Tupaia_belangeri Locus RPL5
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri RPL5
Tupaia_belangeri
RPL5
GeneScaffold_5878
SNORD21, SNORA66
3898..3992, 8971..9103
10542
TCTCCATTCTCCTGGGATCTTGAGCACGCATGCACATACACATACCTGGTGTGAGTTTC
AAGCCATTGGTTCTGGGACTCAAACTGCAGTCAGCCATGTGGGAGTATAGTAACATAAAC
GCTATACCATCTTCTGGCCCCTTTCTCTGACTTTTCAAAGTATTTAGTTTACCAGCCACC
CAGTGAATAATCTTTTTGGTATTTAGAAGTAAAGCACTACATTGTAATTTATTCTAAAAA
CATTCTCATACATAGTGTTCAATCAGTTTAGCTTTACTGTGACAGACTTTCTGTATGTCT
GTATATTCCAGATTTACTGTATAACTGCTCAACTGCTGTATTAACTAAACAGACAACTTT
AAATGATGCTGATTTGTGTCCATCTTTATTTTTTTTAATTAATTTTTTTGAGGGGGAGAG
ATTTTTGCTATAGGAGGGTGTGTGCGCTCATCAGAAAGACAGAGACAGAGGGACAGAAAG
TGAGAAATCACCTCCCCCGGGGGGGTGGCCACACTGCAATCCCTTCTCCATTTGGGATCT
TGGGCACACATACAGATGCGCCTGACGTGAGTTTAAGCCACCAGATCTGCAGTTAACTAC
ATGGGGATCCAGTGACATAGCCATTACGCCAACTGCTGGCCCTGTGTCCATCTTTATTTT
TTTAGAGAGATTTTTGCTATATGGTGCGTGCACTTGCTGGAGAGACAAATGAGAAATCAC
CCTGCACACACCTTCTCTCCTCCAGGGGCTAGGGATGGCCACACTGCAGTCCCTTCTCCA
TTCTCCTCTTGGGACTTTGGGCATGCACGCACACGCTCCCAGCATGAGTTTTAAGTTGCC
AGGTCCAAGACTTGAACCAGAGTTGACTGAGACTCCAGCAATGTAACCACTATACCATTT
GCTCATCCTTATGTTTTTAATTACTTTGAAAAAGAAGGCACTTAAAACTAAATAAGTAGT
GAGGGTAACAGATTACTAACCTGGCTTGTCACTTTCTGCAGATTGCTTATGCCCGTATAG
AAGGGGATATGATAGTCTGCGCAGCTTATGCACACGAACTACCCAAATACGGTGTGAAGG
TTGGCCTGACAAATTATGCTGCAGCATATTGTACTGGCCTGCTGCTGGCCCGCAGGGTAA
GTGCAAGATGACTTCGATGTACTATGGGATTAGCTCATTGCTTGAGCTGCGCCTGAGGTG
TTTGCACATGGAGAAGATAACCCTCAGCCCTGGCTTCAGGAAAGTGCCTGCTATGGCCCT
GTCATTGACACGGGCCATGATAAAGTTTGGTTAAGGTGGCAGTACACTTTCTAATCTGGG
GAAATAGTTGTTTCTCTTCATGTTGGTGCATTTTATCTAGATCAGGTCTGTCCAGTAGAT
TCCCTGCAAGGATGAAGAGTTGTAATCTGCTGCCTGTTGGCATAACCATCTGTGGCTATG
GAGCACTTGAAATATCTAGTGCTACGGAGGAATGGAATTTTTAAATGTGAAAAGCTACTT
GTGGCTAGTGGCTACTTAATTTGACAGTGAAGTCCCTTGCTGGGCAGCTGTACATCTTAT
GACCATCAGCTGTGTTAAAAGTGTAGACTCATGAGGCCTCCATTCTGAGCACAGTCTATA
TTTTGATAGAATGTCCCAAGTGACTTTTTTCCACATTAAACCTTGAGAAGCGGTGTCTTG
ACATTTTAGAGGGGTGGGCTTGGGCAGGATTTAATAGTTCCCATTTAGTTGGCAGCTTTT
ACTGTATGTGTTATACAAACAGGTATGAAAATGGGATTTTGCTTAACTTTGTTACCTTAA
TTACTGTTTTGGAATGGTGTTGTCAGTCACACACATAATGTTGAGAGTCCACATGTTCAT
TGGCTATAATGTTTGAGTGGGAGGTATATTGTCATTATATATGAGAGCAACTTGGTGCAA
AGGCACCGTTTATGGTGAAACCATCTCACTAGGTGACTATATATCAGCAGGGGAGTGGCC
CAAATTAACATGTAGTTGGAAAGTAGAGCCTTGGAAGCTGTTTACCCCAGAACTCTCCTG
TGAAAGTTTTATTACAGAGTAAATTAAGACAACATGTAATAACATTCAGTAATTAGTTAT
TGATTCTTCACGTCTGAAGAAATGTGGATATTACCTTCCTTGAGTAAATATAACAATCAA
ATTAAGTCTTACACATTCAAATTGATTTCTGCAGAAATTAGATACAGCTATGTCCAGAAA
AGATCAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCT
AAAAAGATTTTTAAACTTCAAACTGGAAAGATTGTAGGCCCATTCTTGGTCGGCCATGTG
GGAGTCCAGCGCCCTGTAGACAGATAAGTATTAGGTGGTAGAGAAAGTCATAACATACTT
TTCTAAGTTTTTCTATGTAAAAGTGCATCATAGCTTTTCCAACAATCTAGTAGGTTAATT
TGTAGTGTCTTTGGTTTGAGTTAATAATGTGTGTGTGTTTTTTTGTTCTTTACATCCTTA
TTAACCTTAGAGGTGTTTGAGTTAGTGAGATGAGGATGTACCAAGGGCATTCTTGATTAT
TTCAGCAGTTATCTTAGATAGATGTACCCCCAAAAACAATAGTAGGATTTGGGGGATGAA
TTTCAAAGTTCTTTTCTATGTTAATATCCAGAATTAATTTTTGTAGTGTTAGAAAACCAT
GGCTTAAGGGTGTTTGTGAGGTGAATTTCTTTTCTATCCTGGAATTCAGAGAAGAGCTGC
CGAATGATGATACCCCACTAACTGAGCAGTCGCTAGTTGGTCCTTTGGTTGCATATGATG
TAATTATTGTTTCAAGACGGGACTGATGGCAGCTATTGAAGTGAATTCCTACAGGTAAAC
TAATTTCAATCTGTACTAAAGTATGAAACCTTTATTTTAGTACCAAACGATTCCCTGGTT
ATGATTCTGAAAGCAAGGAATTTAATGCAGAAGTCCATCGGAAGCACATCATGGGCCAGA
ACGTTGCAGACTACATGCGTTACCTGATGGAAGAAGATGAAGACGCTTACAAGAAACAGT
TCTCTCAGTACATAAAGAACAATGTAACTCCAGACATGGTAAAAAATTTACCTAAGAATT
CCTGTATTAGTTGATTTGTAGAAATGGACTTACTATTTGTTCTTGGTGGGTTACCTTATA
CATAGGTTTATTATAAGTTGCAGGTAACAGCTGAATTTTGAAATGTAGGTACCAGTAGAT
TCACATAAGCTGTCTTTGGTTTAAAGTGAAATTAGGAATGTTGGATGCACATAGCTTAAC
AAGTCGGGTGAGGTAGTTTAGTCATGTGTGATATGATGACATTTCACTCAGCAGGGCATT
ACATGTATGATGGTGGTCTCAAAGTGATACCATGTAGCCTAGGTGCCCACCAAGATTTGT
GTAAGTGTACTTCTGTGCTATTTATATAGTCATGGAATTGCCTGACAAGGCCTTTCTCAG
AACCTGTCCCTGTGGTTAAGGTGTGCATGACTTTGATGAGCTAGACTTGTCGCTGTGTTT
TTACTGAAGCATGGTGGACTTCAAGCATCTAAATCAGTGGTCTTCAACCTGTCTGGCACT
GAGGACCAGCACCTGTCCATGACCTGGGGGTTGGGGATCCCCATCTAATGCTTTATGGTG
CCTTTAATTTTTTTTTTCTTAAAGAGGTTTTTGCTATAGGGTGTGTGTGCTTGACAGAAA
CAGAAAGTGGGGAATCACCCCTCAGGAAGGATGGACACGTGCACACATGCCCAGCGTGTT
TTAAGTTGCCAGGTCCAGGACTTGAACTGTGGTCAACTATATAGGAGTCCAGCGACACAA
CCATTGTGCTGTTGGCCCCTGGCTACTTAAGTTTTGTGGATGTCCTTCCTATAGTTTTTT
TTTTTTGAACAAATTATTTCGCTTTATTTATTTTATTTGCTTATTTATTTTAATTTGGCG
AGAGAGAGAGTGAGCGAGCAAGCAAGCAAGCAAGCCAGCCACCAGGTCCGGGACTCAAAC
CGTTTTCGCCCATGTGGGAGTCCAGCACCCTTAACCACCACGCCACCCCCCGCTTCCTAT
AGTTTTGATCTAGTTTGTTTGATTTAAGATGCTATATACTACAACTTGACTAATTTTGTT
TTTACTTTTTTTTGAGAGAGACATTTTTGCTTTAAGTGTGGATGCTCACCTGAGAGACAG
AGAGAAATTGAGAAACCACCCTCCAGGGGGGTGTGTTCACACCACGGTCTCTTCTCCATT
TTCCTCTGAAGACTTTGGACATGCACACATACGCGCCTGGCATGATTTTCAAGGCACCAG
ACCACCATCCAGGACTCAAACTGTGGTCGACCCTGTGGGAATCCAGCGCCTTAACCACTA
TCACCTGCTGGCTCCAACTTCATTCATTATTTTTTTAAGAATTATTTTATTTATTGTTTA
TTTTAATTTGACCAGAGAGGGACAGAGGGAGTGAGAGAGAAGGAAAGTGAGAAAGCAAGC
TGCCAGGTTCAGGACTTGAATCAAGGTCGGCCATGTGGGAGTCCAGCGCCCTTAACCACC
ACACTACCTGCCGGCCCCAACTTCATTTTTGAGGCCAGAGGAAGAAAGTTCTTCATAGCA
AATATGCCACATCAGGGCTTTCTGAAGCTCTCAGGCATGGACATAGGGAGATGTGCAGAT
TTGATCACTAGCTCTGCATGATATTATAGAAATGAAGGGAACCATATTGTTTTGTTTTGG
AGAGATTTTTCCTAAAGGGTACGGGAGCTTGCTGGCAAGAGATCGCCTCCCCAGAGGGAT
GGCCACACTGCAGTCCCTTCTCTAGTTTCGTCTTGGGGTTTGGGACATGCACACATATGC
ACCTGGCATGAGTTTCAAGCCACCAGATCTAGGACTGGAGCCGCAGTTGACTATGTGGGG
AGCCCAGTGACATAATAATTATGCTATCTGCTAGTCCCAAGGGAACCAAGTTTTACCAAA
GTGGGCTTAGTATTGGAAACTTAGCCCAAAGCTGAATCTCCAGAGCTTCCTCTGCTGAGA
CATTAAAAATGATACAGCTTTTTTTTTTTTTTAATTTGCTTTAGGACACAGATGCTTGCC
TGAGAAAGTTAGAAAGCCTTCTCCTTCCCTTTCTTGGTAGGGTGGGGGATAATTATACAG
AAGTCCCTCTTGTCCTTGCCACTTTTTTGAGCACACACACCTGAAGTGTTTTTCAGGCTG
CTGGTTCTGGGATTCATAACTGTGTAGTCTGCCATGTGGGATCCTTAACCACCAAGCCAC
CTGGCAGGCCTGAAAATGATTGTTTTGTTTTGTATAATTTTTTGCAATAGGGTGTGTGTG
TTCATTGGAGAGAGACTAAAGAAAGTGAGAAATCATTCCCTAGCAGGGATGGCCACACCA
CAATCTTATCTCCATCTCCTCTTGGGAGTTTTAGGCATGTACACACCTCTGCCAGCATAT
TTTTCAAGCTGCTGGGTCTGGGGCTCAAGACGCACAGTCATAGTATGTGATCCAGCTGCC
TTAACTACCACACCACCAGCTAGCCTGATACAGTTCTGAAGTTATAAACAACACCCTTTT
GAGTCTTCTTCCCCTTTGCCTCTTACATCTCTCCTTTTGTGCATGTGTCTGATCTATAGC
ATGAATTTTGAAAATAAAGGAATTATAGTAAAGTGTGGAATACAAATCACATCATTACCA
TGCTCTTCTAACTATAAAATCTAAAAAAAAAAATTAGGGATAATTAGGTTCTTTTCTGTC
AGTACGTAGTAGTTTGTATTTTGGACAGTTGGCTATGAATTTTAAGATGGTCATAATTTG
GAAGAGATGACTGATACTTCTGTGCTTTTTGGACACAGTCTGAGACTGAAAAAACACATA
GCTCGAGTTTTTGAGTTAAGAATTAATGGGTAGTTTTATCAGTTTTAATATGTTGTCTAT
GTTAACGTTTATGTGTGTATATTTCTTTGCATTACTACTGATTTCGCCTTGGAGAAGTGC
CGGGGTCAAAGGGATCTTTTAGTCTGGAGAAGTGCCTTGGTCCAAGGGATCTTTTAGTCT
GATTGTACTTGGCATGCATACTTTTCTTCCTAAGCCATATGTACGATCTGGTCGTGTCAT
ACTTAGAACCTGATGTAGACTTAATTGTCTATGCTTTCAGACGTTTGTTTCCTAGTCTTT
CCTAGGTACTTGGTATATTTCAGCCATACTGCTCTTTGGCTGCCATACTTTTCCAGCTGG
GTCATTATTTTTTAAGAGAGATTTCTGCTGTAGGGCCCATGCACTTGCTGAAGAGAGAGA
AAGTGAGAAATCGCCCCCTGGGGAAATGGCCATGCTGTACGTAGTCCTCCATTCTCCTGG
GATCCCGGGTCACACACACATGCCTGGTGTGAGTATAAGCGGCTGAGTCCAGGACTAGAA
CTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCAGAGTGGCGCTG
ATATCAGATCGGCCGGTCTACTGCCCGTCGTTTTACAACAATCCAAAATCTGGCAAGCTT
GGCTTGCTTTCTTGCTCTCAGGAATGCACTCTCTCTCTCTCTCTCTACCTGTCCCTCTCT
GGTCAAATTAAAATAAATAAAGTTAAATAAAGTACTTAAAAAAAAAAGAAAGAAAAGGAT
TTATGTAGTTTCAAAGACAATGATCATTTCGGCAATATTTGTCTTTGCTAAACTTCATGC
ACTTGTGTATTGTCATCATAATATTCTCCACATGAATGAGTGCATTTTTAGAGACGGAGG
GTTACCTTTGACATAGCCTTTTAGGGCGCTGTAATATTCAGAGCTGAAACTTCTGGGGGA
GTGGAAGAGTTTTAGAACAAAATGGCCCAATAAGATAGTGGTAGCTTCTTGTGGTTTTGT
AGAAAATCAGGCCTGTGTCTAATTCTGGATGCCTTGTATTACTGCCTGATACTAGTGACT
AGTATTAAAGAAGAGATCTCTGGTACATGATACTGGGAATTGCATTGAAAAATGGGGTAA
AGATGGAGACTGTGGGATGACAAGTAATTTGATGGTTACTTGTTGTCTCTAGTGTCCAGT
CGTCCTCGGTTATGTCTGTACTCTTATCTTGGCCCTATGTACTGGTCATCTTAACATCTT
AAGTAAGTTTTGTTTTGGCAAGTATCCCCATGTGAATGAAAGAATATAGGCCAGACGGTA
TTTAAAATAATAAAGTGTCAAGTATTTCTGCAGAGAAAGACCAGGAGACTTTAGAAAGTT
CATAGGAAAAGTGGATTAAAGTAAAATACCTATTTATTTTAGTCCCCCAACCTTTTGATA
TCCATGCAGCTTTCTCATAAAGGATTTTTTCCTTTCTTTTTTTTTGAAGGCCCATTATAA
ATTTGCTGTGGATCTACTCAAAAAGTACAAAGTGTCAGTTCATACTGTGTAAGATAAAGA
TTGGGAATTTGTTAGGAAAAGGGGTTAAAAATTTAAGCAGATACCAGCATTGATTTGATT
TAGTTCCTTTTGAGAATCTGGCTTAGAAGGGCATTAGCAAGAAGTAGTAGAGTGTATGTT
ATGTATAGTAGGGTATGTGAAATGAAACCAAGTACTGTTTTGCTTTCCTTTGTTTCAGAT
GGAGGAGATGTATAAGAAAGCTCACACTGCTATACGAGAGAACCCAGTCTATGAAAAGAA
ACCCAAGAAAGAAGTCAAAAAGAAGAGGTGTGTGAGGAGGAGGTTGGGGGTGGTTCCTAT
ATTCAAAGTGGGTCAGACTGTGAGTGACATTGTGCAAACTCGATCACTAGCTCTGCGTGA
TGTGGCAGACGCTAAGGGAACCAGGTTTGCTAAAGTAATTTTGGTGATAGAAATATGTAG
TTAGCCTCAAGCTATTGAGGTGGCCCATTCTATCCTGTACAGTATATAGATATCAATTAC
TGCCTTTTTTCTTAGTGGTTCCCTAAAGAAAAGTGTTCTTTTAATCTTGAATTTTTTTGA
TCTTTATTAGGAATAATAATACTTTAACAAACATTTAAACATTGTACTAACATGGTTTTT
ATTGGATTTTGGGCCCTGAGTTTATAGAGCGGCATCATAGGAGTTGGGGTCTGGGAAAGT
TGACTTTAAAATCATATGTAGATACATGTTTTAAGGCTTAGATTGATTCAGCCTCCATCT
GATAACAAAGTATGTCTTTTTCTATTGAAATTAAGTATTTTTTGTCCTCTTTGGCTTTTG
TTCTAAAGTTCTTTATTTTGTAGGTGGAATCGTCCGAAGATGTCCCTTGCCCAGAAGAAA
GATCGGGTAGCCCAGAAGAAGGCAAGCTTCCTCAGAGCTCAGGAGCGGGCTGCTGAGAGC
TAAACCAAACAATTTTCTATGACTTTATTCATGATAAAAGATAATAAATCACAAGAAAGC
AACAGTTTCTCTACTAGGCTGTGTTACTGTGAAACTAATTATCCTAAAAGCAAAGGAGTT
GACAGTCCCTCCATCCCCAAGAAACAAGTATAGATTTTTCTAGAAAAAGCTGACCTGTAT
GTTGACTCCAACAAAGTTCATCCCTACCTGGGCTTCTCTTCTCCCTGACAGGCTTGGTTA
TCGCTCAGATTGAATGATGTTCGGCCCCTAAACTGCCAACAAGCAACAAACTATAACCAT
CACTAGGAAGTTATTTCTTTCATCCATTTATTATATCCAGATGATTAATGGGAAGAAAAT
ACCTTCAAAGTATACATTCTTAATGCAAACAAGCCTGGTGCTGATTCATGGCTTTAGTAT
TTGAGAAAAGGATATCTAATGCAAGTCACATAAATTTGACACATTCACTTCTATCAAGTG
AAACCTTTGAGCAGAGAATAATGGGGCAGTAGTCTCAAAGAATACTTTGAGCAGGGACCA
GCAGTTAGCATAATGGCTATGTCGCTGGACTCCCACATAGTCGACTGCGGTTCGAGTCCT
GGCCCCGGTGGCTTAAACTCACACTGGGTGCTTGTGCATGTGCGCCCAAGATCCCATCTG
TCTGTCTGGCGAGCGCACACATCCTGTAGCAAAAACCTCCAAAAAAAAAAAACTAAACAG
AAGAATACTCCTCTAAGGAGGTGTTTCATTTTGTGGAGATGTTGAAAGATACATGCTAGA
TCTGAATATAATAAGAGGAACAAATATTAAGTATATCAAGTTTACATGGGGAAAAAGGTA
AGATGAATAAATTTACATATTTCTAAGAAATAGCCCTTTGACCCACAGGAAATAGTGTTT
AGAAAACTTTAAAAAGTCTTCCAGGACCAGCAGAAGGCATAATGGCTGTGGAGCTTGACT
CCCATATAGTTGACTGCGGTTCAAATCCCAGACCCAGTGGCTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1135, 2721..2923, 4060..4237, 8818..8906, 9443..9542
1001..1135, 2721..2923, 4060..4237, 8818..8906, 9443..9539
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved