Tupaia_belangeri Locus RPL4
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri RPL4
Tupaia_belangeri
RPL4
GeneScaffold_4245
SNORD16, SNORD18, SNORD18, SNORD18
1617..1715, 2480..2551, 3679..3750, 4436..4505
6856
GCAACTGTAGCTCATACGGTCACTGCAATGTCCTGAACAGACTACAGCCACGCATTTCA
TTCAGTAAGCAGAAAGCAATACGCTGAAGGACGCCCAACATCCAGTTTTCCGTATTCTGG
GAGGTGCCTCTACCACAAGTGCGTGCCCCGGCAAAATGAATAATCCCCGCCCTGGAACAC
TCGCGCCTTCCCACCTCATTTGATAACGTACAGATGTTTTCAATAAACCTGACGATCAGC
AATCCCCGACAATGGCCAGCCCCACACTGGAGCAGAGCCGGCCTCCTCCCAACCCCCGGC
CCCAGGAAAGCGGCAAAGCGAAAGGCTCGGGGTGGGAATCCGAGATCCAGGGGAAGAGGT
GTCGACCCCGGGCCCCAGTCAATAAAAAGAAACTAAAACTCACTGTAGAAGACGAGAGTA
AAGCTCCTCAGCTGCAGTATTCACGCGCTGCCACATCTCGACTCCGACTAGTGGCGGTGC
AGAACCGCCAAACCGAACTGCGCGCCCGGACGTTGACGTCATCAGTCATGGCCCCGCCCC
ACCGGGACTATTTTCACCCCCCCAACAAACTTCGTTTGTCTACAAAACTAAACTTTTCTT
TTACAGCACCCAGAGATATTTCTTGTCTCAATAATATTCCATTCCAGTCAAAAAAAAATA
ACGAAAATAATGGTAGTGGTTACAGGGAAGACGCTTCCTCTCGCGATAGTTGGCCACGCC
CCCTCAGGATTATTCCGCGACAAAGGAGTCCCTCCTTTATGAATACTATCATTGGCTTTG
AAAGACAAAAGATACCGTATTTCTTATCTAAAAGTGAGGAACACTCTGGTTTTTTTCCCT
GGTGGTGTAGCAGAGGGACATTTCGTGTGCTCGTGTTGGTTTTGAGGCCGGGCACGGTGA
GAGACGAGGGGAGGGTTACATATAGGCTGGGAGTGATACGCACTTCCTTTTCCTGTGGGA
GCCGCCGGTCGAGAGGAGCGTGGTCCTCTCCTCTCCCCGCCATGGTGAGTGCAAGTCCTT
TTGGCTGGGTAGTCTTCCTGTCCTAGGACCAATAGGAAAGGATCGGGAGTTCGAGGCCTA
AAATGTGCAGGAGAGAAATGGAGGACGAGGGAATAGGGGCCAAAGCGTGCGTGTCCGGGA
GCCGGGCTGGACGGCATATGGCAGCCATCTTACAGGCAACGTGGGCGGCCGGGCGGCGGC
GAGCCCTCCCCGTGCTCAGGCGCACGCCAACCCTCCGCGTTCTGCTGTCCTTGGGTCTTG
GGAACCGGGCCTGCCGAAAACGAAAACCGCTGGGGCCTAGGACCGAACCGGGCTTGGGGA
AAGGAGAGGCAGCTAGGGACCTTGCACTTCGGCGTGCTGCTTATTAGTAAGGTTTATTTC
CACCTTTTGAGAGAAGGATTTTGCTAAGAAAATACTGCGTTTCTTTTTTTCCCCTGAATG
CTCGTCTCTGGCCAGCTTGGGAGTCATCTGATTGGGTTGTACTTCTGTGGCATCTAAATT
TAAGTATCGCCCGTCTCTATTACATATTGCTCTAGGCTTACTTGAAAACTGGAAGGTGTT
CATTTTTCTATCATTATTTCTAAAAGACGAGGGAGTTCACAGCAGAGACGTTTTGCTTGC
AATGATGTCGTAATTTGCGTCGTACTCTGTTCTCAGCGACGGTTGCCTGCTGTCAGTAAG
CTGGTACAGAAGGTTGACGAAAATTCTTACTGAGCAAGTCCTCAGCCAGCTCCCGTTATG
ACTAATGTTAAATGTAGTACTTTTCCACAAATAGTGTTGGTACAGTGTGGTATTGTGTGC
GGGGGTGAGGGGTTCAGAAAAAGAAATAGCACTGCCCTTGTGATTGGTCTAAAATAAAAC
ATTGGTAGTAAGTGTTGCGGAGATACAGGAGGCAGTGGTTTAGCTTTAAGTAGTAACTTG
TAGAAAGGCAGTCTAAAGGAGGTGAGGAATTGTGTTGAGAGCAGCTTTAGGGAAAAAATT
GTCGTGAATACAAGGTCAGGAGTATGAGCAATAAGTTCAGAGAGGAAGAGCATATCCTAT
CTTCATCCAGAAGAATTTGGTTTTACCCCCAAGTGAGAAGTCTTTGGAGAGGGTTGAACA
AAGGTAACATGACCCGCGTTTTCACTAGTAAGTATCTGATATGCTTAGAAAGAGCTTGGG
GAGGGCAGAATGAAAGTTCATTAAGAGTATAATGGGATTATTGACACTAGTTTCACTCTG
TCCCTGCTTGTCAATCTAAATATCTTTTCTTTTAATTCAAGGCGTGTGCTCGTCCACTGA
TATCAGTGTACTCTGAAAAGGGGGAATCGTCTGGCAAAAATGTCACGTTGCCTGCGGTAT
TCAAGGCTCCCATCCGACCAGATATCGTGAACTTTGTTCACACCAACTTGCGCAAAAATA
ACAGACAGCCCTATGCTGTCAGTGAATTAGCAGGTATGGATTTCTGTTTCCCATAGGTTA
CTATTTTAGGGGCCACTTGACAGTAGTGATGAAATTCCACATCATTGGTCCGTGTTTCTG
AACCACATGATTTTCTTGGATGTTCTGATGCTGCTTGCTACTGTGCATAATAGTCACAGA
TTGACACGACTGGGTAGCTAAAACATTTTCTTTCTTTCCAATTTTAGGTCATCAGACCAG
TGCTGAGTCTTGGGGTACTGGGAGAGCTGTGGCTCGAATTCCCAGAGTCCGAGGTGGTGG
GACTCACCGTTCTGGCCAGGGTGCTTTTGGAAATGTATCCTTTGTTTCACTACCTGGTCT
GGTTGCCTTCTGTGGGGTTGAGCAGACTGGACCTGATTTTCATTTATATTAATAGAGTTT
CCTCATTCTTATGTTCAGAGTAGTAAGAGTGTCCCTATTAAATATCGTTTGTCCCCATTA
AATATTGCTCTAGACAGATTTGAAAACTAAAATGTGCTCATTTTTCTATCATAATTTATT
TCTAAAAGAGGGAGTGATTCATAGCAGAGAAGTTTTGCTTGCAATGATGTCGTAATTGTG
CGTCTTACTCTGTTCTCAGCGACAGTTGCCTGCTGTCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTAGTCACTTCTCCATTCTCTTCTCAGGATCTTGGGCATCGCAC
ACACATATGCCTGGCATGAGTTTAAGCCACCTAGTCCAAGACTCAAGCTGCAGTTGACTA
CATGGGAGTCCAGCGACATAGCCTTTATGCCAACTGCTAGTCCCAATATAACCATTTTTC
AAACTCTCAAAATTTGAGAAATGTTATTCTTAACCAAGAAAATAGATGTGTCGAGGAGGT
CGCATGTTTGCACCAACTAAGACCTGGCGGCGTTGGCACCGCAGAGTGAATACTACCCAA
AAGCGGTATGCCATCTGTTCTGCCCTGGCTGCCTCAGCTTTACCAGCTCTAGTCATGTCT
AAAGGTTTGTAATTTGTATCATAAGAGTTGGCACAGAACCCTTTTTTTTATCTGAGTCTT
AGGAATTGCCTGTAAAAATTCTGTTTATCCCCAAGTGTCTAACTAAAACTTTCCTTTATA
AATGGTGCTATTTCAATCTAAGAAATCACTCATCTGTTAATACTTTGTAACTGGGAAAAC
TAATTCTTTTATTTAACTGTCAGAATGATGAGATTCCACTCAATTGGTCCGTGTTTCTGA
AACACATGATATTTGTGGAAATTCTGATTTGGCAAATTACATACCATTTTGCTTTTGTTT
ATTAGTTTTTCAGTGATCTTGGGGGTGACCACTAAATATCGAATTGGTTTTGTCAGGTCA
CCGTATTGAGGAAGTTCCTGAACTTCCTTTGGTGGTTGAAGATAAAGTTGAAGGCTATAA
GAAGACCAAGGAAGCTGTTTTGCTTCTGAAGAAACTTAAGGCCTGGAATGATATTAAAAA
GGTAGGTTTAATGAAGGTCTGTTTGGTAGTCTTTGATCCACAAAAAATTGTCACCTTTCA
GATATAAAAAGGAATTGGGGGGCAGTGTTGCAAAGATGAGAGAAAAAAGGTTTTGGAGCC
AGGGTATTTTGGATGGATCCTGTGCCATTACGCCTTAGATTGAGTGAATCATTTGTGCCC
CAATTTCAAGATCGTAATAGTGGGGTTTTTTAATTATGTTATGAAGAGCAGTTGCAGGGA
TTATATCTGAATCATAATACTAAAATCCTCACTTTGCAGGTCTACGCTTCTCAGCGAATG
AGAGCTGGCAAGGGCAAAATGAGAAACCGCCGTCGTATCCAGCGCAGGGGACCTTGCATC
ATCTATAATGAGGACAATGGTATCATCAAGGCCTTCAGAAACATCCCTGGTAATTCCTGT
GCTGCTTCCTTACGTATATTTGATTATCTATACTAGGCAAGTTTATTCAGCTTTTTGTAT
TATGATGAGATTCCACTTCATGGTCCGTGTTTCTGAAACACATGATTTTGTGGAAGTTCT
GATACTTTGCTGAATGAGTTGACACTGACAGTTGGAACTTCATAATTAATAAGGTCATTG
TCAGGTACCTTATGTAGCATGTTAGCCATCAGGATGATTTGTGTTTCTTCTGTTGAAATA
CAGGCTCCCTAATTCTCCTTTCCTTTTCAAAGGAATCACTCTGCTTAATGTAAGCAAACT
GAATATTTTGAAACTTGCTCCTGGTGGGCATGTGGGACGTTTCTGCATTTGGACTGAAAG
TGCCTTCCGGAAGTTAGATGAATTGTATGGCACTTGGCGGAAATCTGCTTCCCTCAAGAG
TAACTATAAGTGAGTGTTTCTCATATACTGGATGTAGGTGTTTAAACTGACTGTTTACAT
TCAGAATTGGCCTGTATGTTAAGTGCTGGATTGCAGTTTCCTCCTGTTCTTCCTCATGGT
GCAGGCACAATGTACTGAAATCTCTTCCATCTTCACCTGGCATTTGTGTGTCTGTGTGTT
TACGAGAAGTAATAGCATGACAGAAATTCTGGAATTCTGGAGCACTTCAGTGGTTAAAAA
CTTGTGTTGATTCATGTTCTTCAGCCAATAACTTGAAAAATGGGAACTCGGGTCTTTTTT
TGCCCTTTTAGCCTTCCCATGCACAAGATGATGAACACAGACCTTAGCAGGATCTTGAAA
AGTCCAGAGATCCAAAGAGCCCTCCGAGCACCACGGTAACTAACGTTTACAGTACAATTC
TTGTCCCAACCTACCTTGCTGGGGAGGTCTTCAGAAAATTCATGGAAAGTGCATATTGTA
ATAATGTATGGAAAAGAAAGTACTTTTAATTTTGCAACTAACTCATACTTAAATTCCATT
TTTAAGTCCCTTTGTATTTCAATAACACAATGTAATGTAAGTCAGATGCTGATGCTTTTT
TTATAGCAAGAAGATCCATCGCAGAGTCCTCAAGAAGAATCCTCTGAAAAACCTGAGAAT
CATGTTGAAACTTAACCCATATGCGAAGACCATGCGCCGGAACACCATTCTTCGTCAGGC
CAGGAATGTAAGTGATCGTTTCTTTTTCACTAATGTATCACGGTTTGAGAAAGACTCAAT
TTTTACATTTTCTTGTGTAATTTGTTAACAGCACAAGAAACGGCTGGATAAAGTGGCAGC
AGCACTAGAGGCCAAATCTGATGAGAAGGGGGTTGCAGCTAAGAAGCCTGTGGAAGGGAA
GAAAGGAAAGGGAGTTGGTGCTAAGCAACAGAAGAAGCCCTTGGTGGGAAAAAAGGCTGC
AGCTACCAAGAAGCCAGCAGCTGATAAGAAACCAGCAGCTGACAAGAAGCCAGCAGAAAA
GAAATCTACCACAGAAGAAAAGAAATCTGCTGCATAAACCCTTAACATTTGTTTATTCTG
TAAAGATTACATCATTTTGGACAGCTTATTTTGAATAAACATCTTGTTCAAAGCAGCAGT
TTAAAACATGGCTTGTTGGGTGTTGTGTGATTCTTTTTCTTTTTTTTTTTTTTTTTTTAA
TTTTGTCAGGTCATGTGTGCTCCCTGGATAGAGCCAGAAGGGATAAGAAGCACCCTCAGT
GGGAGATGGTCACTATCCCTTCTCCATTTTTTCCCACCTTTTGGGATTTTGGGTGTACAT
GCATCCAGCATGCAGCCCCCAAGTCTGGGACTCAAACTTTGCTCTAAGGCTATGAGCCAG
CAGCCTTAACCTCTGTGCTATTGGCTGGCTCCAGATTTTTATTTTAACACTTCTCCATAA
TTCTAGCTTTTTTCTTTTGGAGAGGTGTTTTTGCTATAGGGTACATAATGCTCACCAGGA
AGACAGAAACAAAGCAAAAAATTACCCACTGGGGGGATGGCCACACTGTAATCCCTTCCC
CATTCTCCTTGAGATCTTGGGTGTGCATGCACACATGCCTGGCGTGGGTTTAAGCCACCG
GGATCCAACACTTGAACCAGGGTTGACTACATGGGAGTCCAGCACCATAGCCATTACGCC
AGTTGCTGGTTCCCATAATTCTAGCTTTTGACATGTTTTTTACTTCATATTAGATGGAAC
TTTGTATTGATAAGCCCATGTAGTTGATTTAAAAAATAATCAGGAAGTCATACATAATTC
ACTTTGAAAATTAAGTCATAGATAACTTCTTAGACTTGCTTCAGAAGTAGGCTGTTGAGG
CTCAGGAGGTGGTGGTGAGGTGCAGGGTTCCCTCACATCTGGACCTGGCAGCTTGCATTC
TTTTCCTTCTATCTGGTAGGCACAAATGCCCTGTAGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2261..2432, 2627..2733, 3345..3483, 3836..3960, 4239..4368, 4652..4808, 5111..5194, 5406..5526, 5611..5766, 5785..5856
1001..1003, 2261..2432, 2627..2733, 3345..3483, 3836..3960, 4239..4368, 4652..4808, 5111..5194, 5406..5526, 5611..5766, 5785..5853
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved