Tupaia_belangeri Locus RPL7A
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri RPL7A
Tupaia_belangeri
RPL7A
GeneScaffold_3152
SNORD36, SNORD36
13057..13132, 13459..13530
15322
GAGAACCCCCATCCTGCTCTCCCAGGACAGGGCTGCTGCGGCCATGCCAGGACCCACTG
CAGGGCCTCTCAGAGAGCTGGAGGTGGGAGGCAGAGTGGGAAACTGCTCCAGCACACACA
CTGCACAGCACGCGTGGGGTCTGCCCTGCCTACCTGGCCCCGGGCCTCCTGAATCTTCTC
ATGTAGTCGCTGTCGCAGAACATCCAGGGCAAAGATGGAATCAGACCCCGTGGCCACTCC
ACCTGCAGAGAAGGTGGACTTTGGACCATTCCCTTCCAGTCCCAGTGCTAGGCATCAAAG
CGAGAGTTTCTACACACTACCTGCCTGCCCCCCTGTGGCCACCCAAGGACCTGCAGAGCA
ATTTCAGCCATTCTGCTCCATGCACTCCTTCACAAGGGCAGGTCACTGTGGTATGAGAAA
ACGCTTCCCTGTATGCAAGCCTAACCCCTTTTCCATTTCTCCCCCTTCTGCAGCCTGGGC
CCCTATAGGGACCTGAGGGCAGTGACGCTCTTTGAGCCCAGCTGCTCCAGGTCCTCAGAG
AGACATGGCCTTGCCCCTAGCCACCTGGCTGGCAGGTCCTGTCCACCCAGGCTACTCCTG
GGATTTCCTCTCTGGGAAGCCCTGCACAATCCCTGCCGGAGGGTGGGCACCAAAGCCCAG
CCCCGTGCTGCCTGCATTTCCTGAAATCACTCAGCTCACCTGCAGTGGCCCCCGCAGAGC
TAGAAGCCCCACCCTCTGCAGCTGCAGCTAGTGGCTTTTTGGCCTCAGAAGCTGCTGGAG
ACTTCTCCCGCAGGCGCTTGGCCTTGTGCTCAGCCTTCTCTTCCTGCTCCTGCAACTTCT
TTTGTGTTTTCTTCTTTTTCTTTTTTGGGGGCCTAGCAGCTTCTGAACCTTGCGTTTTCC
GAGCTGAAACACAAAACGTGAAAGGGTTGCCGCCCGACCTCTGACCTCTGAGACCCGTTT
GACAAGCATAAAGGGCTTGCAGAGGCTTTGGCCCCAGCAGGACGCAGGAAGAAAATCAGG
ATGGAGAAGTCATGGGGCAATTACTCACGGACCCAGAGCCACAGCCTTCCTAGAAAGCAG
GCTGACCACGTATAACAAAAACCTCAACAACACACGCTTGCTTGACTGGCAGTTGTTTGT
AGCAATGCTTGGTCCACAAAGATCTGGACCTCAGGGACGTTCATCACGTGCCTTGAGTGA
CAGCTAGGAAAACCTAAATTATCCACCTCCAAGCACAGACATACTGCTGCACCAAACTAC
GACACAGCCGCTGAAAAGCCAGCAAGCTGTATAATGGGGTACGTCATTGGACTCCCACAT
AGTTCAAGTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTATTTT
AGAGAGAGATTTTTGTTATAGGGAATGTGCCGATTACCAGAGAGACAGAAAGAGGTAGAG
AAAGTGAGAAATCATCTCCCAGGGGGTATGGTCATGCAGCAATCCCTTCTCCTCCATTCT
TCTCTTGGGATCTTGGACAAGTATGCACATGTACCCAGTGTGAGTTTCAAACTTCCAGGT
CAGGGATTCAAATTGTGGTTGGCCATGTGGGAGTCCAGTGATGTAACCATTATGCCATCT
ACTGGACCCAGAAACGAGTTTTGGTTTGCTGGTCCCCCAAGAAAAGGTTTTTTTTTAAAA
AAGAAGTATTTATTTATTTGATTCCATTTGTTATTATTATTTATTTTGACCAGATATAGA
GAGAGAAATGGAAAGCAAGAAAGCAAGCCACCAGGTCTGGGACTCAAACCATGGTCAGCC
ATGTGGGAATTCAACATCCTTATCTACCACACCACCTGCTGGCCCCAAAGAGAGCTTTTA
AAATATAATTTAAAAAAACAAAGGCAAGAGAACCAGCAGTTAGCGTAATGGCTATGTCGT
TGGGCTCCCACAAAGTCGACCGCGGTTCACATCCCGGACCTGGTGGCTTAAAACTCACAC
TGGGCGCGTGTGCATGCGTGCCCAAGATCCCGAGAGGAGAATGGAGGAGGGATCGCAGTG
TGGCCATCCCCCCTGCGGGGTGATTTCTCGCTTTCTGTCTCTGTCTGGTGAGCACACGTG
CCCTATAGCAAGAACTTCTCTAATAAATAAATAAGTAAATGAAATAATAAATAAAAAATA
AAGTGGAAAAAGCACAAGTGTTAGCAAGGCCATGGAGAAATTTGGGCGCTCACACATTGT
AGATGGGATGTAAAACGGTGCAACTGCGGCAAGACACTCCGGTGGTTCTACTAGAAGTTA
AGCAGAATGACACCACCAGGGAGCCAGCAGATGGCATAATGGTTATGTCACTGGGCGCAC
ACATACTCAACTGTGGTTCAAGTTCCAGACCCAGCAACTTGGAACTCATGCCAGGCGCGT
GTGCATGCGTACCCAAAATCCCAGAGGAGAATGAAGGGATTGCCTTCCTCTGCAGCGGAT
TCCTTTCTTCCCCACTAAGGGCTGTGACCGGAGGACTGTCTTCATGCTCTGCAGTGACCT
GTACCTGTGTCTTGATGGAAGCTGTTGGCACTACGTCACTTTCATTCCTTCAGGAAACAC
GCATGGAGAAGGAGTTCGGTATTGAAGGTTTATTAGGTATAAGGCCTGTGAGAGAAAGGG
CGGGGGACCGACAGCCACGCAGAGCTGCCGCAAGCCCTCGCTGCCTGGCACTGGCTGGAG
GCTGCCCAGGAAGGGCTGGCCTTAGGTCAAGGAGCTGAGGCAGGTCCACAGACCAGGAGC
TGGACGCCGTGGCCTGCTACACTCCCTGCAGCTGCACGAGTGACTTCTCAGAGACCCAGG
TGTGCCTGGACCTACAGCTTTTCCCAGGCTGCAGGGTTCCTGTCTCAGCCTGGGTCCCCT
ACCAAGCCTAGAGTCTCCTGCTGCCCAGTCAAGTCATTACAAAAAAGCGTGGTGGCACAT
TTTCAATCCAGCACACTACTGTCCAGCCAAGTGTGCGCCTGGTGCCCTGCACAGGAGCTA
AGGGACACGCATGCTGCTGCTGCTGCTTTGGGGGGCTCATTTTTGAATAGCTGCTCGGTA
AGGGTGACACTGAAGAAAACACCGGCCACACTGGCCGCTCCTGCACCCTGGCATCCAAGG
ACACCATCTGCTGTCCCTGTCCTGACCTCTGCCACCTGGCAGCAGCAAACCTCCCCCGAC
CCCAGGAGAGAGTGAAGGCATGTCCCTCACAGCACCACTGCCTCCGGCCCAGAGGTGGCT
ATGTGACACAGTGGCCTCCCAGGGACTCTGGAAAGGTATGGCTGCCTCACTCCCTTTGGA
TTCTGACCTGGAAGGTGTCGCTCCAGGCTACTGAGGAGCGCAGAGAATGAGATCGAAACA
GGCAGAAGCCAAGGAGAGACCAGGGAGGCCTCTGTCCCGGTCCTAGGACTCGGCCATGAC
TGGACCTGCAGCTTCTCCCGGGTTACAGGAGCCAATCATCTCCCCTTTGGCTTTTCGCCC
CTCCCAAGTGAGCGCTGGACTAACAAGTAGGAGAGGCAGGGCCAGGGAGGTGCTCACCCC
ATGCCCCCCTCCACCGATCCCTTCTTGAGAAGCTGCCAGACCTTGATCTGGCTCGCCCTT
CCCCAGGGTCTGAAGGATCTGGGCCCTCTCTTCATTCCCGGTGCCCTCTTTACAGGGAGG
GGCCCAAGGTCTGGAGAGCTGCTCACTCTAGGCCAGCCCGCTCCAGGTCCTGGGGCAGGA
TCCGGCCCTTCTTGCGGGCCTTCTGCAGGCGCTGCTCGGCCCGGGCCGCCTTCTTCTTGC
GCAAGTTCTGCCGCCGCCGGTCTTGCCGCTGTTGCATCTTCTCTACNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTATTGAACCATAAGCTTAAAATGGTGATGATGG
CTAATTTTACTGTTGTGTCCCTCCTCCTGTCCCCCCCACACAATTAAAAATAAAAATAAA
GGGCCAGCCCTGTAGCCCAGTGGTTTCAGGAAGCTGGATCCCATATGGCCAACTGCTGTT
TGAATCTCAGCCCTGCTGGCTTGAAAAACACACTGGGCATGTGTGTGTATGTGCCCAAAA
TCCATAGAGTGGAAAAATGGAAGAGAAAGATGCATCCCCAGGGTGGCATCCTGAGTGCCA
TTCCCCAGCCCTCCGGTAGATCTGCGTCGCTGGCAGCAGCACACCCAAGTTTTGGGTCGG
GGCAGGGGATTTGAGCCTGCCCTCTGCCATGTGGCTGCCAGCACTGCAGTTCAGGACCTC
ACTGTGCCACCAGGCTAGGCCCCGGCCACCAAGGTGGACCTGTTCCTTTTAGGCTGTCAT
CTTTGTCTTCCTTAGTGGCCAAGTATGGACTCTTTCCAGTTAAAACAGTGCATTATGCAT
CTTAACAGTGGAAAAAGTCCCTCCAAGAGGAGGTGGTTTCCTGGGCTACTCCTGAAACCA
AGGGTCACATTCCCAGGCTCCTGCCTGGCTGGTGCCTCCAGCTAGGCTGCGGTCTCTGGG
CCTGTAGTGAAGGGCTGGCTGGTGTCCTGTCCCCGAGGCTGGGTCCTGAGCTGTCAGTCT
ACATATTGTATGATGGCCTTCCTCCTGGGAAGGAGATACGCCATAATGGCAGCGTTTAGG
GGCAGGAGTGAAGTCCCAGCAGGCCCTCGCTCTGTCCTGTGGTTTCTGCATTCTTTTTTG
GGGGAGAGGTTTTTGCTATAGGGCGCGTGTGCTCGCCAGACAGACAGAGAGAGACAGAGA
GACAGAAAGTAAGAAATCACCCCCCACTCAGGGGAGATGGCCACGCTGCAATCCCTTCTC
CTCCATTCTCTCGGGATCTTGGGCATGCATGCACGTGTACCCAGCGTGAGTTTTAAGCCA
CCGGGTCCAGGAAGCGAACTGTGGTCAGCTACATGGGAGTCCAGCGACATAGCCATTACG
TTAGCTGCTGGCCCCTGGTTTCTGCATCTCTAAGGTAGGCCTGGCACTGACACCCTGGGT
CTAGAGTTCCCAGATTCAAGGCCTGATTTCAGCTCCTCGGCTGCAGGCACAGTCTCGCTC
CCCATGTCCTCTGGACTGCAGCACCCTCTAATGGCACCACTGAGAGTTGGTGGCAAGGGC
TGGATGCCGTTAGAGGTACAGGTGCATGGGTGTGTGACATGCCGTGGCAGCCGCCTTTCA
GTCACCAAACACTAAGGACCCATTAGGTACCAGTGGGGAGGGCTGGCCTGGAGGCCACGT
CTGTCAGGCACAGCAGTTGTGGCTTTGACAGCTGTTGGGAGGCCAAAGGTGGTCCTGGAC
ACGGGGGTGAAGGAAGAGGAACCACTGCGAAAGTGTGCTGATGTTTTTATTAAACAGTCC
CATTACAAAACAGCCAGTGTCCGTAGTCTGTGGTTCAGGGTCAGAGGCCACACGCAGGAT
GGCCTAAGGACAGGAGACCGTCCATTCTCAGCCCCCTCCCTATTTTAAATGGTGTGCTCA
GGCCACGCCTTCCCTCGCCCCATTGCTAGGTCCCTAGCAGGAAAGCCCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAGTTCTACTGTGACCTCGGCAGG
TCCCCTTTCTCTCTGGACCTCACCTCTAGGGGTGGGGCCAGATTAAACAGCTGCTCATCC
AGGGGCCCTTGGGGACAAACATGCGACGTGAATCACCAGGACCCTTCGCTGCCACACGTC
CGCTGAGCTGATGAGCGTCGGGGATCAGGACCAGGGACAGCCCCGGACAGCTCTCTTGGG
AAACTCTAGAGCCACTCTAGTGCTGGCTCCGGACGAAGGGCTCCTTGGTGTGGCTCCACG
GGGTAGGAGGGAGTGCTCTTAACCCACCCCCAGGGAGGAAGGGCGAAGGGAGAAGGCGTG
AGGTGAGCACAGGCTCCCTGTCCGCCGGACTGAATGTGACTTTCTAAGCTAACAGGGCAG
AGGTGAGAGGTCTCCGGTCCCCAGCCTTAGTCACACATGGACTCCGAGTTCTTGGGGCCG
CTCCAGCTTCAACAGTGTCTAAGCAGCCCCATGTCCAGCCTTGTCTTTTGACATTTCCAG
GGTCCAGCCTGGGGCCTGTCTCTAGGAGCGCTCTGGCTCCAGCTCCAGGAACAGGGCTGG
GCTGGTCAGGAACTGGAGACCCAAGTACCTGGGGCCTGGCTTCCAAGGCAGTTCTCCACT
CAGGCTTTGCCTGCCTCCCTCCCAGGACCGCCCTGCCTCCACACCGTGGGGGTGCAGGTA
ACGTCCACGTGGAACTGCATCCCTGGGCAGGCACTGGCACCCTGGACATGGGCATAGCCT
GAGCATCAACAGGACTAGCCCACCCTAAGGCGGGAATGTCTCAAACTGAATTCAGAAGAG
GGAGGTGCTGCACGGGCCTGCGAAGTGCTGCCCCGCGAGGAGAGCTCTCAGAAAGGCGGC
AGCTCTGCCCTGCCCCACGGGGGATGCCAGCCAGGTGCCCTCTCTTCTCCAGGCATGGCC
TCCGGACTCGTGGAAGTTCTGTGCTTTCAATCACGTGGCACTGTGCAAAGGGCCCGGGCC
TTGCCGGAGGGCGATGCACTGTCTGTGGGTCAGGCGCTCGGTTCCAAGAACTCGGCACTG
GCTTCACTGCCGAGACAAGGAAAGGCTAGGGCCGCAGAGGGACCTCGGGGGTCGGGAGGG
CCTGCCTGCAGCCAGGCCGGGGGCCCCTCTCTGCAGGGGAGCCCAGCCCTATTTGTACCT
GGACGAGTAGTGCTCCTCCTCAAGCTCGTACAGGTCGATGGACACCTCGTCACGCAGGGT
GATGAGCTTCCGGTCACACTCCTCCTGCAGGGCTCGCCACTGCTGGTTACGCTGGTCGAT
GGCCTCGTTCACTGACGGGAAGTCATTGAGGATCAGGAACTGCTTGAGGTCGGACACCAG
CTTCATCAGGGACTCGCCAGCTCGGACCTGCGGCCATCAGAATGGGGCAGGCCCGGGGGT
GAGCGGGACAAGGGCCCTCCTCCTGCATGGCCGATGCTGGCAAACCATGGCCTCTCTGGG
ACCCTCAGCTTCCTCATTTGCAAAGTGGGATCACAGTGCTGATCTTCACGGGGTCATCAG
GAGAGCTAGAAAGTACGCTATGGGCGGGGTCCCTGGCACCCACCTCCCCGGGCAGGTGCG
ACAAGCCTGCTTCTCTCCCGCAGCCTCCGGCTGCACTGCGTGGGACTGAGCGCTGGTCAC
ACACACTCCACCAGTGCCCCTTCAGAGATCGAGCACTAGTCGGGAGCTGCACTCAGTCCT
GCCCTCACACTTCTGTGCATGTGCCCAGAACCCCGAGGCGTGGGGACGGGAGGAAAAGGG
TTGTGGCATGACCAGGCCCTACTGGAGGGCACTCTCTTACACATGTGCATGCACCTCTGG
CATCTAAACCAAACCCAATCCAACTCTCAAACCCCGGGAAACTTGGAGTTGGCAGGAAGG
CCTACACAGCTCTCGGGGGGGGGGATGCCAGCCACCTGCCCTGCCTTCTTCCAGGACAGT
CTCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCG
GTCTACCCTGTTCCCTGCGGGCCCTGCCCTCATGTACAGTGGGCACCACCGACCCGGCCA
CAGTGGCCCCCGAAGGCCCGTCCAGGCCAGCCCACCTTGGCAGTCTTGATGATCTCGGTG
AAGTTGTCCATGACAGACTTGATGTCATCCTTGAGCCGCTTGTTGTAGGACTGCAGCAGC
GTCTCCTTGCTCTGGGGCAGGGCTCTCTGCTGGGCCATGTGGGGCCTCAGGCTGCAGGGG
CTGGAGGCCTGTGACAGAGTCCACAGCCACCCCTGACTTAGCCGAACATGCACATTTCTG
GAGTTCGGGCACTCAACGAAACAACTTATTCAATCGGGGCCCTGCAGTGGGCCAGGAGTG
GGCGGGCGGAGGGAGGGTGGCCGGCCTTGGGCCCACCCCTTTCTCAGCTCATTCTTTTAA
CCCTGACCACAGCGGCTGGGACTCCAGCCCAGACCCAGGCCATCAAGCTCACAGCCTGCT
CCCCTCCCTGGTCGCAGAGACCTGCCACCATCCTTGCCTGCCTCCCCTCTGCATCCCTGT
GAACCCACCGTGCCACGTCCCTGCTCCATTGCACTCCCTTCCTCGTCTCCCAGCAGTAAA
AGTCCTCATGCCACTCTGTGTCCTTTTTTTTTTTTTTTTTGGAAAAGTTTTTTTGGCTTT
TAGGGCACATGCACTCGTCAGACAGAGACAGAGAGACAGAAAGTGAGAAATCACCCCCCA
GGGGGGATGGCCACACCACAATCCCTTCTCCTCCATTCTCTCAGGATCTTGGGCACGCAT
GCACACGCGCCCGGCATGAGTTTAAGCAACCAGTCCGGGACTAGAACCGCGGTCGACTAC
GTGGGAGTCCAGCGACATAGTCATTACATTAACTGCTGGTCCCCCACTCTTGTGTCCTTC
TACGAGCTCGCCCGCTGCCGGGATAGGGATCATGCTCTGCGCACCCCGCCAGGCCTGGCC
CCAGCTCCTCCAGCGCCCCACGCTCCAGCCACACTGACCGCCCCCAGGGCTGCGCCCGCC
TTTCTCTCGGGCCAGGCCTCTGCGCAAGAGAACGAAAGGGCTGGAGTACCCGCGGCCTGT
TGGGGGTCTCCTTGCTGTGGACAGGCGGCTCCGGGAGGGCGGCCAGGTGACCCCGCCGGC
TGGAGGCCTGGTGCAAGGCTGGGACAATGAATGAACGAACCAACCAATTCGGTTTCTGCG
TGCCTGTTTTTTTAGAGAGGAAAGTCAACCCACCTCGGGGCCCGCGCCTACCGGTGCCTC
TCCCCCAGTCACGCGGTCTCTCGGTTCCCGAACTTTCTGTGCCGCGTCGCCTTCAGCGGA
CCCAGCTAGCCCGGGACACTCTAAGCCCTCTTCAGATTTTATTGATAGTTAAAGAACTCC
TGTCGCTTTAAATCTGAAATCCCGCGCAGGAGCCAGTTCTCGCGATCCCAGGGGCCGCAT
ACATATTACCCACAATTCCATTTCCTTTCTCTCTCCTCCAGTATCCCAAGATGGTGAGTC
TGCTTTCCGCGGTACCTGAACAGCGGTCCGGCTGCATCCGCTGCCATCCTGCTCTGGGCG
CTGCCGCTCGGGGCTCTCTGTTCGCCTCGGCGCTGCGAGGGCCCTCCTGGGCCTGGCAGG
GAGGCATTGGTTTTGCGGGGGCAGAAACTGGCGGCCGAGAGCGGATGCGCTACCCCCTGT
GCCGCCAGGGCAGAGGAGCAGGACCGGGGAGAGCTGCGCCGCAGTGCAGGGCTCGCAGTG
GGCCGCGGCGAGGCGTTTGCGCGCCGCGGCGGCGCCCGGGAGCCGCGCCGCAGGCCTCGG
CACAGGGGTCCTAGGTTTTCCTCCTTGCCGCCGGAGCTTGTGGGCCCCGACCGCCGCCTG
GACGTCGGAGGGGGTGCGCGGCCTCGGTCCCCAGCCCGGAGCTGGCTGCGCGTCCGTCCG
CGCAGGTGGCGTGAGGACGTCCCCCGCCGTCGAGGTCGCCGATGTTCGGCCTGGGCTTCG
CTCGCGCGCCTTCTTCGGGCAGGGCAGCTACCCTGGCGCCGGGAGCAGGACGCGGGGTCT
AACGCGTTTTCCTTTTTGCACAGCCAAAGGGAAAGAAGGCCAAGGGCAAGAAGGTGGCTC
CGGCTCCTGCCGTAGTGAAGAAGCAGGAGGCTAAGAAGGTGGTCAATCCCCTGTTGAGAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTAGCTACTCAGCTGCTCAAGCTGGCCCACAAGTA
TAGGCCATTAGACGAAGCAGGAGAAGAAGCAGCGGCTGCTGGCCCGGGTTGAGAAGAAGG
CCGCCGGCAAAGGGGATGTCCCCACTAAGAGGCCGCCGGTCCTCCGGGCAGGTGAGTGGG
CAGCTCCTCTGGGGGAGGGGCAGTGGTGGCATGGGCTGTTGCGATGATGTATGAATTTCT
TCACCTGAAACCAGTGAAGAGTAAAAATCCGAGCTTTTTAACACTGAGTCACAGCTGGCC
CATGGTCACAACTGTTGCCCATGGCCAGAGCTGCCCAGCACTCAGGCAAGTGGTCATTTG
TGTGTCTAGGGGTGAACACTGTCACCACCTTGGTGGAAAACAAGAAGGCTCAGCTGGTGG
TGATCGCACACGACGTGGACCCGATCGAGGTAGGTGGACCCTGCTGTGCACTGGCTGCCA
AGTCTGGGATCTCAGGTTGGTTCTGGGAGGTAGAAGAGGCTTGCTACTGGGTCTGAAGAG
TACCAGGCCAGAGTGGGCAACCAGGACAGCTCCCTGTAGTTTGAGGAGAGTGCAGACAGG
TCCAGCTCACGAGTGGCTCTTGCGATGATGTGACTTTTCCACTGAAGTGACCTTGAAGTG
CAGATCCATGAGCTTTTTAACCCTGAGCAGTTGCCACTAAGCTAGCTTTTGAGCTGTTGC
TTTGGATCAGGATATGTTCCTGATCCAGTGAATGCTCTCTTCCAGCTGGTTGTCTTCCTA
CCTGCCCTGTGTCGGAAGATGGGGGTTCCCTACTGCATTATCAAGGGGAAGGCCAGGTTG
GGACGCCTGGTCCACAGAAAAACCTGTACCACTGTTGCCTTCACACAGGTTAACTCGTGA
GTATGCGCCCTTGCCCCAGATCCCCCAGGACCAGTAGGGGGTTGGTTCCGTGGTCCACCC
ACTGCATCTCTCTGGATTTGTGACCCTGCAGAGCAGAGTTTGAACCTTCGCCAATGATGG
TTAAGAATTTCTTCACCTGAATAAATCATGTGGTCATACCGTATCTGAGGCACAAAGGCT
GTGGTTAGAGCTAACTAAGGGGGTCATGCATCTAGGCAAGAAGCCTGAAGCCTGCCTTTC
CTTCCTCCTTGTTAGGGAGGACAAAGGTGCCCTGGCTAAGCTGGTGGAAGCCATCAGGAC
CAATTACAATGACAGATACGATGAGGTAAGGAGCAGCTGTACACTGGCAGTGTCTGGGGT
GGATGGGTGTGCTGCCCTCCAGCCCAGAGCAGTTCTCCAGAGACCAGTGTTAACCAGTGT
GCTTGGAAAGCCAGAAAACCTGCCAGCTGTGCTGATGGTGCCCCTCTTGTCATTTCAGAT
CCGCCGCCACTGGGGAGGAAACGTCCTGGGCCCGAAATCAGTGGCTCGCATCGCTAAGCT
GGAAAAGGCAAAGGCTAAAGAGCTTGCCACCAAACTGGGTTAAGCGTATGCTATTGAGTT
TTCTGTACATACAAGTAATAAAACGCTCTCCTTCGGCTAGTGTCTGTAATATCTTCAGAC
CAGGGACCTGTTGCTAATAAGGCTGCAGTGTGGTCAGGTGTGCTGTGTAACATGTGGGTT
GGTTCCATTTATTTTTCCATGACAAGAGGCAGGCACGGGCACCCCCACTGTTCCTCACGC
CACCTGGATCACCTGTTCCTCTGTCCAGCAAGTTTAGAGGGTGCTGATGTAGCCCATGAC
CTCCTCCTATAGGCCTTGTCCTCTCTGGAACTGCTGCCCTGCAGGTGTTATTAAAAGCTT
TAAACTTGAAGACATGCCTGGCTCAAGAGGCACTGTGGAAACACACACAAACTGGAAGCT
ACTACTCACTTAAGCTATATGTTTTATTTATCTGGATTCTTTGATTTTTGCTGTGTGGCA
TGAGTTCACCAGAGATGGCAATAAATCGCTCCTGTAGGGATGACCATGATGCTGTCCTCC
ATCCTCTTAGGACTTGGGCAGCTGCTGAGTCCAGGACACTAACCATCAGCCATGTGGGAG
TCCAGTGCCTCAGGCAACCACTAAGCCACCTACCAGCCTCAGGAGTTTAAACCAGTTCAT
GATCTAGTGTGAGACCACTTGTCTGGTGACTGACTGCTCAAGGACAGCACTGTCCACTGA
TGTCATGCAGCAGGTGTCCTACGCAGGAACTTCTTGAACCACAGGTATGACGTGGCTGCA
CAGAGTCCATACCTGGAGTGCAAAGGAAGGTGAGCAGTTAGGCTGGTCAGCATTCTGAAG
GGGACAGGCTGGGGACCTGGCCTCACCAAGTGATGATGTACTGCATATGCTCATTCCTCA
GGGTGACTCTGGTCTGTCCTCCAACGGGCCCTCCAGGGACAGTGCTCTCTGCAGGCCAAG
CAGAGTTGGAGCTGCTGAGTGGCCATCTACCCCTCAGCACTAGAATGGATGGCACAAAGT
AACTGGGAAGAAGGCAGGGTTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 11903..11994, 11999..12027, 12372..12521, 12869..12906, 12911..13010, 13209..13288, 13605..13735, 13995..14064, 14218..14322
1001..1003, 11903..11994, 11999..12027, 12372..12521, 12869..12906, 12911..13010, 13209..13288, 13605..13735, 13995..14064, 14218..14319
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved