Tupaia_belangeri Locus BAT1
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri BAT1
Tupaia_belangeri
BAT1
GeneScaffold_5674
SNORD83
7997..8073
15857
AGGCGGTGCTCGGCGTCTCGTGGTCCTGGGCACTTGCGAAGGGCGGGGCTCTTTTCTTT
TCTCTCTTCCCGGGGCCACCTTTGGGGCCGCGATGGGACTGGGAGGCAAGAGCCGGCTTT
GGGGCCCGGTTCGATTTTTCTCACCTCGACTTGCGCACCGTTATTTTGGCGTTCTTCCCA
CGTGTTACGAGTGATATCACTGTTTCTCGGAAAGGAGTCTCACTTGAGTAACTCGGCGAT
GGTGTGAGACCCCTTGGTAAAGTTTATGTTAAAGCAGTACTGCTAGTTTGTATAATATTT
TACTCACTGTAGGATGGAGGGGAGAATTTTCTTGTGGCCGAACCTTTTTTTAAAATTTTT
TACGCTACCCCTTAAGCATCGGGTGGGGCGCACTGAGGAGCGGGAGACTGGGGAGCTGTG
GGAGGTGCACGGCAGCCACATGATGTTTGCACTGAGAAGTGAGCGCTCTGCGCAGGGATG
ACCTTAATCTATCACCCTTGACTGATGGCTGCCTGCACGTGAGATGGCAGGAGGTCTTCC
AGTGCTGTCTCCTGTCACGGCCCTTCCACGCCCCTCAGTCATTAGGTTCTGCTTTTTCTT
ATCCTTTTTCTTCCCTCTTCCTTACGGGCCCTTTGACCCCAGTTTTGTTGGGGACTTTCG
TGTTAACCCACTTCCCCTGGGACCACTTTCCCGCGATCTCTGTAGTGCTTGCCCTTTGTT
TTTGCTTTGTGTTAATTATCCTTCTCCCACCCAGTAAAGGTTCCACAGCTCAAGGGAAAG
TGGGAAGGGTGTGGGCATAGAGAAACGGTGGTAAAAACTCTGCTCCAGACTGATAATCTT
GTTTTTTTGTTTGTTTGTTTTGTTTTGTAGCTCTTCTGTCAAAAACTAGTGTCTTTGTTT
TCCTCTGCTGTTCCTCAAGCCCCACTCTTCCCCCTTGTTTTCACCTGTTCTGTGTGAACC
CATCTAGACGCCCCTCCCCTCCTCCCCCTGCCGGCCTAGTTATGGCAGAGAACGATGTGG
ACAATGAGCTCTTGGATTATGAAGATGATGAGGTGGAGACAGCAGCTGGGGGAGATGGGG
CTGAGGCCCCTGCTAAGAAGGATGTCAAGGGTTCCTATGTCTCCATCCACAGCTCTGGCT
TTCGTGACTTCCTGCTCAAGCCAGAGTTGCTCCGGGCCATTGTTGACTGTGGTTTTGAGC
ATCCATCAGAAGGTAAATGTTTTGTTGGGCGTGGATCCCTCATTAGAGTCTTTAAGGATA
CGAGGCAGAGGTGTGTCCGTGGTTTCTCAGGTGGTAAAGGTTTATGTTTAGGAGCGATTG
GGAAATACAGTATCAAAAACTATTTCAGGAGAAGAGGCTTATATAGGCTGAGTGGTAGCT
CAAAAGTGCTAGTGATTCAAAAGAATGTAGAGGTCTGCTGTTTTCGTAGACTGACTCTTC
TTGTCTGTTTTTAATTTTGTCATTTTGACTTCCAGTATTAAGTCTCCAGGAATGGCCTGG
TTAGACTTTTAGTACCTCTCTGTTGCTCCAGACCAACTCTGGTCTCTGGAAACTGTGTAA
CTGGTTTACAGGTATCTGGGTCAGATACCGACTTCTTCATTTTGTCCAAGGTTGTAGGGT
TGTGTGATCCAAGGCATGGCAACCTAAGTAGAAGTGGTCTGTGGCAGGCACTCAGAGCGG
CCACAGCCTGTTAAGGAAAGTTAAGTACAGAGTCGGGGTGTAAGAGATGCTAGCAGGGCT
GGGAAAGCCTGCACCTGGAGGGAGCTAGAGCTAGAAACAACTAGAAGGGCCTGATTGTCG
AATGAATTTGGTCGAGGGGGCAGAGGTGGAAAGGCTCTGGAAGTTGACAAGAATTAGGGA
GATATTCTGACACTTGTGACGGAGACATGGCTTTGGTGTGGTGAAAAAGTGCTGAATTGG
CCTGGAGACTTAAGTCTAATTATCTTTTTTTCAATCCTTCTTCTAGTCCAGCATGAATGC
ATTCCCCAGGCCATTCTGGGAATGGACGTCCTGTGCCAGGCCAAGTCGGGCATGGGAAAG
ACAGCAGTGTTTGTGCTGGCCACACTGCAGCAGCTGGAGCCAGTTACTGGACAGGTATAC
TTGGGGAGAGTGCTGGGGAGGACATTTGGATTAGTAATACGTGGGAAGGATGTTTCTTTT
TCTTCTTCTTTCTTTATTTTTGGGTGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTGGAAACTTGCAGCTCAGCAGCTCTTTCTGCAGGTGTAAATACTTATC
TGTACATGTCACTCATAGTACATGTAACTGATAGTAAGTTCCCACAGACTTTGGGAATGA
GAGACTTTTATTGAAGGGCTGGCCTTATAGCACAGTGCTTAAATGCTGTGCGTAGAAAGC
TGGATCCCACATGGTTGGCCGTGGTTCTAATCGTGGCCCCACGTATTGAAATCACGCTAG
GTGCTTGTGTATGTATGCTCAGATGCTTGACAGGAAGGAAAAATGGAGGAGGCTTGATCA
TACCCCACTGGGGTAGTGTTTTCTCTCTTCTTTCCTCTGGCGAGTGACAAAAAGATTTTA
CTGAAACGTCGGACTCGTTTGGTTATGAATTATAACCTGAGATGCTTGCTGTATTTAATT
TTGGAGAAGTGCTAGTTTGCCTTAGTTAATACACAGTATGAATAAGCCTGCATAGGGTCC
AGCAGGTGGTGTGGTTGAGGCGTTGGACTCCCACATGGCTGACCGTGGTTTGAGTCTGGA
CCTGGTGGCTTTCTTTCTTGCTTTCTCATCTGGTGAGTGCTCATACCCCACAGCAAATTA
AAATAAAAAGAATGGTCCGACAGGTGGCATGGTTGTTAAGGGCACTGGACTCCCATATGG
CCAACCATAGTTTGCATCTGGGACCTGGCAGCTTGCTTTCACTTGCCCCCTCTCTCTTGC
TCTGTCCCTCTCTGGTCAAATTAAAAATAAATAAATAAATAAAGTTAAGTAAAATAATTC
TTAAAAAGAATAATAAGATTAAATAAACAACTCTGAAAAGATGGGCCTCCGTAGCAGGAG
ATATCATGGTTGGACTGTGGGTGATGGTTACAGTAGGACCACCTATTTTGCTACTCTTTA
CACTGGCTTAAGTCATTTGCTGTGTTTTGATGATAGCTGAGATTTGGAGTTGTGCAAGAA
AAAACTGGAGTAGCTAAAACAGCTCGTTATGGTGTGTGAATTTTTAGGGTTCTTCATAAT
TTCAGAGAATTGAAAGATGTTGAGGACTGTAACAGTTGGCCTGAGTTGTCCATTACTTAT
GTTGATGTGGTGTGGTTCAGAAATATTGGGGAACTTTTTGGGAATGCAGGTTATGTAGGT
CCTCCCCAGATTTACTAACTATGTTCTTGCAAGATCCTAGGTGATGGGAGCTTGATGAGC
ACTGATGTCTGACTTCTTACTCCTGCTAGGTGTTCTGTTCAGATTAAGATTTTCTTCTCT
ATTATATTTTAAAAGGAACTAGAGATGAATGTAGTCATTGGCCTAAAATGACATTTTCTT
AAAAACTAGAGTAGTAATAGTAATCCAGAAGGCCATACAGTGCAAATATTTGTGTTCTCC
CATCTCTGGTCCTCTGAGCCATAATCACTTTTTTTCCCTGTAATGGGCCTGTGTAACCAA
GGATTAGGTTTGTTTCTCAGTTTACTAACTTAAAGTCTTTGTGATTTACAGCAAAACGTT
TCGCTGTGTATGCTGTTACTCCTGGTTTTCGCAGGTGTATTGATCTTAATTGTTCAAATA
GGCCTGTATGTGTATGTGCACATCTTTGTCATGGCCCTGTAACCCCTATTCTTACATCAC
CAGCGCCCTTAGCTTTACCTTGTTAGCTCACCCAGCCGGCTTCTGTAGGTTGATCCGTAG
CTTTACCTTGTTAGCTCACCCAGCCGGCTTCTGTAGGTTGATGCTGAGAGTCGGAGACCA
GGACATGATTTACATTGTTACAACTATGGAAACATTTATTGTGCTCAGTAGTGAGCTAGG
ATTTTGTTCCTTCTCTGTCTGTAGGTCCTACTCACCAATCCCTTTGCTTCTCAAAAGAGG
ATGTTCTTGGTGACAGGATTAAATATAAATTGTCATTATGTATTCTTTCCTTCCTTACTT
TCACTCAAAATTGTTACAGTGACTTGTTGAGGGCAGAACAGTTCTATAGAATGTTCTAGT
GGATTTATCTGGCTATTCCCTTACATTGTTTAGCCTGTTCTTTCCTCTTGGTATTTCCTA
TAAACTGAAATTTGTATTTGAAAGCTTAATTGATTTGGGGTAAACATTTTTTGGCAAGCA
TCCTTCGTAGGTGGTGGTGTGCTTTCTGTCTCGCCACGAAGTGTGTGTGACCCGTGGCCC
GTGATTTTAGAGTTACAGTAGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTCTTACAGGAGGTGGAGCCCATTTGGCAGT
GTGAGCCATGAGGAGTGGTTGTAAACACAGGTGAAGCCTCAGGCATTAACCTGCTACCCA
CCCCCTGCTCCGCGGTGTGTAGGCCAGACTGGCTTGGCACTCTCAGGCCACTGGTTGGGG
ACCCCTGTACTAGACTGTAGAGCTGACTCTGTGTTTATTTATTTATTTTTTAAGAATTAT
TTTACTTAACTATTTACTTACTTTAATTTGACCAGAGAGGGTCAGAGTGGGAATGGGAGA
GGGAGAGAGAGGGAAAGTGAGAAAGCAAACTGCTAGGTCCGGGACTTGAACCACGGTTGG
CCATGGGGGAGTCCAGTGCCCCTAACTACCTGCCAGCCCAGGCTCTGTATTTTTTTAATT
GCCAGAGGGCATGCACACTTGCTTGGAGAAGGAGAATGCATTCTTCAGTGGATGTGTTCA
TGCTGTAATTCCTCTCTGTCTCCCTCCTGTTGGGATCTGGACTCACACATGCATGCCTCC
AGTGTGTTTCTCACTCTTCTTGGGCCAGGATTCATGTCATAGTTGGCTGTGTGGGTTGTG
TGGGATCAGGCTCTCAACCACTAGGTGGCTGGGCTGTTCCATATTTCAGTCCTTATTTAT
TTATTTATTTATTTTTAAGAGAGTTTTACTGTAGGGTGTATGCACTCACTGGAGAGACAG
ACTGAGATACAAAAAGTGAGAAATCACCCCCTAGACGGATGGCCACACCATAGTCCCTTT
TCTTCCATTCTTCTCTCGGGATTTTGGGCATGCATGCACACACTTCTGACATGAGTTTTA
AGCCGCCAGGTCTAGGACTTGAACCATGGTCGACCGTGTGGGAGTCCAGCAATGTCACTA
TTACACCATCAGTTGGTCCCCAGTCCTTATTCTTGAAATGAAGTCTGGCCCTAGAGTCAT
TGGAAGAAAAATGGTTAGAAAAAGTCAAGAGAACTGAATGCTAGTCTTCACTCCTTGACT
AGTGATGTGATTTTGGGACCTTGGATAAGGCACTTGTTTCTTAACCTGAGTGTTTGGCGG
ACGTTAGAATTTTAGGTGAGTTGACCTCTAAAGTTTCTCTTAGTTCTGATGTGTCCCAAG
GATTGGTTTAGATTGAGCTGGAAACTCTGGGAAGATTGGAACCTTTCCTTTCTTGTGAGA
TACTTTTTTCTCCTGGCATGGCAGGTTGCAGTATTTTTTGGTGGTCTGTCCATCAAGAAG
GATGAAGAGGTGCTGAAGAAGAACTGCCCGCATATCGTCGTGGGGACTCCCGGCCGAATC
CTCGCCCTAGCTCGAAATAAGAGCCTCAATCTCAAACACATCAAACACTTTATCTTGGAT
GAGTGTGATAAGATGCTTGAACAGCTCGGTGAGTGGCAGTGCCGTGCCTGGGCTGTTGTC
TGGGCAGTTACCTTTGAGCCAAATGATGTTTATTTGGTACAGGAGCACTTCTGTGCAAGG
ACGACTCCTCATCTATCACCCATGACTGATGGCTCTGGGCTCCCTGGTTGTTAGAACACT
GCTTGATTTTTTTTCCTTTTCTTTAATAAGTTGGGGGGAGGGAAAAATACCCTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNACGGCAGCCTTCAAGGGTGGGCATCCAGGCATCCCAACTGGAAG
CTTTCTGCTCACCAAAACTCATACCTTCCCGGGTGGGCAGGAGAGCAAAGAGAGGGACAG
ACAGATGGCAGGGGCATTGTCCACAAGAAGACCCAACAGCGCAAATGAATCCACCCCCTC
CCCACCTCCGGGGTTTGGGGGCCTTTGGCACCTCAGTCCCCCGATTCCCCTACTCCTTCC
CTGCCCCATACCTCCTCGCACCCATCCGGAAACTCGGTTGATGTGAGCCGGCAGCAGAGA
AGCACCGTGGCGCGGCGAGGGAATGCGGACGGCACCCGGCGGTGGATGGCGGCAGCGGAG
GCCGCGGGGAAACCCGACCAGGAAGCTGAGGACCAAACCAGCCTCTTTTTCCGTTCCCGG
TTTTTTTCCTGAACCCAATGCGTGCCATGCCCTGTTTACCCCCATATATGTTGGGGGAGG
GGTATCCTGAATGGGGTGGTAGATTTTTTTTCTTTAAAACCTTTTTTTTTTAATACTCAA
AGGAGAGGGATGTTGGAAGGGTAAAGTGGAGAGCTCCACTTGGCTGTAACCAGGTGGGTG
CTAGGGCTCGGGGCCAGGCGGCCGTCGTGTGAGCAGTGCTCCTGTCCACGGAGTGGCTCT
TGTCTTTATTTGGACCTGGAGCGACAGCTAACATTTGAACGAGGCGTGGAGCTGCTTTTT
AGAAAGCTTGCCTCGTTAGCCTACCTTCTGGGGTTGGGCGTCTGAGCTTTCCCTGGAGAG
GGAGGGAAGTACATACACACACCCCCTTTCCATCTTGCAGCCTATGTTCCCAAATACAGT
ATGAAGAGTGATAGGAAAGTTAGGCTTTGGGACTTCCTTGGTCCTTTTCTGTCACTTTCA
GTGCTACTTCCTCCCCTTCATGGGTGGTTTTTTTATTTTGAGGATGAACGCATCTGCTGC
TCTGAGTGTTCTGTAGCCCTGTGTATCGATACCTGCCATGTGAGCTGGGGGTGGTCTGAC
TCTTAGTTCAGAGATCGTCTCATCCACAAGTATTCCCTGTTGACGGAAGCAAGTTTTACT
CATCCTGAGTAATCTCGGCTTCTTAAATGGCATTTTGACTATGTCCTTTGTCACATTCAG
GTCTTAAAGACATCACTTTCCTTCTGTGCCTAAGACTCTTAGGGGAAAGAATGTAAATGG
AGCAGTCCTTGTTCCCTCATGTTCTTACAACCAGCCCTGATGGAGTTACTCTGACCTTGG
GTCACTGTTTCCCATTATTTCCCAGGTGTTTGGATCATGTTCTGTCTTTGAGAATCACAT
CCCATTTTCTGTCCACCACCTCCATTTGAGGTAATGGCATCTTGCCATTGGGTGGTCTCT
CCAGTCCTTTACCTTTGTGAAGTTCCTTTTCCATGAGATTCTTCAGTTGGGCAGTTTTTA
AAACTCCTCCGTGAGGAAGACAATTAGATCTAATGCAAAAGAGACCACAGTAAAATAAGG
GGATTTTTGGGGGTGGGGTTGGGTTTTCAGTCTTCTCACTTCTCCCCATCCCCCCCATGG
GGTGTATTGGAGATCAACTTCCTCCACCCCCCCAGGTTTAACCCCCCCACTCTGCCCTCC
TCCCGTTCCCTACCCCCCTTCCTTCCCACCCAGACAATAGAGAACGTAGTGGATAAAGAG
ATTAATTGACCCTGCATGTCTAGTTCAGTTCTCGGTAAATCGGAGGAAAAGAGAGAAGAA
CGGAAGCTATTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCTGT
GTTTTAGTACTTTTTATTGAGGAAACACGTATGTGGTGTGGAAGAAAATGGTGGGAAAAT
TCTCCTAAAATGTTTTTTTAGGGGCTGTCTCTGTGGCCTAGTGGCTAAGATTGCTGGATC
CCACATGGCTGGTTGCACAGTTCAAATTCTGGCCCCAACAGCTTGGAAAACAAGCCTTTG
TGTGTGTGGGGCCGTGTGCATGCATATTCATGCTCCAAATCACAATAGGGTGGAGAAAAA
GAGAAGGGATTGTGGCATGACCATACCCCATTGTGGGGTGCTTTCTCCCTCTCCTCCTGG
CTGGCACATTACAGAAATTTCTTGGGACCAGCAGATGTTGTAATGGTTACGTCACTGGAC
CCCCACATAGTTGACTGCGGTTCGAGTCCCAGACCTGATGGCTTAAAACTCATGCCGGGG
ACGTCTATGTGCATGGCCAAAATCCCAAGAGGAGAGTGGAGGAGAAGGGATTGTGGTGTG
GCCATTCTCCCCTGGGGGTGGTGGTGGTGGTGGTGATTTTTTGCTTTCTCTCTGTCTCTT
TGGTGAGTGCATGAACCCTATAGCAAAAATCTCTCCAAATAAATTTCTTTTAGGTCAGAA
ATGTCTTTTTGGGGGGTGCTTTTCTGTGCCATGGCTGACATGGATAAGTTCTGAATATTT
AAAATAAAATATTTAGTAAAATTAAAACCTGAGAAGGGCTTTAATAAAGTTTATGAAGAT
CTTGCACTATTGGGAACCAGCAGTTAGCGTAATGGCTATGTCGCTGGACTCCCACATAGT
CGACCGCGGTTCGTGTCTCGGACCCAGTGGCTTAAAACTCACGCCGGGTGCGTGTACGTG
CGTGCCCAAGATCCCGAGAGGAGAATGGAGGAGAAGGGATCGTGGCGTGACCATCCCCTC
TGGGGGGTGATTTCTCGCTTTCTGTCTCTCTGTCTGTCTCTGTCTGTCTGGTGAGCGCAC
GTGCCCTATAGAGAAAACCTCTCCACACAAAAAAAAAAAAAAAAAAAGGAAAAAAAAAGA
TCTTGCGTGTTAGGATTCTTAAGTCTGTTTATTGTACTACTTACTGAGAAGACACATGGC
ATGGATTAAACAGTCATGTGATCTATTTGTACTAAAAACAATTAGGTTTAATATTTTGTG
AGTAGGAATATCATTCCTGGTCTTTCCAGAGCTTAGGTTTAATTTTTACATAGTCAGGAG
TGAGTTTTATCTTTATCATCTAGCATGTTGGGCAACTTAGTTACTGTTCTCCGCACCTTC
TCCGCCTTCTCCGGCTAGGTTACTGGTAAAATCAGCTGAGAGAAAGGCTACATTACATTT
AGAGGAGGAGAGTAAATATGTGGTAGGAAATAAGGGATTAAAGGGAATTGCTGAGAATAG
AGTACTTGTTGGAAACTCCAGCATGGCCTTTCTCACGCGCTGTGACCCACGGCCCCACTC
ACCCCACGTCGCCCCCAGGTGGTGATCTTTGTGAAGTCTGTGCAGCGGTGCATTGCTCTG
GCCCAGCTTCTGGTGGAGCAGAACTTCCCAGCTATTGCCATCCACCGTGGGATGCCCCAG
GAGGAGAGGTGAGATGGAGATGTTTTGTGACCTAGAGAGGAAAAGAGATAATTGTAGAAA
GGGAATCTCAACAATTTCGTAATTTCCTTTATCACAAAGGCTTTCTCGGTATCAGCAGTT
TAAAGACTTTCAACGAAGAATTCTTGTAGCTACCAACCTGTTTGGCCGAGGCATGGACAT
TGAGCGAGTGAACATTGCCTTTAACTACGACATGCCTGAAGATTCTGACACATACCTGCA
TAGGGTGAGTCCTACACCAGGAGGGCATTCTACTTTCCCACCCCCTTTCCTTTATTTTTT
AAAAGAAGGTTTTTTTGGGGAACCAGCAGTTGGCCTAATGGCTGTGTTGCTGGACTCCCA
TGTAGTCGACTGTGGTTCGAGTCCCAGACCCAGTGGCTTAAACTCATGCTGGGTGTGTGT
GCGTGCGTGCCCAGATCTGAGAGTAGACGGAGAAGGGATTGCGGCGTGGCCATCCTCACT
AGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTT
TGAAGGAATTTTGCCATAGCATGCTTATGCTGCTGGAGAGACAGAGAGACAGGAAATGAG
AAATCCCCCCCCCCCCCCCAGGGGGCATGCCCAGGTCACAGTCCCTTCTCATTCTCCTCT
CAGGATCCTGAGCACACATGCACAAGAACCCAGTGTGAGTTTTAAGCCACCGGATACAGG
TCTTGAACCGTGGTTGACTATGTGGGAGTCCAGTGATGTAACCATTATGCCGTCTGCTGG
TCCCAACGCTGAAGACTTTCAATGACCAATTTTGGGTGGCTACCAACCTATTCGGCCAAA
GCATGAACATTGGCAGGGTGAAAATGTATGAGGATTCTGAAACCTGCCTGCTTCAGGTAA
GCCCTATGCCCAGGACACCCCACTCTCCCACCCCCTTATCTTCTGTATCTTTTCTTTTCT
TTTTTTGAGAGGCTTTTGCTATAGGGTGCATAAGCTTGCCAGAAAGACAGACAGAAAGCG
AGAAATCACCCCCAGGGGATGGCCATGCCGCAATCCCTTCTCCTACATTTTCCTCTTGGG
ATCTTGGGCACACATGCACACGTGCATGGCATGAGTTTAAGCCACCAGGTCCAGGACTTG
AACCATGGTCAACTACATGGGAGTTCAGCAATGTAGCCATTACGCTAACTGTTGGTCCCT
CTTCTGTATTTTTTCACACCATGTATCTTCATCCCTCCCCCTGGCTGCCTTCCCTCCTCT
GAGTCCTTCGTTGCTCCCCTCCATCTCCTTGCAGGTGGCCAGAGCGGGCCGGTTTGGCAC
CAAGGGCTTGGCCATCACGTTCGTGTCGGATGAGAACGACGCCAAGATCCTCAATGACGT
GCAGGATCGCTTCGAGGTCAACATCAGCGAGCTGCCCGACGAGATCGACATCTCCTCCTA
CAGTGAGTGTCAGGCTCCACCCGCGTCCTTAGTCCCACTGTGTCAGGAGGGCCTGGTGCA
CAGGCCCTCGGCCAGCTCATGCCCCTGGTCTCTGAGGCCACGTGGGCTGTGGCGTCGTCC
TCTCTGTGGGGTCTCTCTCTCATCAGATCATCTCTGTCGCACCCCACGTTTGTCCTCCAC
CGCACAGCCCCGCGTCTGCGTGCGTGTCTGCCCGTGTTCGCTTTCGTGCCTTGTTCTGAC
GGTGCCGTGTTTTCTCCTCAGTTGAGCAGACACGGTAGAGGACCCGCCCCTTCTGGAATG
CTGACAGTCTGTCCCCTCAGAAGAGGACCAGGCGTGGGGTGAAGGAGACACTACTGCCAC
CTGCCCCGACGGCCCCACCCGGCTGCCTCCTTGTGCATCACCACCCCGAGTCCCATTTCC
CGATTTGTCAGAGCTTTTTTAACAAAACTAGAAATGAAACGCGCGTCTGTGTTGTCTGTG
CTCCGCCCCTTTATTGTGGCGGGTCAGGTCGTGTTACGGAGTGACCCAGGAGGTCCCTGT
GAGGCCCTGTCCTGCTGTGGGGTCATGGGGCTGGGGCTGCACTGCAGAGGCCGTGGCTCC
CAGCAGCTTCCAAGTGCCGGCCCTGCCTAGGTCTCCTGGGTACTGGGGCCTGGGGCCCGG
GGCAGGCTGGAGTGTGTCCAGGGAAGGCTCCTGGGGGCAGAGGGGAGGACAAAGGGGGTC
TGTGGGGAGCTAGGCGTCGCCGAGGCTCTCCCTGTGCCGCCTCATCAGCTCCTTCAGCTT
CTGGATCTTGAGCACCAGGGCCTGGGCCTCCCAGGCGCCCTCCTGGCCTTCCAGCAGCTC
CTCAGCCTGGGCCAGCTCTGCTGTGCGCTGGAACGGGGGCCCCTGTGCAGGGGTGAGGGA
GCATCAGCCAGGGAGGGGGTTGAGGCCCTCGGAAGCCGGGGGTGGGGGGCTGTGGCTGGA
CTTGAGGAAGCCACCCTCCTCGCTGTTGACCCCATTAGCTGAAGGCCCCTGTTGGAGAAG
CCAGGGTCGTCCCTGTGGGCACAGGCCGTAGGGTAGAGATGTGTAAACACCGGGGACCTG
CACCTGGGCTCCTCGGGCAGGATGTAGGGTCACAGGGAGGACTGGTTGTCCCTCCCTAAT
AAATAATTAACAGTGTGTGTGTGTGGGGTGGAACTGCTGCTCAAGGACTTGTGGACTGCT
GCTGGGGAGGCAGGGAGGTTGGGTGGGGAGAGGGAGCCCTGAGGTCAGGCCTCGGTGGGG
TGGGGAGTGCAGGAAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1211, 1966..2093, 2404..2496, 7764..7947, 8855..8973, 11313..11342, 11345..11359, 11365..11397, 11400..11441, 12978..13087, 13179..13323, 14434..14581, 14841..14857
1001..1211, 1966..2093, 2404..2496, 7764..7947, 8855..8973, 11313..11342, 11345..11359, 11365..11397, 11400..11441, 12978..13087, 13179..13323, 14434..14581, 14841..14854
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved