Tupaia_belangeri Locus ENSTBEG00000005310
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000005310
Tupaia_belangeri
ENSTBEG00000005310
GeneScaffold_5664
SNORD48, SNORD52
1345..1407, 2100..2166
3302
ATCCGCTGCACAACAATGTGAATATATTCAACACTAATGAACTACACACTTTAAAAAAT
TATTTATTTATTTATTCATTCTTTTCTCTTTTTTTGGAGAGGTTTTGGCTATAGGGTGCG
TCCCCTAGCCAGAAAGAGAGAGACAGAAAACAAGAAATCACCCCCAGAAGGGCCACGGCG
CAACCCCATCTCCTCCATTCTCCTCTCCAGATCTTGGGCACGCACGCACAGGTGTCAGGT
CCGGGACTCCAACCGGGTTCGACTACATGGGAGTCCAGCGACATAGCCATTACTCCAACT
GCTGGAGTCTCATTCACTTATTTTAATTTGACCACAGAGAGAGACATACAGAGAGAGAAG
GAAAGTCACCAGGTCTGGGCCTCGAACTGCGGTCAGCCATGTAGGAGTGTCCAGCGCCTT
AACCACCATGCCACTACAGTAACGCATTTTTTTAAAAGACATCAAATTGTATATGAAATA
TACACAGTCTATAGTGTCTCCAGTTACAGTTCCAGAGTTGCTTCAAACCAAACTCGCAGC
TCAAAGGTGCCTGACAGGTGTGTGGGCTCCGAGGGGAAACGAACTCCGAGTTCGCAGGCG
GAACGGACCGGGACCCGGGACGACAGGGGAAGAGCCGCCAGCGGGAGCTGCTCTGGGGAG
CCGGAACCGCCAGGAGGGGGCGCCCGAGCAGCGCCGAGCTCGCGGGGTCCTGCGGCCGAG
GCGTGCTCCCTCCCGCCTGCCAGCCAGATTAGCAATTTTTTATTTTTCAAAGTTGACAAA
ACACCCCAAGTATTTGCTCAGAAGAGTATGAAATATCCGCTCATGGCCCCTTTTCATTTC
GTTCTATTCGCGTTAGGGTGGACGATGGCAAGGCTGCCGCGCGCCAAGGCAGGCACAGGA
GAAGACAGCTATGCCCGTCAGGACCCCGGCCGGGCGCGGCCATAAATACTCTGGTCCCAC
CCTCGTGTTTCCCTTCGGACAATGGGGTCTGCGCTGGTCGGCAGGTACTTCTCGCGGTCG
GCCCGGGCCCCTGCGGCGGAGCCGGTCGCGCGGTCATGGCGCAGCAGCCCTTCCTGGTGC
AGGTATCTCGGGGCCTGCTGGGGAGGGGCCGCGGCCCGGGCTGGGGAGGATGAGGTTCCA
GTACAGACTAGAGTTTCTGAGGTCTCGGTGACGCCACTGCTTGACACTGACCCAGCCCGG
GGAGGAGGGCACTCGGCCGGAGTGGTCCCGGCGTCGCCTGACGCTTCGGTTTCTTCCTAG
GTCTCTGGTCCCCCGGGCGCGTCCGCAGGCGGCCACGAGGGTGAGTCGGTCAGAAGAGGG
AGTGGCGGCCACCCTGGGGGAAGGGGCTGATGATGACCCCAGGTGATTCTGAGTGTCTCG
CTGACGCCATCACCGCAGCGCGCTGACCGCCTCCGGCCCCCTCGGGCTGGGATGGGATGC
CTCATGTAGGGTTCGGGGAACTTGGTGGTCAGGAACCCTTGTTAATCTTTGATTTCTGTG
TCTTGTTCTCCCAACTAGGGGTCTTAAGCCCCCCCGATGTCCTGTTCTCGAGTGAAGGTG
AGTGTTAGGTACGAGAGCGTTGGGCGCCTCTCACAGACGATTTTGTTCCAAGCTCTTACA
TGGCCACGGTGCAATCTTACCTTTCAGTCACCTCTGGAGATTTTGGGCATGCACCCACAC
ATACACATACACACACACACACACACTTGATGTGCATTTCAAGGCCCAGGAGTCCAACGA
CCTAACCGCTACGCCATCTGCTGGCCCTGGGGGTGTTTTCAGCCCTTGATTTAAGATTTG
AACCAGTGGGTTCATGGTGTGCCATTCAGCTGCCTTAGCCACCATGCTACCAGCTGGCCT
GTGAATAGTGCTGTTTATATTTTTGTAATCCACATTTTAAAAACTGGTTAACCCACCTCC
ACTCCTGTTTGTTCTCTAAAGTGAGTGCATGTGGGAGCATCTAAGTGGAGCTGTTTTCCT
GCAGTTCGGAGTTTACTTCGTACTTTCTCTTCTTTTGCTCTTAAACTTCCCATCCCTGGG
CTTCTCGTTTGATAGATCTCGTGCCAAAATAATTTGTCTTGATCCTGGTCTCCCTAAATT
TGGAATGATGATTTCACAGACTAGAGTCTCTGATGCTGGTTCTGATGCCAAATGCAAGTT
CTGACCCATTTAGGGAGCCGGATCGTTAGGTCTTGAGAAGGGCAAGAAGGAGGACCAGAA
CACTGGTAGTTCTCATTGGCTGTCTCATTTTAATCTTTCAGCAGTGAGACCTGGAGGCTC
ACCAGTTGGGCAGTGCCCTTCCAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAC
CCCCAGGGGGATGTCACGTTGCAATCCCTTCTCCATTCTCTTCTCGGGATCTTGGGCATG
CACGCGCACATGCCCGGCGTGAGTTTTAAGCACTGGGTCCGGGACGTGAACCGTGGTCGT
CTACGTGGGAGTCCAGTGACATAGCCATGACGCTAACTGCTGGTTCCCGATTCTATTAGT
TTCTTCATGGCTTTTTGTTTTGTTGTAGGGCATGTATACTGGCCAAAGAGAGACTGCTCA
CTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1025..1043, 1046..1071, 1076..1079, 1082..1093, 1096..1098, 1101..1110, 1112..1164, 1176..1217, 1220..1228, 1230..1247, 1286..1293, 2262..2280, 2283..2284, 2287..2302
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved