTAGTGGAACCTTTTCTGCTTCACATTCTGAGA
AAGGCAATTTCCAAAGTGTTGAGTTCAGTTCAGGGCAGCTTCCCTGTTCTGTTAATTAAA
CTTTGGGACATTGAAATGGGCTAGGGGAGGTGACTGGATAGAAAGTATTATTCTGTTCAT
TTACCTCCCAGCCTACAAAAATGCCTGCTCAGATTAATATATCACCCGTTAAAGGTGTCC
TGGAGAGAGGTGATTTTGAAGAGACTGAAGACTTCATTAGCTTACACTAGTAGACAAGTC
ATATTCAAGTTTGAGGAAGTTTGGGGTCCAATGGGCTATTTGAGACAATGAATCATTTTT
ATACATGGTTGCTTTTTAGGACCACATGGTGACAATGCACGACGTGCTCGATGCACAGTG
GCTGTATGATAACCACAAGGATGACAGTTACCTGCGGCGAGTTGTTTACCCTTTGGAAAA
GCTGCTGACATCTCATAAACGGCTGGTTATGAAAGACAGTGCAGTAAGTCTGGGTTAGGA
GCCCTCATTTGGACAGAATGTAACTCCAAAGATGAGACATGGTTCTTGTCCTGAACTTGA
TTCTATTTAGACAAACGTAACGTAGACATTGTGCACTTATATGTTCTTTTCTTTGTGGGT
TTTTTTTTTTTATGGTTAAGTCAAAACTAACTATAAATTTAAAGTAGAAGTTTACCTGCT
AGACCTTCTTTGATTTTAAAATAAGGCAAAGTAATAAAACATTGACTTTAAAAGTTCTCC
CAGAGTAAATAACTTGGTTCGAGTAATAAACTAGCAGAAGCACATTAAAATTTGCTCTCC
AGTAGCCTGTATATTGTGCATATGGCTAAGAAACCTTGATTTCTGGGAACCAGCAGTTAG
CGTAATGACTATATCGCTGGACTCCCACATAGTCAACTGCGGTTCGCGTCCCGGACCCAG
TGGCTTAAAACTCACGCTGGGCGCGTGTGTGTGTGTGTGTGTGTGTGTGCCCAAGATCCC
CAGAGGAGAATGGAGGAGAAGGGATTGCGGCGTGACCATCCCCCCGGGGGATGATTTCTC
GCTTTCTGTCTCTATGTCTCTCTGTCTGTCTGGCGAGCGCACGCGCCCTATAGCAAAAAT
CTCTCCAAAAAAAAAAAAAAGAAACCTTGATTTATTTCTTTCTTTCTTTCTTTCTTTCTT
TCTTTCTTTCTTTCTTTCTTTCTTTCTGTGATTTTTCAAGCCACGGGGTCTGGGACTCAA
ACTGCAGTACGCCATGTGGAAATCTAGCATCTTAACCACCATATGGTATGGTGGCCCAAA
ACCTTAATTTCTTTTAAATTGTTAGAAAAAGTTGTTCCAATGGAGGGCAGAGTGAGGACT
AGAGAGTTTCAGAGCTGTAATAAAAAATACTCTAGAATTTCTATAAAAGTTGTTTAAATT
GTTGAGGCTATAAAATCTGAGTTCACTGAGCTTATCGATCTCTTTTCTTAGCATTTTATA
AAGTCTATAAATTGAGAGTAGTCCTAATATGCAAGTAGTTACTTCAGTTTGGGTTTACTT
GAGGGTTATAAATTCCTGTATAATTAATCATTTTGAAGTTGAGGGACCAGCAAGTGGTGT
GGTGGTTGGGGCACTGGACTCTAACATGGCTGACTGTGGTTCAAGTCCCAGACCTGGCAG
CTTGCTTTCTCACTTTCCCTTTATCTCTCTGGTGAGCACACTTGCCTATAGGAAATTAAA
ATAATAGTAATAATAATATTAAATAATCATTTTTAAAAATAATAATTTTAAGGTTGATGG
TTACTCAAATTTAGATCTTGTACCTCATAGATGTTTCATGCATTTTTGTATATTACTGCC
CATAATAAAAAGTAAAAAGTAATCTAAGAGCTATACTAAAACATGGCACTATAGTAGTTG
GAAAAACTTAGAAATAGTGAAGAGCGTAAATATGATAAGCCTTCCCTGTGCTGGGGTCAC
ACTGTTGGCTTCTGGGTGAACTTAACGAGGAGGGTGGAATGTGGTCAGCAAGAGTGAAGA
CAAGATGGCATGCAGCAGAAGGATGTGTCATAGGTGCCATGGAACTCCCAAGTACTTGTA
CCCATTGGCCTATACATTCTGTGCCAATTTTATTTTGCATGAATGTTCAACAGGCCTTGG
TGATCTTGACTGATAGTTATGAGGGGACTTAACAGTTATGAACTATGTATATTATGAAGA
AACTCCATGGGCTTCAAATTCGTTTTGCACCACAATAATCTCGTACTTTATTTCTCTTTC
CTCACAAACTTTTTGAAGTCCCTGTGTACTCGAGGTGCCTGTTATTACCTGGATCTCCAG
AAAATATATTTTTCTTGATTAAAGAATAGAGAAGAGTGATTAAGGAAATCTAAGGCTGTC
GTTTTTGTTGTCATTGTAAAATGAAAACACCAATAGGTCCCAAGGAAAGAAAATAGAGCC
TTAACACCTGATTGCATAATTTACTAAAGACATGAGTGAGGATGCCATTGTTCTTTAGCA
GCTGAAATATCACATATAAGAAGTGACCATTATTTGCGAACTATCTTTGGTAGTTTTGAG
TTATGTATGTGAAGTACCTGGAGCCATGCTTGGAACACAGCAAGGCTACTGTTGCTCCAG
GTCCTTTCATGTCTGGTTTCCTGCTCTCAGGCCCTTCCCCTTGCCACCCGCCTCTGGTCA
TCCTGCAGGTGAATGCGATCTGCTATGGGGCCAAGATCATGCTTCCGGGTGTTCTCCGGT
ATGAGGATGGCATTGAGGTCAATCAGGAGATCGTGGTCATCACCACCAAAGGGGAAGCAA
TCTGCATGGGTAAGAGGGCATGTTGCCTCTGTCAGTTCTGGTGTTGGGGCTCCATTCTGA
ATCATCACAGCCAAGCTCACTGAGACTGGGTACCTAGGTCCCAGTTTCCCTCGGTTGATT
TAATCATGGTGTTGCCTGAGATCTCTTGGATAATCCCAACAGACAGACAGGGTGGTCAGG
CATGGGTGAGTGCGTTTCCCTTGTACATGAGTAGGCCATTATCACCATTTGGCTTTCCAG
TGCAACATGGGAAGCCACCAACAAGAGAGTAAGAAGTGGTACTCAATGGTAATGGCAGTA
AGGAGCCTTTTGTCCACTCCCAGATTGCTTGCAGTGAATTTGGGATTAATACTAGTACTT
TACAATTTGTGGAAGTTTAGCTGCTATCACATTGTCCTTTAAAACCATAACTGCTATGTG
GCCCTCTTAATAAGTCTGAGCCATTCATGTTATAGGCCTAATTTGCTCCCCAAATAGAAC
AAGTAGGTCAGTTATTTTTGAAAACTAACTGCTCTGTAGCCACTCCTGCACCTGTCCTGA
GCCACAGCTTGCTGTATACATTTAGGTGCTTTGGTTATGTGTTTTTTTAAAGAAAAGTTT
TTTTTTAAGAATTTTTTTCGTTTTATTCATCATCATCATCATTACCTAATTTGATGAGAG
AGAGAGAAAGCCACCAGGCCTGGAACTCAGACCATGATTGGCCATGTGGGAGTCCATCAC
CTTAACCACAGTGCCACCTGCTGGCCCCGTTTATGTGTTTTTAACTTTATAACTTTAACA
TCATTTCAAAGGCATCTTTCTTATAAAGGTGAAGTTCCTATATATGTTCATCCTGACCAA
GGAAACCCCGATGAGAGGAGTGGAACTCAGAGCTTCTGATAAAGAGGCACAAACTGGTGG
ATTGGGGCTCACAAGCTTCAAGCTTTTTCCTTTGGATCATGGTTTTTTTTCCTCTCCAAC
ACCTACAGCTATTGCGTTAATGACCACAGCAGTAATCTCTACCTGTGACCACGGCATAGT
AGCCAAGATCAAGAGAGTGATCATGGAAAGAGACACTTACCCTCGGAAGTGGGGTTTAGG
TCCAAAGGTGAGCAGGTGGGGTGGTGTGCTCTGTCAGGTTATCTTGCTTTGCGTTGTTCA
GTGCTCACTTGGGGAGCTCGTGTCCTTGGAGCTACAGCCTTGTGTTGTGCTGGGATCTGG
ATCATTGGTCCAAGTGAAAACAGGCTCTATCTTAGTCCTTAGTGTCTAATGGGGGAACAC
TTGGGCTGACTTCTGGGTATATGGTGGAGTGGTGAATGGTATTTTGAGGCTCCATTATGA
GGGGTATGACCTGGCCAACAGGACTGGGCAAGGTCTTCTCTGAAGTCATGCCAATGTAAA
GGGTGAGGCAGATGTAGATGAGCTGAGAGGGCAAGGAAGGGGTCAGGGAAGTGGGAACAG
CATGTGCAGAAGTGCTGTGGCTGAAGAGTGAGGCTCTCACTGATAAACTTTGGGACCTTC
AGCAAATGCCATGTTTGCTCCCACTGGAAAGCAGGTGAGTGGAGTGTGAGGCTGCCCAAG
GGAGGTGATGCTGTTCTAATGTGGAAACCCTAACCTTCTACCAGGCAAGTCAGAAAAGAC
TGATGATCAAGCAGGGCCTTTTGGACAAGCACGGCAAACCCACGGACAACACGCCCGCAG
CCTGGAAGCAAGAGTACATTGACTACAGGTGAGGGTAGGGTGTCTTGGAACCTAGGGTGT
GGGAAAATGTTGGTAACAAGCAAGGGTGGTGACAGGTGAGGATAGGAGGGAAGAGGTGGC
AACTCCTTCAGGCATGGTGCACATTGGTGAGGACAGGTAGGGGTGTGTGGCAGTTATCCT
TTTCTAGTCTGGCTCCTGGGACTCTAGAAGGAGTCAGTCTGCAACAATAAGTGGTGAGTT
CTTCTGTCCAGTGTCAGTGTTTGATGGTGGCTGTAGACCTGCCAGATATCACTGTTAATG
GATGTGTTTCCCTGGAAAGCTGCTCTGAAAACTTGACCTATGACTGCTCCTCCACCTTTC
AGTGATTCTGCAAAGAGAGAGGTGGTCGTTGAAGCAGTCCAAGTCCCACAGGTAGTTGGG
GAAGCAGCAAAAGCACTGCAAGGAGTTGCTGAAGCAGTCAAAGCCCCGAAGGTGAGTGCA
TGCCAGCATCTGTCTGGAATGTGCTTTGGGAGATGATCCATCCTGTGTGTGCTGCACATG
TAGGCGCTGTGGCCTCATGTTCCAGGGGACTTCTTTGAGTTCTTTGGGCTCCACTAAATT
GTGCTTTCCTGAATGTGGGCTCAGGAACCCAGGTGGCCTTGGCTCCCACCTAAGCTATGG
TGATAGCACTGGGATAGAGTGGGTGACACTGACTGGCAGCATGGCGGTGTTGAAATCAGA
GGCTGTGGCAGGTGCAGTGGACAGTGGGGGCCATAACAAGACTTGACATGGGAAAACAGC
AGTGGTTTTGAGTACCAGCTTCCTGGTCCTCTAGCCCCAGGCGTCATAATCAGAAAACCT
ATAGTTGAAGCCAATTGGGATCTTTCTTGGGGACTCCCTACCTTTTGACTTACTGAGTTT
TTCTCATCTGCTATGGCTTAAAGTCTATTAGCCAATTGTTATTCATTTCAGAGGAAACGA
GAGAGTGAGAGTGAAAGTGACGAGTCCCCTCTAGTGGCTTCCCAGGTCATCAAGAAAGAA
AAGAAGAAGAAAAAGGACAAGAAGGCCAAAGCAACTCTGGAGAGTGGAGGCGAGCCTGGA
AATGGGGTGTGTATGAATACCTCCAGGGTCCTCAGGCCAACTTCATCTCAGCAATGGCAG
AATCCCTCAGTCATGCCAGCCTTGTCACCCTTGGAGGTGTGGTGGCCTGAGGATGGGGGC
TTTGTATCTTGCTAGTACCTTTCATGACTCTCTACTTTATAGAGTTTTATCGAAGGTGGG
CAGGGAGGGTATGTAGTCTGGGAATTGGAATGTCCCTTCTTCCCAGAGTAGATGATTAGG
CTGTCACTGACAGGCTCACCGGATTTGTTTTCACATGAAATCTTTTTTTTTTTCTGCTCT
TTCTATTTACATCTTTTCCTTTCAATAAGATAAATTTTAACTTAATTTTTATTTTACAAC
ATTAATTTGTATACATAGTTTTAAATAAAATTTTATTATAAGGCTTATCACCAACAAACA
TAGCCCTCAGTTCACTCCTATGCTCCACTAGGTTCCATTTTTCAGAGGCATTCATTTTCA
ATCCTCTTAGCTGTGTCATCTCTTTTTTCTTCCATATTTCTGAATAACACATAAGATAGT
TATTTAAACATTTCATTTTTTAAAATTTTACTTTATTTTTTAAAAATTTATTTTACACTC
TTTACTGATCATCATCACAGCATAACAAAATGTGATTTCCCATCCAGAATACACTGTATA
GTGGCTTAACTATACAATGTTATCATCAACAAATAGTTTTCCATTCTTTGTTTCTTGTAT
ATATATATATATTTTCTATTTCTCACCCTCTGCCATTTTTAACCTTTGTCCTTATAGATC
CTGGAAAGGCTTATTTGGGTAGAATGTACCACATTTTCTTTTGAGGAACATGGCATGGTT
TGGTTCATGAATCCATGTGCTTGCTCTCTCGCTTGCTCTAGGACAGTGACACCACCAAGA
AGAAGAAGAAGAAGAAGAAAGCCAAACTGGTGGAAGTGGTTTCTGAATAGCGAAGCCCAG
CCCACTTTATGCATCGTGTATAGCTGGGAGGAGAGATCAGAGCCCTATCAAGAAAACAGT
TCCATTTGGTGGCTGGTGAAGGAGTGGAATGGGTGGAGGGTTCTAGCACATTTCATCTGC
TTTTAGAGGCCTTGGTGATATGGCCTGCTGCGCTCATTCCATCTTGTCCTGTTTTAAGGA
TATGAGTGGGGAAAGAGGCAGATTGTGTGCCACTGACTACTTTGCTCGTTTTGGGAAACC
TCACCTTCAGACCCAGTACTGCCCGGTAACCATTTTCCAAGGGCCTCTTTAACAACATCG
CAATCCTGTCTGTTTTTCTTTAACTCCTCTGCCTAACAGTTCATTGTTCAGCAAAATGCT
GTAGAACCCTCCATAAGTGGAAGACTTTAACTGAACCACATGTTTGCTGGGGAAACCCTC
ACTTCTGAGGTCCCATCTCTGAGGGCCGTGCAGGCTTCTTTGCACGTCACGGCTTGTGTG
TACAGCAGCATTTACTGAAATCCCCTGGTCTGTGTTTTAACTCTCGTTGACTTTTAAGGA
AAGAAATTGCTCATTGCTGAGAGAAAAAGGAATGTTCTAATTTTTACTTATTAAAGTTAA
CTTGTTAAGTTTTTTAAGTATTCCTGTTGGGTTTTCTAGTTGTTGGCAATCTCAAACTAG
CAGAGCAAGAAATTTATTTTGATTAAAAATATGGGGAACTCTATCCAATTTGAAATTGGT
GCTTTCCCTTTATGTTTGGCTAGCTGTACATTTCTCTTACCCTGTGTCTTGCAACATTCA
CCTGGGGCCTATCTGATAAGGGATCGAAGACTTAAGGGTTGGGGCAGAGGAACCTGCTGA
TGTTGTCAGCTCTGATGGTCCTGGTGCTGATGACAGGGTGAGTGGGGAGAGTGAAGCTGG
GGGTGGGGACCTTCAGGAATCTGAAGGCTTTTGTAACCAGGACCATTAGTGGAGGAAAGT
TTTGGGATTGCTTAGGAGCACTTTGAAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1063, 1319..1445, 2356..2486, 2899..3042, 5228..5348, 6308..6426, 6944..7047, 7382..7451, 7454..7457, 7486..7490, 7971..8105, 8981..9049
1001..1063, 1319..1445, 2356..2486, 2899..3042, 5228..5348, 6308..6426, 6944..7047, 7382..7451, 7454..7457, 7486..7490, 7971..8105, 8981..9046
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved