Tupaia_belangeri Locus BAT2
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri BAT2
Tupaia_belangeri
BAT2
GeneScaffold_5672
SNORA38
1298..1428
16661
CTTGGGGAGCAGGCAGTATTAGTGAAAGAAGTGACTGCTGGTGGACATTTTTAACGAGG
ATAAGAGAATGAGGTTGGTTTTGGCCTTGGCGCTCTGGTGTCTGGCCTTTGACTGCAGGA
TGCTCTTAAAGTGGCTCCATATGCTTTGTTTTTCTCAGTTCTGTATAGGGTAAGTCAGAG
CCCATCAGTATTTTACCTGGAGACAATTTTTTTTTTTTTTCCCCCTTGGAGCTAAGATGG
GGGAAAGTTTAGGAAAATACAGGATATTCTGAATGCTTGGGGTTCTGTAGCCTGAGAGTG
TGGAGAGTCCAGCTTTTCTATGAGAATTTTGCTGGCCTCGGTCCCCTGTTCGACTGAGCA
GGCTCATAAAATCGTTAAGCTCCCAGCATACCTTCCTGCAAACCTCCCCAGATGGGAACT
GAGGCTTCTGGGAATAGAACCTGGGGCACAGGGCCCTGGGGCGTGATTAGGGAGCTGGTG
TCTAATAAGTAGGGGATCTAAAGCCCTGTTGCTTGTGCAGTGGGGCTGTAGGTCTATTTC
GGGTTTTCTCTTGGGTTTGTACTGGCTTGCCTTGATCTTCTGTAGGTCTCTGAAATGGTT
TTGGTGGAGAGGAGAAGTACTTGTTGGGGATAATGAAGAGGCTGCTATTCTTTATGGACT
CTCACAAAGAGCAGAGTGTTTATACTAGGAGGATATTAGGCTTTTATTTGGATTTCTTTG
GCAAAAAGTGGGGGAAAGAGGGAACATGGCATTTGGGCTGTATGGGAGCTGAGTAGATTG
TGGTTTCCTAAAGGGGATGGAGAGTTTACATAGGCTGGAGGAAAAGACACCAGAGGGCCA
TATATTGGAGTCCCTAATGAGAATGAAAGGGAGCTTCTAGGTTTCTATTAGGTCTGTAAA
GGAGGCAGAGATTGAGACACTTGCTGTCTGGCCCACAGGCTCCGGCACGTTTTGGGGGAG
GTGCCTGCAGGACCCAACATACTCAATGAGCTTCCAGCGCAATGTCCGATCGCTCGGGGC
CGACTGCCAAGGGGAAGGATGGAAAGAAGTATTCCTCGCTCAACCTGTTTGATACGTATA
AGGGCAAGTCCTTAGAGGTCCAGAAACCCCGCTGGTGAGGGTCCTGCAAAGATGCTACTA
ATGGTTGGAGGCTAGTTGTGAATGGGGCATACGTTTTAGAGCCATTTGAAGGGGAACACT
TATTGTAGAGATAAGAAAAGACCAGGGAGACACTGGAGACCTCCCGACATTACCTTGGGT
CCTATAGAGGGTCGTGGTCTCTGGGTGATTACCAGTTACCCTCCTACAAAGGCGTGTCTG
TGGTTGCCTGTCTTTGGACACGTAAGAATTGGAGGCAGAGAAATGTGGATTTGGAGGAAT
CTGGAGCCTGCTTGCTCCCCGCAGGCTCAAGATCACCCATCCCATATAGAAGCATTTATT
AAATTAAGTCTTGCCTGTAGACATTTCAGAAATTATCAAGGGCAGGGAGAGGGGTGGCTT
GTAAGAGGAGTTTGGACTAAGTGGGCACTATGACACTGAAGACATCTAAATGGTATCTAG
GGTGGGAGGATGTCAGATTTCCCATGTGAGGCATTTTTGACCCTCTTTTTTTTTTTTTTT
TTTTTTTTTTAACCTTTTCTTCAGTTGCCCCTCGTCATGGCCTGCAGAGTCTCGGCAAAG
TTGCATGCCCGCGTATGCCACCCCCAGCCAATCTTCCAAGCCTGAAAGCCGAGAACAAAG
GCAATGACCCCAATGTCTCATTAGTGCCGAAAGACGGAACAGGATGGGCAAGCAAACAGG
AGCAGTCCGACCCCAAGAGGTAGATAGAGGCTTGGGGGTTCTAGAGTGATCGTTATTTTA
ACTTTGAACTTTAGGGTGAATTGGGGATTGGCCTAGCCTGGTTAGGTAGAGCCAGAGAAG
AAGAGAGAGATCCATTTTCGATGTATTTTAGGTTTCCTGTTCGATAACTGAAGTATGTAT
GGTGTTTTTAGTTTTCTCTTAGACATAAGAAAGATAACAGGCTATGAAAGATGACAGAAC
TAAAATATTTTGTCCAGATATTTGTTAATGGTAGCAATTAACCTAGGTTAAGTCCTTACT
TTCCACTAGTTGGAGAAGCAGGGCAGATGTTTCAGGCTCTGAATAACCTTGAATTCTGAA
TTCTACCATCCCCTCAGTTCCGATGCCTCAACAGCTCAGCCGCCGGAATCGCAGCCACTG
CCGGCTTCACAGACGCCTGCCTCCAACCAACCGAAACGACCCCCAGCAGTCCCCGAGGTA
CGGGAGAACTGGATGGACAGAGGGAGGAATGGCTTCTAAGCCTACCCACATTACTGTTTA
TCTTCTCTCTGCTTCCCTAGAACACTCCTTCGGTTCCAAGCGGGGTAAAGTCCTGGGCAC
AAGCCAGCGTCACCCATGGAGCACATGGAGATGGTGAGTTTGGGCTGTCTGGGGAGCTGT
GCCTTGGGAGGCAGGAGCCCCACCCTCTACCTTCAGCAAAGTGTCCTTGGTCCTCTTTTA
CTAAATCTTTGACTCCGTATTCATTTTCATGGGGCATGAGAACAAATTTAAGTCTCAGCC
TTACGTGGGGCGTGGTGGAGTTTCAGAACTGATCTTGCTTCTTGGGGAATGAACACTTGC
CTCAAGCTACCAGGGCTGGGACTTGAACTGTGGTCAGCCAGGTGGGGTCCCACCTCCTTG
ATTACTGTACTGTGGGGCTGGCCCTAGAGCCTTCCACTTTTTTTTTGTAATTTGTCAGAG
GGCATATGTGCTCACCAAAGGGAAAGGGGTAGTGAGAAAGCAGTCCCCATAGGGATGGTC
ACGCTATAATCCCTTCTCTTTCTCCCTCTTTATGGAATTTCGGGCATTCACATGCCCAGC
ATGACTTTTTAGATCTGGTCAGCCACGTGGGATACATCCAGCACACCACTGACTGGCCAG
ATCCCGTGTGTGTTGTCTGTAAATGTACTTTTTTTTTTTTTTTTTTTTTTTTAAGAGAGA
GAAGTTTTTTGCTGTAAGGGCGCATGCATACCAGAAAGACAGCGAGAAATCACCACTACC
ACCCCCCCACCCCCCTCAGGGAGATGGCCATGCTGCAATCCCTTATCATTCTCCTCTAGG
GGTTTTGGGCATGCATGCACACGCACCTGGCATGAGTTTTAAGCCTCCAGGTCCGGGACT
TGAACCATGGTTAACTATGTGAGAGTCCAGTGACATAACCATTACACCATCTGTTGGTCC
CTGTAAATGTACTTCTGTCAACGGTTTTGCACTCCTATCCACACAGGTGGAAGGGCATCA
AGCCTACTGTCGCGATTCTCTCGAGAGGAATTTCCGACCCTGCAGGCGGCTGGCGACCAG
GACAAGGCTGCCAAGGAAAGGGAGTCTGCCGAACAGTCGTCTGGGCCCGGACCAAGCCTC
CGCCCCCAAAGTAAGTGGCCTCGTTATGTGAGTGGGTGAGTGGCTGCTTTTTTGACCAGG
ACGTTACTTGTTCCATCTCAGAACTAGATGCTGGCTTAGTCCTTTTCATTATTAGCTATA
TTTACTTGCCACTGAATCGTTGATTTCTCTTTATTTTTACCTTTACCCAAATCACAGACT
CTACAACTTGGAGGGATGGAGGTGGACGTGGCCCTGATGAGCTGGAGGGCCCGGACTCCA
AACTTCATCATGGTCATGACCCCCGGGGCGGGCTGCAGCCTTCAGGCCCACCCCAGTTCC
CTCCCTACCGCGGAATGATGCCGCCCTTTGTGAGTTTGGATATCTTATTATAGAGTGGTT
GTGCTGGAAGCTAGCTAGAAATCAGGAGGACTTAATCTTTGGTGGGGATAGGTAGAAAGT
AGGGACCTATGGGACATGAAGGGTGAGAGGATGATGGCGGGTTTTAGGAGCCCACTGGCT
GTTTGTCCTTCTGAGCAGTAACTATTTGGCCCTCTTACAGATGTACCCCCCATATCTCCC
GTTTCCTCCGCCCTATGGACCCCAGGGGCCTTATCGATACCCTACTCCTGATGGGCCCAG
GTGAGGGATCCAGGTCTGGGTTTGTGATGGGGGGAGGGAAAGGCTGTTGGGGGAGGAGAT
GATATTACATTGGCATTGGTATTATGGCTTGTCATCTTTTACTTTCTCTCCCATTTGTTT
TTTTGAAATAGTCGCTTCCCCCGTGTGGCAGGGCCCCGGGGCTCAGGGCCGCCAATGCGC
CTTGTAGAGCCTGTAGGTCGGCCTTCTATTCTTAAAGAGGATAACCTCAAAGAGTTTGAC
CAGTTGGACCAGGAGAACGATGATGGTTGGGCAGGTAAGTAGAATTAAAGATCAATCATT
TGGATCTTTGAAAGGCAAAATCTGATGAAAATAGAGGGTTGTGCAGGAAGAAATGGAAGG
TACGAGATGTAGCGAGGTACAAACTTTGTGTCTTTAGTGGAGTGTGTGTGCTCTCGTCAA
ACTTGTCATCGTGTTGACCTAGAGTTCACAGGGAGGAAGTTGCTATGTGATGCATAGCCC
TTCCAATAGTTGCGGACCACTTTCTGTGTCCCAGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCTGCTGGTCT
GCTATGACAGATCGTGGGGCCCACCTGCAAGCTCAGCACCGAAGACGAGGATGAGGCCTG
GCGGCAACGGAGAAACAATCTTCGTCTGAAATCTCTCTGGCCGTGGAGCGTGCCCGGCGA
CGACGTGAAGAGGAGGAGCGGCGCATGCAGGAGGAGCGCAGAGCAGCCTGTGCCGAGAAG
CTCAAGCGGCTAGATGAGAAGTTCGGAGCACCGGACAAGCGACTCAAAGCAGAGACTGCT
GCTCCACCTGCTGCCCCTCCTGCCCCAGCTCCACCACCCGCCGTCCCCAAAGAACTCCCT
GCACCTCCAGCTCCCCCACCGGCACCAACCCCAACACCAGAAAAAGAACCTGAAGAGCCA
GCACAGGCCCCTCCTGCCCAGTCCACCCCTACTCCAGGTGTGGCTCCACCTCCCACTCCG
GTGAGTGGTAGTGGCAGTACCAGCAGCACGAGCAGCGGCAGCTTCGAAGCCAGCCCAGGT
ATGGAGGTGGAGATAAACATTAGCAAGTGTTAGGTCTCTGAGTGGCTGAGGGTACGGGTG
GTAAGAATGGGGTAAACGAAGTAATAGGTGATGTGGGAAAAGGGTCTCACATTCGTACGG
GTTGTTAAAGGGAGGCATCTAAAAGCGTTTTCTGTATGCCTAGAATGGCACAAGACTGAA
GAAGGTGTTACTTTGGTGGTTTCATAGGAAGTTAATACCACTACTTTTGGCTCTTGAGAG
ACCATGGGGGTGTTTTTATGAGTCTTATGATGGTGAGTGTGATTCTTCTGTAGGAAAGTT
TATGGGTAAGGCCAAATACCTCAGTCTTTAGGGAGGGAGCTAGCGATTTGGGATGGAAAT
TCTGGGGGTTCATAGGATATCTGTGGATGAAATAGGGCCACTGTGAATTGTTGTCTTTTC
CTTAAATGCAGTGGAATCCCCAACCCTCCCTCAAAAGAGGGTCCCTGAACACCAGAGGAG
GGTCCTCCTCTCACCACACCCCCAGCTCCAAAGGTGGAACCCAAGGGTGATGGGGCTGGT
CTCACCCGGCAGCCCACCAGCCAGGGATTGGGCTACCCCAAATATCAGAAGTCGTTGCCA
CCTCGTTTTCAGCGGCAGCAGCAGGTAAGAACAGGTTGCTTCCTTCTGAGGGCCTCTTCT
CTCTCTGGCTTCAGTACTCAGCCTATCTGTGAAATTACCTGCTGGGTCTCACTGTTGCTT
TTGTTCAGTTCCATTTCTGTTGGGTCACCACAGTTTCCATTTGTTCATTAACCTTTTTAT
TTTTTTGTGGTTCCTTTGTGTGTGCACCACTGGCACCTCTTAGTCCTGTATTGTGTTCTT
CACTAGGAGCAGCTCCTGAAGCAGCAACAGCAACAGTGGCAGCAGCATCAACAGGGCTCT
GCCCCACCTGCTCCAGTGCCCCCATCCCCACCACAACCTGTGACCTTGGGGGCTGTGCCA
GCTCCACAGGCTCCACCACCACCTCCCAAAGCCCTGTACCCGGGTGCTCTGGGCCGGCCT
CCACCCATGCCCCCAATGAACTTTGATCCCCGCTGGATGATGATTCCTCCTTATGTGGAT
CCCCGGCTCCTCCAGGGCCGGCCCCCTCTAGATTTCTATCCTCCTGGCGTTCATCCCTCT
GGTAAGGGGCCACCAGGGGACTGCTGAGGGAGCCTCTCAGTCCTAGGAGGCAGCTGTCAG
GGTGCTACTGTGATTTTGGGTTAGCTGGTCTTGCCAGTGAAGCGGGGAGGGTATATGTTT
AGCACTGTTGAGTTCCCTGGTGAGAATGGGCTTAAGGGAGAAATAAAAAGTGGTTCTTCG
TTCACCAGGACTTATTTATTTGGTGGGGAGGTTGATTCTTCCATTGGGAAGCTGAGCGGC
TAATTTTAACAAGAGCAGGCAAGTCCTAACTTGAAACGAGACGGAAGAGCCGATAGGGAG
GACTAGATTAGGGAGATGGCTTTTTGGGCTGTAGGATCTGTGACACAGAGTTGTTTTCTT
ACTTTTTCCCCCTCAGGCCTAGTTCCCCGGGAGCGCTCAGACAGTGGGGGCTCAAGTTCA
GAGCCATTTGAGCGCCATGCACCACCCCTCTTGCGGGAACGGGGCACCCCACCAGTGGAC
CCAAAGTTGGCCTGGGTTGGAGATGTCTTCACCACACCCACTGACCCCCGCCCACTTACC
TCACCACTTCGCCAGACTGCAGATGAGGATGACAAGGGCATGAGGTGAGTCTGGGTAGTG
AGAGATGGGTGAGTTCCCAGTGAAAGGCTCTGGGCGTAAGAGATAGGTACTTTGGGTTAT
TGGTGAAATGATAGGGATGAACCAATGAAAGGAGTGTCTGTAACTTAATAAATTATTCTC
TCTTTTCACTTAGTTCTGGTTTTCTTTGTCCTGAGATAACCTATTTTCATTTATTTTTTT
CTGTCTCCCTCTTCAGGAGTGAGACTCCTCCAGTTCCTCCCCCACCACCCTATCTGGCCA
GTTACCCTGGCTTTCCTGAGAATGGAGGCCCTGGACCCCCAGTCTCTCGCTTCCCACTAG
AGGAGCCAGCTCCCGCAGGACCCCGTCCACTCCCCTGGCCTCCAGGCAATGATGATGCAA
CTAAGATACAAGCTTCACCACCCAAGAAGGAGCCCCCCAAGGAAGAGACTCCACCGTCCA
CAGGGCCTGAAGCAGGCCGAAAGCCTGTCCGTGGTGTTGGAGGTGGAGGCCAGGGTCCCC
CACCGCCACGCAGAGAGAGTCGTACCGAGACCCGCTGGGGCCCTCGCCCAGGCAGCAGTC
GACGTGGAATGGCTCCAGAGGAGCCAGGAGTTCCTCCCCGCCGAGCTGGACCTATAAAGA
AACCCCCACCACCAGCAAAAGTGGAAGAGTTGCCTCCTAAACCTCTCGAACAGGGAGATG
AAACCCCCAAGGTCCCAAAGCCAGACCCACTTAAGACAGCCAAGGGGAAGATGGGTCCCA
AGGAGACCCCACCCAGTGGGAATCTTTCCCCTGCACCAAGGCTTCGGAGGGACTATTCCT
ATGAAAGAGTGGGTCCTACTTGCCGGGGTCGGGGCCGAGGCGAATATTTTGCTAGAGGGA
GGGGTTTTCGGGGTACTTATGGGGGGCGGGGGCGGGGAGCCCGAAGCCGAGAGTTCCGCA
GTTACCGGGAGTTCCGTGGAGACGATGGGCGAGGAGGTGGAGCAGGGGGACCAAACCACC
CCTCTGCTCCCAGAGGCCGCACTGCCAGCGAGACGAGAAGCGAGGGTTCAGAGTATGAAG
AAATCCCCAAGCGTCGCCGGCAGCGTGGCTCAGAAACGGGCAGCGAGACCCATGAGAGCG
ATCTGGCCCCCTCTGACAAGGAGGCCCCTCCACCCAAGGAGGGAGTGCTCACCCAGGTCC
CTCTTGCTCCCCCACCAGCGGGAACGCCCCCCTCTCCAGCCCCAGCCCGCTTCTCCACTG
CCCGTGGTGGGCGAGTCTTCACTCCCAGAGGGGTGCCATCACGGAGGGGTCGCGGTGGGG
GGCGGCCACCACCTGTTTGCCCAGGCTGGAGCCCTCCAACCAAGTCCCTGGCTCCCAAGA
GCCACCTATAGGCCCTTTGCCACCAAGTAAGGAGCCTTTGAAGAGAGCTGATGCCAGGGC
CTCTGTCCCCATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTAGGGCATGAATT
TAAGGTTAAAATTTGGGGAAAGGATAAAGTCTTGGTCAGGATGGGAAGTTCGGGTGCATG
GCACTGGAGGCATACAGGCTTGTTGGGCACTAGGATTTCCAGGTCCAGGTAAGGCGGGTG
GAGCACAGTTGATAAGTGAGCGGGACCCAAACGTTTCTCTCCATTCATTCGTTTGTTCTC
TACAGATCTGTGTGTGTAGAGAGCCGTACAAGGGCTCGGAAACCCCTGCATTGTAACGGG
AGAGCATGGGTCACAAGGAGGGAAATTAGAAAACAGTTTGACTTGTAGGGCGGGAGTAAT
GCTATAGCAAGTACTGGAGTCGATGCTCTGTTTTCTTCAGCCGGCCCCCAGAGGAGCGGC
CCCCAGGGCTCCCCTTGCCTCCCCCACCCCCCAGCAGTTCTGCTGTCTTCCGCCTGGACC
AAGTCATCCACAGCAACCCCGCCGGCATCCAACAGGCTCTGGCCCAGCTTAGCAGCCGCC
AAGGAAGTGTAACCACGCCAGGGGGGCATCCGAGGCCCAAGCCTGGGCCTCCCCAAGCCC
CTCAAGGCCCCTCCCCACGGCCCCCAACCCGATTTGAGCCCCAGAGGGCCAACAGCAATG
GCATCGGTTCTGGTAAGCTGGAGGGGGTATGGGTGGGGATGTTTCTATCCACACAACAGG
TCAAATGCTGGAAGGGGAAGGGGCTGGCCTGGGGGCGCTGCTGCTGGGTGTTCCAGTGAG
CAAGGGTGGGAGGATCGGGAGGTGGAGTAGGGAGGAAAAGTTGGGGTCATTGGTAGAAGA
AGTCAGATGCTGACAGTTTTCCCCTCTTCCCCAGACCCCCACTTCGAGGAGCCAGGGCCG
ATGGTGAGGGGGGTGGGCGGGACTCCCCGGGATTCTGCCGGGGTTCATCCCTTCCCCCCC
AAACGGCGAGAGCGGCCTCCCAGAAAACCGGAGCTGCTGCAGGAGGTGAGGGTTGGGGCT
TGAGCTTGTGCTTCACTGTGTTCCTCTTGAAGGTTCTTGGTTATGGTTTTCTGTTGTCCT
AAGACCTGTCGTGTTCTTACCCAGAGTTCTGTTGTCACTGCTTGTGCTCCCTACCCTCAC
TGTCCTGCCTTCCTGCATTTCCCAGGTCTCTCCTAACTTGTATTTCGCTTCTGGCCTTTG
TTACTTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGGAATCTT
TGCCACCTTCTCATAGCTCTGGATTCTTGGGCCCTAAGGCTGAGGGTCCAGGTCCTCAGG
GAGAACCCAGAGATGCAGGCACCGAGGCCCTAGCCCCTCACATCTGGAATCGTTTACATA
CTGGTGAGTAAAGCTCTGTGAAAGGCGTACGGTAGAGGGGTAAAGAGTGAGGTGGGCTTC
AGAGCTGCTTCTCTCATTACCTCTTTTCTGGGGCTGATAATCCGCTCTCCAGCCACTAGC
CGGAAGAGTTACCGGCCCAGTTCCATGGAGCCCTGGATGGAACCCCTGAGTCCTTTTGAG
GACGTGGCTGGAACAGAGGTGAGTGAGGACGGGAGGGAGTGGCTGAGCTGGGGTTTTGCT
GAGCACTGGCCACACTTCCCTATCTGTTTGGGGTTGAGTCGGGCTGGGCTGCTGTGTCAT
ACGATTGTTTCTGTTTGGGTTGAATGTGCGCATCAGTCAGATACCAGGGTGCTTTCTGCC
CCCACTTAACTAGCTCCTTCTCCACTCCTCTCAGATGAGTCAGTCTGACAGTGGGGTGGA
CCTGAGTGGGGATTCTCAGGTGTCATCAGGTCCCTGCAGCCAGCGAAGTTCCCCTGATGG
AGGACTCAAGGGGGCAGCAGAGGGACCCCCCAAGCGGCCTGGAGGCCCCTCACCCCTGAA
TGCAGTTCCTGGTGAGGGTCCACCTGGCTCTGAACCCTCTGAACCTCCTAGGAGACGGCC
ACCTGCCCCCCATGATGGGGACAGAAAGGTAAGAGACCAAGAGAGGGTTAAAAAAGGGCT
AGGAATCTGACTATGGCCCTACTTTGACCTGCCCCTTTCCCTCTGCTGTATGTCGTGGGG
ATTCCCTGAACTGGGCTTTCCTTACCTCTCCCAGCTCCACTTCACTGTGTTCCTCAACCC
AGGAACTGCCCCGGGAGCAGGCTCTGCCCCCTGGCCCCATTGGCACAGAACGATCACAGC
GTGCAGACAGAGGTCCAGAGCCTGGCCCTCTCCGGCCAGCCCACCGACCTGGCCCCCCAG
TCCAGTTTGGCACTAGCGACAAGGTCTGCATGGGTTGGATCTGGGTTTCCTTGGTTGGGT
AGAGAGGAGGGAAGGCCAAGAGGTGGGACATGGAAGATAACAAGTCCACGTTATGGGATA
TTCTCCCCTGCCTTGTGGTTTATAGGACTCAGACTTGTGCCTAGTAGTAGGAGACAGTTT
AAAAGCAGAGAAGGAGCTGGCAGCATCAGTCGCTGAGGTAAGTGGGAGAATGAGTGGTGT
GGAAAAGCCTAGAATTTCTGGAAATGGTGGCTGGGTGTGAGGGGCCAGCAGCTGGCATGG
TGGTTGAGATGTTGGACTCGCACATGTCTGACCACGGCTCAAGTCCTGAAACTGGCTACC
TGCTTTCCCACTTTTCCTTCTGTCTGTCTTCGGTGAGCATGTGTATCTTAAAGCAAATGG
AAAAGTAACAATGATAAGACAAATTTAAATATACTTTTTTTAAAAAATGAAAAGATGAAT
GGGTGTGACCGAGGCCTTAAGGGTACCAGACATGCCTCTGCTCTCCAGGCCATTCCTGTG
TCCCGAGACTGGGAGCTGCTCCCCAGTACTTCTGCCTCAGCTGAGCCACAGTCCAAGAAC
CTGAGTTCTGGGCACTATGGCCCGGAGCCTAGCTCTTCTGGCCAATGCCTGTACCCCGAG
GTCTTCTATGGCAGCCCTGGACCTCCCAGTTCTCAGGTAGGCCACTTTCCATCTCATAGT
CCCCTTGAATGAATAACTTTTTTCCTGCCTTTCCAAGTTGTATACTTGTAAGACATCTTT
TTTTTTTTTTTTTTTTTTTTTTTTTACTTTTATGATCACTGCATTTTTTCTGTTGCTTTT
TAACCGCAGTAGGTGGGATGGGTGAGGTGTTCTTGATTAGATAAATTGGAACTATTTCAG
CCCCACACTCTCCCACAGGTCTCTGGGGGAGCCATGGACTCTCAGTTACATCCTAATAAT
GGAAGCTTCCGCCCTGGGACACCCTCCTTGCACCCTTACAGGTAAGATTAGATGTTTGTG
GACCTCAGAGGGAATTGGAGATGTATTTCAGAGGAGAAGAACAGGGAAGACACAATGTGA
GGGTACCAAGAGCTAACAGACTTAAGGTTTATTGCTTAAACTAAAGAAGCAAATGACGAG
CTTTCTTTTTTCTTTCTTTTTTTAAATGAAAGATTTTTGTTATAGAGTACATGTGCTCGC
CAGAGAGACAGAACGCGAGAAATCACCCCCCTCCCCCCAGGGGGGACAGCCTTGCTGCTA
TCCCTTCTCCATTTTCCTCTCGGGATTTTGGGCAGGCAAGCACACACAGGTGCCCAGCAT
GAGTTTTAAACTGCTGGGTCCAGGACTTGAACCATGGTCGACTACTTGGGAGTCCAGCGC
CGTAACCATTCCACCACCTGCTGGTCCCATGAGTGGTTTTCTAACACCTCTCCTCCCTCT
GATTCTTTTCAGGTCACAGCCCTTGTACCTACCCCCAGGCCCAGCCCCTCCCTCAGCAGT
GCTCTCTGGGGTAGCTCTGAAGGGCCAGTTTCTGGATTTCTCAGCACTGCAAGCTACAGA
ACTGGGGAAGCTGCCAGCTGGAGGAGTTCTCTACCCTCCGCCTTCCTTTCTGTACTCTCC
AGCTTTCTGCCCCAGCCCTTTGCCTGACCCACCTTTGCTTCAGGTAAGAGGTGGTCAGGT
GCTAGGGTTTCGAAGTTAGGAGTGGGGAGAATGTTGTTCTGGAGTTAACACAGTTCTCAA
TCCCCACCAGGTTCGCCAGGATCTGCCATCTTCAGATTTTTATTCTACTCCTCTGCAGCC
TGGTGGCCAAAGTGGTTTTCTCCCTTCAGGGGCCCCTGCCCAGCAGGTACTTTTTATCTT
CCCTGTTCCTTTCACTCTCTTTACCTAGTCTCTGGCTTTTAAGTGTTTTCATTTTCTCCA
GTGTTTGGCATTCTCCCTGTTCCTAATGTGCACACCAAAATTTCTCGTTACAGATGCTTC
TACCCATGGTAGATTCACAGCTGCCTGTGGTGAACTTTGGCTCCCTGCCACCGGCACCAC
CTCCTGCCCCACCCCCTCTTTCTCTGTTACCCATGGGCCCTGCTCTGCAGCCCCCCAGCC
TGGCTGTGCGGCCCCCACCTGCCCCTGCTACTCGGGTGCTGCCTTCACCTGCCAGGCCTT
TCCCCCCTAGCTTGGGGCGAGCAGAGGTAAGGTACAGAAACTGAGGTGCTAGGGAACTCA
GGAGTTAGGGGTGGAGCTTCTGTTTCTCAGGGTGAATGGGTTTAGTGGCAAAAGGCTCAC
AGTTTCTTTCTTTAAGCTACATCCAGTGGAACTAAAGCCGTTCCAGGATTATCGAAAACT
GAGCAGCAACCTGGGGGGACCTGGGTCGTCACGTACTCCCCAAGCTGGAAGGTAAAGGGA
AGTGTGGAGCTTCCTCATCCCCCCCAAGGGCTTGCTTTCTTTGGGACCAAGGGCAGGTCC
TAGGCTTACCTTCAATGTCCTCCCGTAGGTCTTTCTCTGGCCTCAATTCCCGTCTCAAGG
CCCCACCTTCAACCTATAGTGGAGTCTTCCGCACCCAGCGCATTGACCTCTACCAGCAGG
TGAAGGAGAAAGCCCCAAGTCTAAATTCAAGGATTTCTGCTGGAGCGCTTACCCATGACC
TCCCACTGTGACCTAATCTTCCACATGTACCTGTTCCCTAGGCTTCTCCACCAGATGCCC
TGCGCTGGATGCCGAAGCCTTGGGAGCGGACAGGGCCACCTTCTAGAGAGGGGCCTTCCC
GACGGGCAGAGGATCCTGGGTCCCGTGGGGACAAGGAGCCTGGGTTGCCCCCACCTCGTT
GAGGCAGTTCCCCTTGCCCCCCACCCCCGGGGCTTGTATATAGATTATAAATATATAAGG
GGGAAAGGGGTGGGCGAGGAGGGTTTGTGGGGCTGGAGCTTCACTTACCCTCCTCCCCTT
TTCCCTGTTCCCCATCCCTGGGGCCGTTTGTTAAAAAACAGTAATAAAAGGATTAAAAAA
AATTTTCCAAAATGATTTCAGGGATGGGTTGGTTGTTTATGATGATGTCTTTTATTTATT
AAGAATTAATGTATTTATTATTATTCAGTTTGACCAGAGGAAGAGGGAGAAAGCAAGCCA
CCAGTTCCAGGACATGTTGAAGGCAGAATTCCTCTAAATTGTCAACTAGTAACGCCGTAG
GCTTTCCAGCAGGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTTTTTTTATTTGCTAGTTTGGGGGGTAGGTATGAGAAAGACTCCCTG
AGGGGGGGTAGGGGGGGCTGCATAATCACCCACTTAGACGTAGGGGCCAGCCACCTCACT
TCACCACCTGGCTTGGGAGCATTCATTTTAAAACAAGTTAGGACCAGCAGTTCTGTGATG
GTTAAAACACTGGATCCCACATGGCCAACTCCAGTTTGAGTCCCAGATTCCACAGCTTTA
AAGAAACACTGGCATATATGTGTATATGCCCCAAATACCCAAAGTGGAGTGGAGAAGAGA
TTGCAGTTGGGCTGCCCCTGCCCTGGGGAAGGGAAGGAGGTGAGTTCTCCCTTTCTTTCA
GTTTCTCCTGAGGAAGCATGTGCCCTACAGCAAGCAAAAATAACTCGAGACTGTAATGAG
GATAGTTTGAGACAAGAGCCAGGAAAACCCGACTTTTATTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1105, 1107..1113, 1644..1684, 1686..1688, 1691..1818, 2177..2276, 2360..2432, 3286..3429, 3597..3748, 3940..4019, 4151..4293, 4877..4967, 5068..5284, 5652..5657, 5659..5673, 5675..5677, 5680..5712, 5715..6117, 6551..6561, 6564..6584, 6588..6743, 6966..7260, 7636..7843, 8056..9178, 9181..9219, 9224..9249, 9569..10228, 10900..11171, 11374..11504, 11813..11942, 12052..12137, 12334..12567, 12722..12862, 12985..13056, 13368..13535, 13758..13840, 14292..14502, 14590..14685, 14813..15025, 15136..15230, 15328..15418, 15521..15661
1001..1105, 1107..1113, 1644..1684, 1686..1688, 1691..1818, 2177..2276, 2360..2432, 3286..3429, 3597..3748, 3940..4019, 4151..4293, 4877..4967, 5068..5284, 5652..5657, 5659..5673, 5675..5677, 5680..5712, 5715..6117, 6551..6561, 6564..6584, 6588..6743, 6966..7260, 7636..7843, 8056..9178, 9181..9219, 9224..9249, 9569..10228, 10900..11171, 11374..11504, 11813..11942, 12052..12137, 12334..12567, 12722..12862, 12985..13056, 13368..13535, 13758..13840, 14292..14502, 14590..14685, 14813..15025, 15136..15230, 15328..15418, 15521..15658
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved