Tupaia_belangeri Locus KIAA1731
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri KIAA1731
Tupaia_belangeri
KIAA1731
GeneScaffold_4039
SCARNA9
44249..44612
46318
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACATAGTCTAGTG
TCTCGGGTCCCTGGAGGCGCAGGGTAACATGATATGGCTCACTGCTGTTGAGAGCTGGGG
AAGAACTGTCACAAATCAACCGCCCATAATAGTCCAGGGAATCGTGCAGTCGATACAGAA
AAGGATGCAAAGCTCAAGACGCCTTCGTGCCGTGACCTAAGACAAAAGTCACCCTGTGGT
TCTATGGCTCTGGGCAAATATCTTGTCCTTTCTGGACCTTCGCCTCCAGATCTGTAAAAG
AGGCACGCTGACAAAGAGGGAGTACGACTAGAAAGCCGCTACAGGTGTGAGAAATAATGA
ACCTCTACGTAGCGCGGGCGCGCTTGTGCGCGTGCGCGGGGAGCGGGACTAGGGACCTTA
ATGCGGGCTCAGCCTTCCCGGCAGCCCCCGGGGAAGGCGGGACTAGGCGGGTTCCCGCGG
TTTGGTCCCGCCATTGGCGGGCGGTTTGAATGCCGGAAGTGACGGGAGCTCGGCGATGGC
AGCCCCGCAGGCGCATAAACGGCCGCCTGGAGGCTGAGCTGCGGCGGCTGCTGAGGCTGG
TTTCCTCCGAGCTGCGGCTCTGGACTTCCGACTCGGGGTTCTCAGGTGAGTGCGGGCGCG
CCGGCGTGCCCTCCGCACTCCAGGGCCTGGGTGTGTCCGAAGTAAGGGCTGCGAAAAGGG
GCCGCGTTGTGAAGTAGTGGCTCGGGTTCTCGGGCCCCGGCTGCGGTCGGGCCGGCGGCT
GCAAGGAGTTCCTGGGCAGGAGGTATGGCCGGACCCGACCCTCCGGCCTCGTGCGAGAGC
CTGCGCCGCAGCCCGTTGCTCGCCCTCCCCGGGTTGGGTCGCGCAGGCCTTTCCTGCAGC
CTTCCCTATGCGTAGATGCCCTGAGCATCCAGGCTCGGGCGGCCGGGCCTCCGCTGCAGC
AGCTGCAAACGCTTCCTCTAGGCCACTCGTGGACAAGTCCTGAAACTGATGGCGGTTTAA
GAGCATTACCTGTAATCGTTTCATGCAAAGAGCACCTTCTCTTTCGATGTCTACAGCCTT
TCATTTCTCAGGTGTTTAAATGTTATCACGAACCCAGCTTTTAAAGCACTGGCAAATGTT
TGAGTCTTTAATACTTAGAGCGTATTTGACAATTTCACATAGATTAAGTCACGTAACCAG
ACAATCTGCTGGAATAGATATTGTCATTCTTACACAGATTAAGAAAATGAGATCAAGATA
TGTGAAAAAACCGCGCCAGTGTGTGCCTGCTAATAAGTAGTGCAGTGTTGGGTCTTAAAC
TCACATCTTATAAGTCTAGAATTAGTTTGGTGATTATCATGTGCCAAGTACCATATAATC
CTCAAGACCAAGTCTTGCCAAGATAAACCCATATTGATAGGAATAAATAATTTAATAAAA
AGGTAACTGGAGGAGCAGGGAAAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NACACACTCCCTGCATGAGTTTTAAGCCACTGGGTCTGGGACGCGAACCGTGGTCGACTA
CGTGGGAGTCCAGCGACATAGCCATTACACTAACTGCTGGTCCCAAGCTAGTGACTTTTG
AGACTAACATCACTCTTCCTTTTTCCTCAACCTCATATGCAATTGTTTGTCAAATATTGC
TAATTTTGCATTCTAAATATTTCTAGAATTCATCCCTTTGTCTAGAAATGCCTTAAACAG
CTCAAATCCAAAATATTCTCAGTTTAACCCATTACTCCCTCCTCCTAATCCTGCTCCTTT
TCCCAGGTGTTCTACAGAGACAGAGTATCTCCACTCACTTAGTTCTCAGTCTGCAATTTG
AACATCATCTTTGATTTTTCCCTCCTTTGCCTCCCACATCTTTTTTCTTTCTTTTTCTTT
CTTCCTTTTTTTTTTTTTTTTTGAGAGAGGGAGAGAGACATTTTTGCTACAGGGCACGTG
GGCGTGGGCGCGACAGCGAGAAAGAGACAGAAAGTGAGAAATCGCCCCCCAGGTGGGAAT
GGCCATGCCGCGATCTCTTCTCCAGTCTCCTCTAGGGATCTTCAGTGCACACACACACAC
ACACACACGCACATGCGAGAGCCCTGGTGAGTTTTAAGCTGCATCAACTGCGTGGGAGTC
CAGGGACATAACCATTACGCCATCTGCTGGTCTCTCCTTTACCTCCCTTAACCAAGTAAC
CAACTCCTCTTCAGTCCACCCACTTCTCCGTTTTCATTATTGTTGTCTCACTTTCTTGTG
TGGTATCCTAGTTGATTTCTGGGCCTTTTATCCTCTGACTTCACCGTGCAGCCAGATCTG
ATCACAACAGCAACTAACCACCCCAACTTCCACTTTATAACTCTTTCATTTCTGTTGTTT
AACCCGTAGGCTGCAAAATCTAGGTTAGCGGTCATAAGCCATTTACCTGTCTCGTCCGCA
CCTGGCACACTATACTTGGCACACAACAGATGCCCAAGAAATAAGAACGTGTTCCCTCCC
TCCGTCCATCTCTGATTATAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGAATCCACTAACATGGAAGCCACACTTCCATGGCTGCTTCGAGCC
TATAACTAAGTGACAGGCAGGGCTGTCTGAGAGAGACTCCCAAAGATCTTACCCTGCCAA
CTAAGAGATCCTTACTCATTTTTCTCTCCTTCCTCCACCCCACGTCACACTTGCACTGGG
GTCTGAGGTGCTTCTAGCTCTTTACCAGCTCTCTGTTCAGTTTCTCTTACACAGGCATTT
TCTCTAATAACATCTTTGTGACTAGGAGGGGACAACAAATGAGCCTATCCCCCATTCTTT
TTATACATTAAAAAGAATACATTATCCATCCCTGATACATTATCCATCCCTCGTGTGTGA
AACACTGCCTGGTATTTGTTATTTATTTATTTGAATGTTAATTTTTTTTTTTTTTTCAAT
TTGCCAGAGGATGCCTGTGCTCACCGGAGAGAAGAGGGAGAAAGTACACCTCAGTGGGTC
ATGGCCACACCACAGTCCTCACCATTTCTCCATCCTGTTGGGATTTGGGGCATTCACATA
GACCCATCCCTAGCATGGTTTTCAATCCACCAGTGCTGGGATTTGAACTGCAGTTCACTA
TGTGTGATCTGGTTTCATTAACCACTAGGCCATGGGCCGACCCTGAATACTCAAATCTTT
TAAAACCATGCTCATCATTTTTTTTTTCCTTTCTGTCTTTCTTTCTTTTTTGTCACTGGG
AATGTATACTCCTCACTGGACAGAGAAACAAAAAGTGAAAAATCATCCCCTAAGGGGGAT
GGCCCTTCCACAGTCAATGCCTTGTCTTTCATTCTCTTCCTGGGATTTTGGGCATGCACA
CACATGAACCCAGCATGATTTTCAGATGTCCAAGTCTGGGCCTTGCACCATAGTCTACCA
TGTGGGAGTCCAGCACACCACCTGCTGGCTCTAATAGTCATCATTTTTCAATTGTTAGGA
ATCTAGCTAGAAAAGGCAAACTGTCATTGATGAAAAACTAAAAGAGGTTAATATAAAGAC
AATATGAAATCAATTCTCTATGAATATATAGGTAATATGCATTATAGGAGGGGCAAGTCA
GGAATGGGTGAGTGAGTGGGTCAGGAATTAGAGGACAGCTTCATGGAGGAAGTGGAGCTT
AAGGCAGCTTCAGAAAGATGTTAAGTTTCCAGTAATAATACAGTTGGCCTGCTTAGTCAT
TGTGAGACCTGAGAAATGTTGGCTTGTCTCAGATAAACTCATGGTTGTATACTGATGCTA
ACTATGATTTTTGGAAATGGCTATAATGGGGACAAGTTGATATCAGAATTACTTAAAGAA
GGTTTTCAAATTACAGAAACTACAGATTCTTTTCATTTCTTCCCAACACACTCCCCCAAA
TAGAAGCATGCTAATAATCCAAAGAGGAGAGTGAACAGTAGCAATAGAAGAATAGATTTG
GGAATCTAAACACTTGACACATCCAGACAGAATTATTTTAGAAGAGATTTTTATATAGGC
ATTTATTGAAAGAAATTGCATCATAATAATTATTGAAGAGTTATTTATTGTACAGTATAG
CACATGGGGTCTGTGCTTGGTGATAACATTGTATAACAGAGACTAGGGTTGAATCCAGGG
GCCAGGTACCCTTGAAATAGCAGCAGTCTTTCTGGTTATGAACAATTCATCTACGTTCTA
AAGTATTAAATTGAAGTTATGAAATCTTTTTTTTTTTTTTTTCTTTAGGTTTTTGCCATA
GAGTGCATGTTCTCACCAAAGAAAGAGAGCAGGAAAGTAAGAAACCATCTGTCAGTGGTG
GGGATAGCCATACCACAATCCTTTCTCCTCCATTCTCATCTCAGGATTTTGAACACACAC
TCACATGCGCCCAATGTGATTTTCAAGCCTCTGGGTCCAGGACTAGAACTGTGATCTGCC
ATATGAGGGTCCAGCATCTTAACCTCACACACCACCTGCTGGCCCCATGGAAACATCTGT
TCTTTGTTAGCACATCTTTTTAAGTTCTTGTGCATTTGTTGTTGTTGTTGTTGTTGTTTT
TAAGAGGTTTTTGCCTTTGGGCATGTACACTTGCTAAAGAAAGAGACACGGTGAGAGGGA
AATTGATAAATCACCCTGCATGGGGGTGGCCTTGCTGCAATTCCTTCTCCTCCATTCTCT
TCCCAGGATCTTGGGCACACATGCCCAAGTGTGTTTAAGCCACCAGGTCTGAGACTCGAA
CAGTGTGGCCATCTGGGAGTCAGCAGTGTAACTGCTATGCCATCTGCTGGGTCCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGGATGG
CTCTGTCTGACTGCAAGTGAGGTTAAAGGATGCTTATCTTTTCACCCTTTTATAGATGCG
GGAGATAATGTCAGTCTCTTTAAGTTGTGGGCAAGAAAAAACTAAAAGTTAGGAAAGTTT
AGAAAGCCTCGAGATTTTAATTTTTTCTACATTGGTTGGATTCCCCAGCTAGCATAGTCC
TACGTAGCAAAGTGATAAGGACAGTTGCTAGACCTAAGGAGAATATATTTGAGTTCCTGT
TTCCCACCCGCTTCTAGGAAAAGTCTCGCTCACCTGCTTTCCTAAATGGGCTACTCTAGG
TCGAGAACCAGAAAATGATATCTCCTTCCCGCCTAGGAGCCGAGTTAAAACGTAGAAGAA
ACCAACAATTTACTCGTTTGGCCGAAGAGCTAAGGGCAGAATGGGAAGAATCACAAATTC
AGAAAATACAGAACCTGGAAAAACTATATTTGGCAAGTTTAAGAAACATGGGAGGAGGAC
ATCGCCAAGCCAAAGAAAATGTGAGAGCCAGCTTGTGGGGTTACCTGACTAGGGCAATAA
TATTAGTTAAAAGTAAAATACAGGGGTCAGCAAGTGGCATGGTGGTCGAGGGCACTGGAC
TTTCAAATGACTGACTGCAGTTTGAGTTCCGTACCTGGCAGCTTGCTTTCTCACTTCCCT
CTCTTTCGCTTTCTCGCTCTTTCTGTCCCTCTCTGGTCTAATTAATTGTTGAAAATATTT
AAAATAAATAATTAATAAAATCTAAAATACATTTATTAATAAGATAAATATCATATTTAT
ACAATGTTATTAATGTTAATATTGAATTAATTAATTATTTAATAATATAATTTAATGTTT
ATTAAAAACTTGATGTTTAATATTAAATGTTAAAGAAATAATAAAATTATTTAAATAAAT
AGTTAAATTTAAAAATTATTTTATTTCGCTTTATTTATTTTATTTGACAAGAGATGGACA
GAATGAGAGAGGGAGGGAGAGGGAACTGAGAAAGCATGCTGCCAGGTCTGGGACTTGAAC
CGTAGTTGGCCATGTGGGAGTCCAGCACACCCCTAACCACCACACTACCTGTTGGCCCCA
AATAAAATAACTCTAAAAAGAAAAAAAAAAGAGGACCAGCAGTTAGTGTAATGGCTATGT
CACTGGACTCCCCTGTAGTGAACCGTGGTTCGAGTCCTGGACCCAATGGCTTAAAACTCA
CGCCAGGCGCCTGTGCATGCGTGCCCAAGATCACGAGAGGAGAATAGAGGAGAGGGGATT
GTGTCATGGCCATCCCCCCGGGGGATGATTTCTCGCTTTCTGTCTCTGTCTCTCTTTGTC
TTTCTGGCAAGTGTACACGCCCTATAGCAAAAATCTCTCCCCCAAAAAAGTAAAGAATAG
CTTTTGAATGTTTATCTGGTAAAAATGTTATCATGTATAGAATTTATTTTGGGCAACCTA
CGCTTTTTTAATCAACTTAATATAATTTGTGAGTACTACTAGGTTTCTTTCCCAGGAAGA
GATTTATCTTGCTCTGTGTGTACCATTAACTTCACGCTTTAATGCAGCATCTCCCAAACC
TCAGTCATTAGAGTACCAAAACTGGGCAGTTGGCCCCGTGGGAGCTGACTTCCTATGCAC
AGGGCTTACTTACTGCACTACAGGGCTGACTCTTGGCATTTTAATTTAAACAGGGTATTT
TCTTTTATTAATTTAACCTTATCCTATCATTGATATTTTATTTAAATTTCTCTATAAATC
TGTTAAGTGATTACATTAACCTTAAGTTAAAACGTTTATATTTGTGGGACTGGCAAGTGA
CGTAATAGTTGAGGCACTGAACTCCCATATGGCCAACAGTGGTTCAAGTCCCTGACCCAG
TGGCTTGAAACTCACCGGGCGCATGTGCGTAAAGTATCCAAAATCCCTTGAGAAGAATGA
AGAAGGGATTGTGGTATGGCCATCTCCCTAGGGGTAGGGGATGGTGTCTCACTTTCTATC
TCTCTGTCTCTATTTCCCTGGTGAGCATATGTGCCCTATTGCAAAAATCTCTCTGAAAAA
TAAAAGTTTGTTTGTTTGTTCCCTCTAAGCTGGCTTATGGTACCATATCAGACAATACCA
TTCCTTTGCTTTGGAAAGCACTGCCATATTATGTAGGAAATGGCAAAATTGAAAAGACAC
TTATGTTCTGGTGCCATATAAGATACATTTCTGTTCATTTTGTTTAATATAACATTTTAA
GTAATATATGTTTTTAGGAACCTGATTTGGATGCTCTGGCACAGCGGGCAGCAGAAAGGA
AAAGAAAAGCAGACTTGAGACATAAAGAAGCCCTGAAAGTACAGAAAAGTCAGAAGGAAC
TATTAATGAAACAAAAAACACGGTAAATTAGTGATTTTTATTGTATTCTCAACTGAAACT
GACATGACTAGAAACAGAGGATACATAGGATACAGTGCAGAAGTCAGATAGTTTATCCAT
TACATTTTTGAGACTTGGTTTAAAAACAATGCAGTGGGGAGCTGGTTCGCTTAGGTTAAC
ATAGTAACAAATGAGCTTTCTCTTCTCATTATAGTTTGAACATTCTAAATTTATCAGCAG
TTACAACGTTTTTGAATAAATGTATGGCTGGCTTAGTATGCATGTCAACCAAAATCTGCC
TCTAATGTAAAAAAGAAAAATCAAAATTAAAAGTTTGTGGATTCTGTAGAAGTTAGAACT
GAGTATTTTGGGCATGCTGTAAAAATGAAAGAGTCTGTTCTATGGGACCACCAGGTGGCT
TAGTAGTTATGATGCTGGACATCCACATGGCCAACCATGGTTGGAGTCCCGGACCTGGTG
GTTTGCTTTCTCACTTTTCCTTTCTCTCTCTCTGTCTCTTTCTGGTCAAATTAAAAAACA
AATAATAATAGCAAATAAAATTAAATAAATAATTTTTTTTTAGAAAGAGCCTGTTTTAGT
TAGCAGTGGTCATTTTATGTAGTGGCTAATGTTTAATGTTTGTCAGCATTTTTTCTCTCC
AGACTATTCTAAAGAACATTAGGTGTCTGTTGACTTGGCATCTGCTGTAGAACTTTCTTT
TCTGTCTTAAGATGTACTGCTCTGTCATTTTCTTATATGTCCACTGTGTGTGGACCAGTA
AGTAGCACAGTGAGCCTGGGGGCTCAGCTGGAGGATTCCTAGACATTTCGTGGTTTTTGT
GTTTTCAACTCTGAGATACTACCTGAGAGATTAACTAATAATGTCTTTTGATGTTTAAGG
CATATAAAAGCTCGAAAGGAGGCACTGCTTACAGAAAAGGAACGGTCTGCCAAGATCACA
AGTCTGCCAGCTCCTCCTCCACCTCTTTTTGAGGTAAATTTGATTGTTGAGAAGAAGAAG
TTGTCATCACTCCTTACTATTAACATTCAGTGGAAGTCAAAATAATTCTTATTGGCTTAA
ACTTAATTTTCAACTGTGCAAGTAACACTAGTATATCTGGAGTATTTTCAAGTAGTTCTA
GATACCATTTCATCTTCAGTAAATACTTTAGTATGTATCTCTGATGTGTAAGAATCTTTA
AAAACAAACAAACATGATATTTACATTGTTCTCAATGTCATCTAACACCTAATAAGTGTT
CAGTTTTCCCTAGTGATCTCAAAAAAGTTATTTTTATTTAAAAAGCTGTAATGGGGGCCA
GCTGTTAGGGTGGTGATTAAGGAAATTTAATCCCACATGACCCACTGAACGGTTCAAGTC
CCAGACCCAGCAGCTTGAAGTACACTCTGGATGTGTGGGAATGTATACCCAAACTCCCAA
AAGGAGGAAGAAATGGAGGAGAAAGAATTATGATATGACCATCCCTGTAGGATGTGTCCT
CTTTCTCTCTCTTTGTCTCCAGTGAGTGCATGTGTCCTCTGGTAAATAAAAAATATGTAT
TTTTAGAAAATCTATAATGGTTTTGGTTTTTGAAAAACTAGTAGTAGTTCTGCCCTCTTT
TTTTCCCATGTCTTTTATTTATTGAAAAAATTGGATTATTTTTCTTACAGACTTCTGCAT
TCTGTATTTGGCTCATAATAGTTGCCATTTTGTATGTAAATTAAGGTTCAGATAAGTTAC
TAAATTTGCACAAGGCTATAAAGTAAGCAGAGAGGTCTGTTTCTTTATGGTTTTAAAATG
CGTAGTTTTGAGATTTGGAGCTCATTTTTAAGAAAACAGTGTTTTTGCCACAGGGTGGGT
GTGCTCACTGAAGAGGAGAAAGACATTGAGAGGGAAAGTAAGAAATTAACTCCCAAGGGA
GTTGGCTATGCTGCAGTTTCTTCTCTATTCTCATCCTGGGATTTCAGGCACGTACACACA
CACCCCCCCCAGTATGGTTTTCACGTACACACACACCCCCAGTGTGGTTTTCAAGCCACC
AGGTCCAATATTCAAACAACACTCAGGCCATGTGGGAGTCCAATGCCATAACCACTGTAC
CACCTGCTAGCTCCAAGAAAACATTTTTAATATTTTAACTAAAGTGGAAATTAATTTTAA
GAACTATTGGTTCTCTTACTCATTATATTAGGTTATTGTGGTTACTGAAATGGCTATTAA
GATGATTATCAAAATTACGGAGTAATTTTTTATCTGGAAAGTTAAAACAGAAGTTAAAAA
AAAAAGAGATGTTGGGACCAGCAGTTAGTGCAATGGCTATGTCACTGGACTCCCATGTTG
TCAACCGTGTTCGCGTCCCGGACCTGGCGGCTTAAACTCACGTTGGGCGCGTGTGCATGC
GTGCCCAAGATCCTGAGAGGAGAATGGAGGAGAAGGGATTGCGGCATGGCCATCCCCCCT
GGGGGGTGATTTCTCGCTTTCTGTCTCTCTGTCTTTCTGGCGAGCGCATGTCCCTATCGC
AAAAGCCTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAGACATTTAATTTAGTTGTAAA
TGTATACGAGCATATTTTATGTATACGTGATCAACTTGAGTACCAGTTATTCTACCTGAT
TTCATTTTGTCAGCCTTCCTGCTGCGTGTTGAGCCATCTGCCACGTAGCATTAGTCCAGG
ATTCAGATGAAGAGTCCTATTTCAGCCACTCCCAAAGTACCACGGGAGATGATAAAAAGC
TAGGCAGTGTGCTGGGCTTGCCCAAGTGTACCCAAACCCAAAACCTCCCCAACCTGGCTC
AAGCCCCACCACCACCTGCACTGTCATTACTGGACCCCCGTGATGCCTTTTGATCATCTT
TGTCATAATTCCTAATGTTCATAACAGGCCAAGGGTCGAAAATTTATAAGAATCTAAAAA
TAGTCTACAAATGCTTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
CATCCCTCTAGAGGGTGATCTTTCACTTTCCTGTCTCTTCGGTGAGCGCATGTGCCCTAT
AGCAAAAACCTCTCAGAAAGAGTATGGTGGAATTTATACTTACACTGTGTATGCATGTGA
AAGCTCTTGTGTTCAAAGTTTATAAATCTAAGAGCAATGGGGTCCAGCAGGTGACATGGA
GGTTAAGGCGCCGGATCCCACTTTAGCTGGCTAGGCATTCCTGGACCCGGTGGCTTGCAA
ATCAAGACAGGTGCATGTGCACACATGCCCAAAATCCTGAGGGGAGAGTGGAGAAGGAAC
TGTGGCATGTCCATTCCCCTGGGGGTTGATTTATCTTTCCTTTCTCTCTGTTTCTCTCTG
GCAAGCACATGTGCCCTATACCAAAAACTTAAAATATATTTGTATATATATTATTTTATC
TTTTTGACATTGCATTTAGGTATGGTTTACCAGATGCAAGAGAAAATCAGCTTTTATTTA
TAGTTAACTTATTTTTATTGTATACTTTTTTTTCCCCCCTATTCTTTATCCTTGGCTGTA
CAAACCAATCTTAGGTACCACAGAGTGCTTGGTTTGGCCCATACTGGGTAGGAGACATTA
GTTACTGTGGTGGAAAACCAGGGATAGAAGCCAGAGTGCCTGTTAGGGAGTAGATGGTGT
TTTTTTGTTTTGTTTTAAAGTTTTTACCGTAGGGCTCATGTACTGCCCAGAGCAGATAAG
AGACAGAGAGGGGAAGTGAGAAATCATACATATACACCCCTTTGGGGGGATGGTCACACT
GCACTCCCTTCTCCTCCATTCTCCTCTCAGGATTTTGGGCATACATGCACATGTGCCCAG
TGTGATTGTAAAGCCACTGGGATCAGAACTCAAACCATAAAGGTAGCCATAGGGAATCCA
GCACCTTAACCATCATTCCACCTACTGACCCAAGATAGGGTGACTCAGTCACTCACAGGT
CATCCTAACTCTTCCAGCCTATGGACTGATTTCACTGAAAATGTAAGTGCAGTTCACTGG
AAATCTTTTTATAATCGAAAGAGGTTGGTGGTGATTCTTTTTAATTGCCTGATGATGTGC
GCACCTGCTAGAGAGAGGGCACCTCCTAATGGGGCACAGTCAGGCCGCAATCCTTTTTCC
TCCATTTCTCCACCCCATAAGGATTTGGGGCACACACCCATACTTACCCAGTTGCCCACG
TCAGCTCAGCTCCTAATGTGTAGTGCATAATTGCTGTACTATGTGGCCAGCCCAAGGATT
GGTGATCATTTAAATCTTAAAACTGTGACTTCAGTTTTAAAAGAAATACCAAATTCAATC
TATAAGTAGCCTTTATTTTGGAAGTACAATACTGGTACTTGAAAGTTGTGTATATTTTAA
TTACATTTTTATAGTAAATTACATAATGTGTTTTTTTTTTCTCAGCGTTCTTCCATTCTT
TGTCAAGAAGCTTATTGATGAATTTTTCAAGGTGTTGAGCAAGAGCTACTAAGGTTCTTT
TAGGAAGTGAAAGATTCTTGGAGCCATCAAATGGCATAGTGGTTATGTCACTGGACTCCC
ACATGGCCGACCACAGTTCGAATCCCAAACCCAGTGGCTTGAAACTCATGCTGGGCACAT
GTGCGTGCATGCCCAAGAATCTGGGAGGAGAGTAGAAGAGAAGGGATTGCAGCATAGCCA
CCCCCCTGAGGGGTGTTTTCTCACTTTCGCTCTCCCTGTCTCTGTACTTCAAATGTATGC
TCTATAAGGCAAGCTAAAAAAAGAAAGTGAAAGATTCTTCTTTAATGTGTTTTACCATCT
CTGAATTTTTATTTTGTGACATCTGTTTATTAAAGTGATATGTATTGTGAATTTTAATTA
TAATATTAACCAACTAATGTGTTCATTAGTGGGGAAACTATCCTTTGTAATTTTATTATT
TTTTACTTTTAAAATTTGCTACAAGGCACATGCACTCATTGGAGAGAAAGAGAGAAAGTG
AGAAAGCTCCACCTCAGGGGGTTGACCATGCTACAGTCACTTCTCTATTCTTCTCTTGGG
ATTCACACACGCACAAATGTCTGGTGTGTTAAAAGATTTTTCTTAGGGCCGGCAGGTGGT
ATGGTGGTTGAGGTGACTGGACTCCCACATGACTGACTACGGTTCAAGTCCCGAACCTGG
CAGCTTGCTTTCACACTTTCCCTTTCTCTCTGTCTCTCTCTCTCTGGTCAACTTTAAAAA
TAATAATCAAGTAAAATAATGACAATGAATAAAATTTTTTTTCAAGTTCTTTCTTATACT
TTATTGGGTTCTCACAGTAACTGCCATGACCATCGGATAAGGGTATTACTGTGTACTAAC
TTTTCTTGAGATTGCTGAAGGACAGAGCAGTGAGGGACTCTGCTAAGGTTTCCCAGCTTG
TTTAAGTACGGAAGAGACTCAGCGCAAGAGTTAGCATTTCATCGTGTGTATTCTTCTCAT
CACGGTATATATACAATGCATGCCTTATTTTGTTTTTATCTAACTACTAGTACATAATGT
TATTAGAAATATTACTTGAAGGCAGGGGCCATTAATTTATTTTACTTTTCAGTGTCATTC
ACAATGCCTAGCATAAGGTTTAACATATGCACTGAAGAAGGCACTGAAGAAATTCCTTGT
TTGGTTGCTTTAATTAGATATCACTGCATAATAAATTCTGATGAACTGAATCTGCTTTTA
TGACAAAATGTAGAGAAAGGAAAGGAAAAGTAGTTTATGTCATCCTTTTGAGTATTGTTT
TGTTTTGGAATAAGTATAATTTATTGGCTAATGTTTCAGGACCAAAACTGAATACATCAT
TGAACACTGAAAGGACTAAGACTGGTGTGAGCTGCAGTAGAATTTTTATGATTAGATATG
GAATAGGACATGGTGGTGTATATTGTTTTCCTGTAAGTACAGGGAAGTGCTTATAATTTG
ATTTGACATGTCCTATAAGCGTCTTATAGTCGGTAAGTTGAAAGAGAAGTGTCTTTTTAA
CTAATTTAGAAAGTCTAGTGAGTAAAATACATTGATTAATGACACCTGAAGATGTATCGA
AGTACTAATGAGTCTGTGCTTCTGGTAAACTTTAACTCTGAAAAATTAAGGCTTATTTCT
TTGTGACCAGGATTTTAGTTCATCCTAAATAAAGATAACTGGTTAATATATATGTAATAT
ATATTTTGCATTGGATCCAGCTTTAAATGAAAATTAGTGCATTAATCTAACTACCTATTT
TTTATGTTCCATTATCCAGAACATTGAAGTGAAGAAAATTTCTTCATTGAAAACCAATAG
TTCTACTTACCATCATCTTTACACTTTCGTGAATAGAGAGACAGACACAAAGCAGGTGAT
GAACTTACTGTTTGTTCCTCCCCTACTTTCCTGTTTTTGTGTTCTTCGAATTGAGTTATA
TCTGTTCTACTTCTGCTAACTATCCTATCACACTTTCCCTTTCTCTCTGTCTCTCTCTCT
CTGGTCAACTTTAAAAATAATAATCAAATAAAATAATGACAATGAATAAATTTTTTTTTT
CAAAAATTTTAAATATGCTTTGAATTTTCATGTAAAGTGTATGAATATGAGCCAAAGGTT
GACTACTTAAATGGTAATATCTTAAAGGGCAACAGGTGCATGGTGGTTCAGGGCACTGGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAACATGTATTGTAAACTA
TTAAATTGCATTTTTCAAACGCAACAGCAACATTTAAGAATGGCCATCTTACCATACTCT
TGTGTGCATAGAACATTTTGATTTGAAAATTGTTGCCCTAGGCTAGCAGTGACATGGTGG
TTAAAGCAGCTAGATCCCACCCCATTTGACCAATAGCACGGCTGAGCCCTGGACCCAGCA
GCTTTAAAAACTCAGGAGCGCATGTACATGTGCGCCCAAAATCCCAAGAAGAGAATGCAG
AAAGGATTATGGAGTGGCCTTCCCCACCTAGGGTGCTATCTCACTTTGTCTATTTTTTTC
CAGTGAGTGCACACATCCCATAGCAAAACTACAAGAAAGAAAGAGGGAAAGAGAGAGAAA
GAAATGACTGCCAGTGTTAAGAGTGACAAATGGGAGCTGTTAGGTGGCGGGGTGGTAAAG
GCGCTGGATTCCCCACATGGCTGACCGCAGTTTAAGTCCCAGACCTGGCAGCTTGCTTTC
TTGCCCTCCACCCAATCAAATTAAAATAATAATAACAAATGGAATTAAATAAATACATTT
TTTTAAAAAGTGACAAGTGATGTATTTTTGTTATTATAATCGCTCTAATAAAAAAATTTT
ATTATCTTTTATTTAACTTTATTTATTTTAATTTGACCAGAACGGGAGAAAGCAAGAGAG
AGAAAAAGAGAGGGAAAGTGAGAAAGCAAGCCACCAGGTCCAGGACTTGAACCATAGTCA
GCCATGTGAGAGTCCAGTGCCCTTAACCACCATGTTACCTGCTGGCCCCAATCGCTCTTT
CTTTTTAACAGCAGTTTTAATTCGTTTTCGTGTTGCATATATTAAGCGACTAAGAAAAGA
AACTTTCTCAATATAGCATTCATGTAGAGTCTAACATGCATAAATATACATTTTGGCTAT
CTGCTTAATAGTAGGTATTAAAATTATTATGCATTTAATGATTCATCATAGAATGAACTT
CTGAGGTTTATTTAAAATTATAAAACAATATTATAATTTCGGTATTATAGTACAGGAATA
ATAAATTTCATTCTATTGCTAACTTGCTCTACTGCATTTTTGCAATATTAAATAGTTGCT
TTTCTATTAAGACGAAGAAATATTTTTGCTTATTTCCAGGGTACTGCCTGCCGATGGTGT
TACATTTAGTCATCAAGGTTTTCTTTCTGATAGTAACTAGAAGACCTAGTTATAATACAG
TTTTATAAATGTAGTCCCACAAACTAAAGTTTTTTGTACTAACTGAAAAAGATGCTTTCT
GAATATTTTCAGGAATATATTTATGATTGCATACAGTTTTTGTTCAAATAACTTATTTGC
TGCTTCACTTCATCACTTAGGGAAAATCTGTCCTTAAGCCTTAGATTTAAAATGTGACAG
CAAGGATTAGCTCTATAGCCTAGTTGTTAGAGGAGCTGAGTCCCACATGGCCAGCCATGG
TTTAAATCCTGTCCCTGGTAGCTTGAAAAACATACTAGGTACCTGTGCCCCAAATCTCAA
CAGGATGGAGAAAGGATTGTAGCATAACCATATCTCATTGGGTGGTGCTCACACTCTTTC
TCTGACAAGTACACTCACCCTCTAGCAATTAAAAAAAAAAAAAAAAGATTAAATAATCTC
TGGGGTCAGCTGTTGTGTGGTGGTTGAAATGGCTGGATCCCACATGATTGACTCTATAGT
TTAATTCCCAGACCTGGTGGCTCAGAGTATACCCCAGGCATGTGTGTGTGCATGCCCAAG
GATAAGAATGAGAGGAGAAGGGATTATAGCAAGGCCATCCCCTGGGGCGGGGATTTTCTT
CTTTCCTTTCCTTTCTGTCTCTCCCCAAGCATATGCCCTCTGGCAAAACTTAAAAAAAAA
AGAAAAGAAGAAAGAAAGAAAGCTTTTGTCCAAATATGATGTAGAAGATGCAGAAGTATA
TTTAATATCATGGTTTCTCATTTTGCTCATTTCAAATTATAACTCATGAAGAAAAATTTC
ACAAGCATGTTTTTTAAAGCAAATTTCACATATTTTTCATCTTTTGACTACTAAAATATT
AACAATTATAAATTACATTGACAAAAATCTATAGGGATTGTCTTCCTAAAGCATTTTTGT
AAAACCTTGTTTTGAAGTTTGGTCAGTTACAATAAAATTTGCTTTGAATCCCTAATTTTC
TTTCTTTATTTTCCTCACAAATTTTACATGCTTTATTCTTGAAAACCTCATTTTCTAAAT
GGAATGAAATGTTCTTAAAGGTTATTTTGTTTAATGTCATGTATGTTATTATGTTACAAA
ATTTTACAGAGATTCTCATTTCGATTTAATCTGATCTTTTGTTATGCCTAATGTTACTTG
GATTTCCATAAATATTTATTGACTCAAAGGGGATATGTCTTTTTAGTTAACTTGTTTGGC
CAGTGCACACTTAATATATTACCATCAGTCTCTATACCAGTTTTTCTTACTATCAAAGGA
TTTTTAATAGTTTTACAGATAAAAGTTAATAGCTTGCATACTTGTCATTAGTTATTTCAG
CTCAGTGACAGAATTTCAGCATACAAAGTACATAAAAATTTTTTCACACCTAATTACATT
TATAGTGTTTACTTCTATTTGTAAGTGAACATTTAGATAGTGAGTATAAACCAGGTTATA
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAAATACTATTGATTGAC
TGCTAGCCAGATGCTCATTTAGCTGCTGAAGAAGAAGCTAAAAGATTGGAAGAACTACAA
AAACAGGCAGCACAAGAGAGAATGGAACAGTTTGAAAAGGCACACGCACGAGGTTTCCAA
GCAATGAAAAAGATCCATTTGGCTCAAGTAAGATCGTGAATTCTGATTGTGACCACTACT
GATAGACTTACCCATGAGCTGTAGAACTGCTTAACGAAGGGCTCAAACTGAGGAGAGAAA
GCTGTCAAACATGGTCTCTCAACCATGTGATTTCAAGTTGTCCTGTTTCCTTTGCCTTCT
TGTTTCAAGTTCAGGTTGGGTTGAGCTATTCTTATAGTGTATTGATGTTCTAGCATTCAG
ATTAGATGAGTAATTCTCATCTAAGTCATAAAACTATAGAAAAAAAAAGCAATAATGGTT
AATGGTTAAGGATTTGAGTTCCAGTTTGTTTGCTTATATTTACTTCCATTCCTTGCTGCT
TTGCTGTTTGATCTCGGGCAAGCTACTTAACCTCTCTGAGTTCTGTTTCATCATCCATTT
TATGAGAATTAAATGAGTTTAATAAAACTTACAAAATGTGCATAGAATTTCATAAGCTCA
CAGTATATTTTAGTGGCAGTGGTCATTGTAAATAATTCAAGCAGTATAACATGCCAAGCT
TTCAGTGAGCCAGAATAGTAAACTTTTTCCAGCAACTTTGAAGTTAATGAGATGATTTGA
ATATAGATTAAATGAATCCATTCATAATTTGGTTCTTTTTATAGGGTATTTCAAAAAATG
TTTTAACTTTGCAAAAGAATAAGTAATGTGTCTATGTTATCAAACACATATATGACTCTT
CATCTTCTAGGCTTAGTGTCTTTTATTTAAATAGTGATTCAAAATCACATGATCTCACTC
CTAATGAACGATTTCCTTTTCTCTTTCTGAAACTTTTTGTTACAGACCTTGTTGTGGCCT
GAGACTTTATTTCCTGCCATGTCTGTTCTTAACCACTAGATCGTTGGAAACGTCATGATG
TATGTTTCTATGGAAATGGCGTCATGACTTTCCCAGCAGCCCAGAAGTGTTTCACCTCTA
CCTAGATCTCCAACCTTATCCTTTCTACTTAACCACCCTTGCCCCTGCGTGCCTTCACTA
TAATGAAGTGTACTATTCTCTGAATATGCCTCGCATTCACCACCACATTTTGTGCTGCAG
TTGTTATTGTTTTACTTGTGCTCAATCTCCTTTGCTCACATTTATCTGGGTAAATGCTCA
TCCCAAGGAGTGAGCATTCTTTCCTTATCTTCCCTCCTTATCCTTTCCCACCAAACTTCT
GTTAGGAAACCTCACTAAACTGCTACGCTTAAATTTATTAGACACACTTCTTAAGCTTAA
AAACATACCTGCAGGTCTCCTTTAATCAAGGGCATTCATACAGTAGGAAGTAACGGTATC
CGTTAAGCATAGTCTGGGTCTTGGTGCCTATGTGAGCACTGGAACCAAATACATTTTAGG
AGCCATGGCAGCTTATAGAGGAAGTAAGTTTGTGATTCTTCTCAGAAAAGAGAATTGTAA
CTGGCATACCCTTATGAAACTTGACAACCTAACCATTACTACCCTCTCATTGTGCTTGCT
ACTTGTTTATTGGTTTCATTACTACACTAGGGTGGAGATTGTGTCTCTGGCACTTAATAT
ATGGTCTGGCAGTTGGCAGGTATTTGTTGAATGGATAGATTAACTAATGTCATTTGTGGC
AGGATAAATGGCAGAGAAGGGAAGAGAAGTTTAGACTGTTCATGACTTCCCCTTCTCCTT
CACTGCTTGTGTTATTAGCCTAAGCTCGTGACTCAGGTGTGATGAATTCTTTTTTTTTTT
TTCTTGAAGAATCAAGAGAAACTAATGAAAGAACTGGAACAGCTCCAACAAGAGGACCTG
GCACGTAGGAGACAGACCGTAGCACAGATGCCACCACAACTTGTTGAACTTCCATACAGA
CGCAGTGAAATAAAAGAAGACTGGCAGAGAGAGCTGGAGTTTGCCTTTGAAGACATGTAC
AATGCAGACAGGAGTAAGATATTTTCTGTAGACTTTCAACAGTGCATTTACATGTTTTGT
TTGTAGTGATAAAGCTGTTTTTATTTTGAAGTGAGTTGTCAGTTTGAAGAGGCTCTTATT
TTAGATATTAGAAATTGTGCTGGCCTTTAAAATTTTATGATCCACTTCTTTTTAGTAATT
TCAGAATGGAACAATGTCTTTATATTTCTTTCTAAAGAGGTAAAAGGAAACCTAATTTTA
CACCTTGAACCTGAGCCTTTGCCCGCTGTAATGGATCAAATCCAAGATGATGAACTGGAC
CTTTCAATGGAACAAGAAAACTTGGGTGAAACTGAAAACCTTCAAGTGATGGAAGCTGAA
TTGATATGTCCTGGTGAAAAAGACGGTAAACACCCCTTCTGAGCTGAGTATTAACAATAT
TTCACAGAAAAAAAGGTGCTAATTATTAGCCAACAGTTAGAAAAACTTGATCTAAGTATT
TCTTTAATTGCTAGAAGGCATGTGCTTGCCAGAAAGAGAGAGAGAGGAAGCACTCCGCAT
GGAACACATCCCACTGCAGCTCCCATTGCTCCATTTTTCCATCCCATCAGAATTTTGGGC
ACACAGGCATACACACCTGGCTTGTTTTTCAAGCAACCAACCTGGATTCAGTCAATGGTT
GGCTTGTAGAATCTAGCAGGTTACTTGGCTAGTTAAGCTGCTTGGGAAAGTTATCTGGTT
AGACAACTAGTTAGGCAGGTTTCATGACTAGTTAGCTGCTCATTCTACTAGTTAACCTAT
AAGACTACTAATAAAAGGTAGTAGAAGGCTACTTATCTCATTGGACTACTGGTTATATGG
CTAGATAACTTGTTGGAAAGTTATTTGGGCCAATAGTTAGCCACTTAACCAGTTTTTCAA
CTACTTAGCTGATTAGAGGACTAGTTAAATGTTCACACTGTAGACATTTGTTCAGACTAG
TAGTCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTAGCTAGCTAGTTA
GGTCATTAGCTAACTAGATATCAAACTAACAGACTGTTTGCTGGTTAGCTTAGCAAACTG
GTTATTTATCTAACTATTTATCTGGCTAGGTGGCAACATAGTTAACTAGGTAGTAGATTA
GTTACCTAGTTTTTTAGCTGGCAATGTTGTTATCTACTTGGTCACCTAGTTTGTCAACTA
GTTGGTTGCTAACTAGTCTTTTGCCTAGTAGTTTGACAAGGTAACTAGTAGAAGGAGCAA
CTAGCTAACTAGTCTTCTAACGAGATAAATAGCCACCTGAATGGTCTGCCAAATAGGTAA
CTAGTAGCCAAAGGATTCCTCTAGCTAGTTAACTAGCCTGAAGATTAATCTTCTAACCAG
TTAACTATTTCTCTAACAAATTAACCTGTCATTTAGTGAATAAGCAGCTGGGCTGTTAAG
TAGTCAAATAGTCATTTACCTAGTCATTTAGCTTGTTAACTAGCCAGATTACCTTATTTA
TCTACTTATTTATGTATTTATTATTTTTAATTTGACCAGGAAGAGCAAGAGGGATAGGAT
AGTAAGAAAGCAAGCTGTCTGGTCCTGGATTTGAACTGCAGTAGGCTATGTGGGGGTCTG
GCATCCTGATCACCATGGCACCTGTTGACCCCAACCAGTGTGTTTTTCAACCCTCCAGGG
CCATGATGTGAACTACATGGATGGCCATGTGGAATCCAGCAGCCTTCATCACTAGATCAT
GGAGCCAGCCAGCCCCACATTTATTGTTTAAATTTGGATTGAAATAGTTAATCCTCAGGG
CCAGCAGGTGGCTTAGTGGTTAAGGCACTGGGCTCCCAATGGCTTAGTGCAGTTAGAGTT
CTGGGCCTACAGCTTGAAAATCATGCTGATATGGAACCAGCAGATGGCATAATGGTTACG
TTGCTAGACTCCCATGTAGTTGACTGTGGTTCAAATCCCAGACCCTGTGACTTAAACTCA
GGCCAGGCACATGTGCATGTGTGGCTAAAATCCCGAGAAGAGAATGGAAGAGAAGGGATT
GTGGCGTGGCCATCCCCCCTAGGGGGTGATTTCTCACTTTCTGTCTCTCTGTCTTTACAG
CCAGCCCACATGCCCTATAGCAAAAACCTCTCCCCTCCAGAAAAAAGTCATGCCGGGTCT
ATGTGCGTGTGTGCCCAAAATCCCAAGAGAAGAATAGAAAAGAAGGAATTGCAGTGTGGT
CACTCCTCCCTGGGGGTGATTTCTCATTTTTCCTCTCACTGTCTCTTTTAGTCTCTTTCC
AGCAAGTACATGTGCCCTATGACAAAGACCTTAAGCAAAAAAGAAATAGTTATTCCTGGT
TAAAAAGTTATCATTGCAGTCAAATGGTATTGTTAAATCATAAATGCTGAGGAAAATAAG
TTGTGCTTTTGTTTTAACAAGTGGTGACCGCGGTAACTACATATTTGCTTGGTATATAAT
GGGTACTATTCAAGTTGTTGGGTTTTTTTTTCCTTTTAGTTCCTGTGGTAATGAAGACAC
AACAGGTCCCTTCAAAAATTCTTTTTAAAAAATTATTAAATAAGATCCGAAGCCAAAAAT
CTCTCTGGACAATTAAATCCATGTCTGAGGATGAAAGTGAAGTGACTACGACTATTAATG
AAATTGAGAGTAAAGCACCAACAATTGACTCAGGGACCATTGCCAGCGAAGACAGAACAT
TATCATCTGGGCAGGAACATGGTAGTTTTCCAGTAGTATATCATTTTATGGCACATAATT
ACTTTTTATGTTATTTTAAAATGTATTCATACTTGAAAAAAGTCTAAGAGGCAACAAATG
TTAAAAACTTGAGCAATCTCCTAGACTGCATTCAGTATAATATTATGGCTTATATATATA
TTGGGTCCCTGGAAAAGTAATGATGCATTTTTACATAGAAAAATATGTCATTACTTTTCT
GACAGCCCAATTATTTATATTATTTCCCGTGTAATTAATAAGTCAAAATGAACCAGTTCT
CTATTGAAAAATTAGACTATTTCTAGATTTTTTAATTTCTTGGGCTGAAGTGGGAATCCT
GTTAGTGACATCTTTGCCAACAGCTTTAACTATTTCCTTAGGAAGAAATGTTGATAAAAT
CCCTGAATCAAAAGATATAGAAATGTTAAGGGTTGGGGCCAACAGTTGGTATAATGGCTA
TGTCATTGGACTCCCATATAGCTAACCATGGTTTGAGTCCCAGAATCGGTGGCTTAAAGT
CATGCTGGGCGCGTGTACATGTGTGCCTAAAAGGAGAAGGCATTGCAGCGTGGCCATCCC
CCGGGGGTGGTGGTGGTGGTGATTTTTCACTTTCTGTCTTTCGGTCTCTCTCTGACTTTC
TGGTGAGTGCACGTGCCCTATAGCAAAAACTTCTCAAAAAAAAAAAAGTTAAGGGCAAAC
AGTTTATTGTATTAGTGTTTCTTTTGCCTTCTCATCAAATATTTGATTTATTTGTGACTT
TTATTTTTTGATCATTAAGTACAGTATATACTTGCTAAGTATGAGCCAGTTGGTGGTATG
ATAGTTAGGCTCTGTATCTATATGGCCAAATCTGCTGTTCGAGGCCCAGACCCAGTGGCT
TGAAAAACACTCTGGGTGTGTGTACGTGCATGCTCAAAATCCTGAGGATAGAACAGGGGA
GAAGGGATTGTGATGTGGCCATTCCCGCTGGGGATGACCTCTCACTTCCCTTCTCTGTCT
GGCTCTCTGTGGCAAGTACATGCACCCTGTGGCAAAAATGTAAAAAACAAAAAACAACCT
CTTAAATGTATTTTCAGGGACTAGCAGTTGGTGTAATGGCTATGTTGCTGGACTCCCATG
TAGTAGACTGTAGTTCGAGTCCTGGACCTGGTGGCTTAAACTCATGCCGGGCATGTGTAC
CCAAGATCCTGAGGGGAGAATGGAGAAGGGATTGCAGTATGGCCATTCCCCATGGGGCGA
TTTCTCGCTTTGTGTTTCCTTCTCTGTCTCTCTCTTTCTGGCAAGTGCACGCGCCCTATA
GCAAAAGCCTCTCAAAAAAAAAAAAAAGGGAATGTTTTTTTCAGAACTTACAAAGACCAG
GGCCTACAGGAGTCGTGATGGTTAAGGTCACTAGATTCCCACATGGCCAACCACAGTTTG
AGTCCCAGACCTGGTGGCTTGCTTTCTTACTTTCCCTTTCTCTCTCTCTCTGGTCAAATT
TTAAAATAATGACAACAAATGGGATTAAGTAAATAAATAAATAAGTTCTTTTTAAAAAGT
TTAAAAGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGTCGACTGCAGTCC
GTGTCCTGGACCCGGTGGCTTAAAACTCACACCAAGGCACGTGTGCGTGCGTGCGTGCGT
GCCCAAGATCCCAAGAGGAGAACAGAGGAGAAGGGATTGCAGTGTGGCCATCCCCCCTGG
GGGGTGATTTCTCGCTTTCTGTCTCTCTGTCTCTATCTAGTGAGCACACGCACCCTATAG
CAAAAAAGAAAAAAAAAATCTCCAAAAAAGAAATTCTAAATTACTAAAACTAATTTTTGT
TTTGGGGATTCTCTTAGAAATAAATGAGCCTCTCCCTGTCACAGCTGTAGCTCAGAGTTC
AGTTCTACTTCATCCGCAAGAAGAAGCAGCCAGAATTAGAATGTCAGCAAGGCAGAAACA
GGTAATTTAAACTTTTATTTTTAAGGGTTCCTTTCTCTAGGTACCATAATTTTCTTCGAC
CTTTAAAGTTAGTCTTCTGCCTCGTCTTACAGAAACATTCAACTGCTGGAAACCATTTTG
TCTTTGCTTATACTGCTCATTTGACCCTTAATGTATCTACTTTATGTTTTATACTTTTGT
GTATATTTTATCTTCCCTATGAAACTTGTGGGTATTTTTTTAAGTATTTTTTTTAACTTT
ATTTATTTACTCATATATTTTTTAATTTGACCAGAAAGACCCACATACACACACACAGAA
AGTGAGAAAGCAAGCCACCAGTTCTAGGACTTGAACCATGGTCAGCCATGTGGAGAGTGT
CTAATGCCCTAACCACCATACCACCTGCTGGTCCCAAAATTTGTAGGTATTTTTAAAGGC
AAAGACTGTCTTCTCTAAAAAACTTAATTTATCCTGATACAATGCTTTGTATATTTAAGT
CCTCAAGAAATATTTGTCGAAACTTACAAAAGCTTGATAATTAGACACTGAGGTGGGCTT
TGCACTCCCGAAAGTTTTTCAGAAAATAGTATTTCAGGAGAAACAATAAATTCAACTTTT
TAAACTATAACTTTGGTCTTATCTACTCCTAATAAAAGATTTTTATGACACAAATTACCT
TATAGGGGGTAAGACTATGAAGCTGGTCAGGTCCTATTCGTTGTGTTTTTTAGAAATTCA
GTTGGGAAAAGAGCATTTGCTCTTTACAAGAAAAGAGTATTTCTTGTCAAATAAATGTTT
CCCAATTGGTATTTTCGGACAGTATTTTCCAGGAGGATTTTCTATGATGATGGAAATGCT
TCACATTTATGCCCATTATGGCAGCCATTAGCCACATGGACTGTTGATTACTGTAAATGT
GGCTAGTGTGACTGAGGGAGTGAACTGTAAATTTTATTTAATTTGGGGACCAGCAAATGA
TGTAATGGATACATTGCTGGACTCCCACATAGTCAACTGCGGTTCGAGTCCCAGAGCCAG
AGCCAGTGGCTTAAAATTTCTGCTTTCTATCTCTCTGGTGAGTGCACGTACCCTATAGCC
AAAAAAATCTCACTTAAAATTTTTTATTTAATTAGAATTAGTTTAAATAGTCATATGTAG
CTAATGACTAATATATTGATAATACACTTGTAGAGGTGCTATGAAACTCTTCAACTCGGT
GGTTTCTATGACAGGAAAATTAAGGAAGATGAAGACAGAACTCAGCTGTAGCCACTGTTG
TCTCATTAGGAATCAAGACAATTTTTACATTATTTATTGACTTATCCTCTATTTTAATGG
TCAGAGGGCATGTGCACTCACCAGTAAGAAACAGAGGGTCATGCTGCAATCCCTTCTCCA
TTTCTTCATCCTGTTGGGATTGTGGGCACACGCACATATACCCAGTGTGTTTTTCAAGCT
GCCAGATCAGGGATTCTAACCATGGTCAGCCACATGGGATCCAGCTCATTAAACCACTAG
GCTATGGGGCTGGTCCAGTAATAGATATTTATATTTTCCTTTAGTAATTTTTATTTGGGA
AATGAGATCTTTCTTCATTTTCTCTAGTAAAAGTGCTCTTTTTTATGAAACTTCACATGC
CCGCCCTTTTCTGCTTAACCAGTGTTTGACCTATGTAGTAGGTACTGGATTTAGCAGGCG
GACAGACTAGTCTTTGTCCTCAGTAGAGTAACTCAGGTGTATGTTTGGATTACTTGGAGT
GTATGTGCATTTGTATAATATTCGGGTTTTCATGTCATCCTCTGCTGTTTTCTTCCCTTC
TGTTTTATGTCTGATAGAAAAGGCACAGATGTTTTTATTATACTATCACTTGTCTTCTGA
TAACTACGTGTCTTAGTGGTTATGCCTAAGAAATCAAATGTATTGGGAGGCCCTAATATT
TCATTTCTTTAGTCATTATTTATTCTAAAAACAGTGTAAAATTAAATATGTGAACATAAA
ATTTGGCAGCGTCTGCAGGTGGTATGGTGGTTAAGGTGCTGGATTCCCACATGGCCATCT
GTGGTTTGAATCCCAGACCTGGCAGCTTACTTTCTCATTTTCCCTCCCTCTCTCTCTAAT
GAGTGTGTGTACTCTGTAAAAAAGAGTTTAAATTAATAATAAATAAATAAAATTCAATAT
AATAATTTTTTTAAAAAAATTGGCCACATATCATTTGCTGTTTTTCTGGAGGTGGTTCTT
CAGTGGTGATCAGGATTTCTCTGGACTGAAAAAAAAAAAAAGGAATAGTTAATAGGTTTA
TGCTTTCTTTCCCTTCCCTTCTGTCTCTTTTTACTTCTCTTTTTCCATCTCTCACTCCCA
CCCTCCCTCTAGCAATGGCAAAAGTAGCTAAAATCATCACCACTTACTTCTGGGCTAATT
GGTACTCTTGGTATCTTTGTAATGTAATGCATGTAACCTTTATTTTATATGAGCTTGTCA
TTAATAGATCAATAGTATTTTTGTTTCTTAGATAATGGAAATAGAAGAGCAGAAGCAAAA
GCAGTTGGAATTACTTGAACAAATTGAACAACAGAAGTTAAGATTAGAAACCCACTGCTT
CAGGGCTCAGCTGGAAGAAAAAAGAAAAACCACTCAACAGCAGACTGAGGTAGGGTACGG
AAACTCGCTCCTGCACACATCTGAACTTTCCGCTAGCTGTGTGGCTTTCAACTCCCTGCT
TCTGCAGGATGCAGTTTGACCACGATTTGTGTATAATGCACAAATTGAGCTTTTGGACTT
GGCTCCAAAGGAGAATGGTTGTTTACTCATTTCTTACTAATAGAAGTGACTACCTTTTTA
TAAAATATATACAGCTATATGGGAGTTTGCAATCATAGAACTTGTTTCCATTAAATACTT
CAGTTCTTGTTTCTGAGTTTCCTTTTAATTCATAGCTTTGTTGTTTATTAGGTTGGCACT
GCTCCAACATCACGCACTCTGGTTTCTGATGAAGACAGTCATCGACAGATGATTCGTAAC
TATCAGCATCAGCTTTTACAACAAAACAGGTATTAGCTAGGGCGTAGTTTATCTGCGATA
GTGTGTAGTTACATCTTCAGAATTTGTTGTTTCATTTGTATGAGGACTTAATTGGGATTC
TCTTAGAACTGTGGCGTATAAATTTCCCCAAGGACAGTGTAAGTGTTTTTCCTCTTCCAC
ATAATTGTGGCCAGTCTTAGATGTTGGATTTAATATATGGACACTTGAAAATGTAGGACA
TTTTTCTTTTTATTGTTTTAGGGGCTAGCAGATGGCATAGTAGTTATGTTGCCATGGCTG
ACCATGGTTTGAGTCCTGAACCCAGTGGCTTCAAAATAATGCCAGGCATATGTGCATGCA
TGCCTAAGATCCCAAGAGGAGAATGGAGGAGAAGGGACAGTGGCCTAGCCATCCCCTCTG
GGGGAGTGGTTTCTCACTTTATCTCTTATTCTTTGTGTCTCTCTCTCTTTCTCTGGCGAG
TACACATGCCCTAAGATCAAAATATCGCTCTCAAAAAAAAAGAGTAATTTTGAAAATGTA
TATGTGTCTGTTTACTGTTTTTTGTTTTTTGTTTTTTTTTATGTGTATGTGTTTCTTTTT
TGGTAGGTTACACAGGCAGTCTGTTGAAACAGCCAGGAAACGATTACTTGAATATCAAAC
TATGTTAAAAGGAAGGTATCCATCCACATCAGCTGCATCACTGATACCTGATTCTGTGAC
ATCAGTACAACCACATAAATCTGAAAGACCTACTTCTGTGTCAGAGCATTGGGATCAAGA
TAAGAGAGCCAAGTTGAGTCCTAACAAATATCTATCCCTAGAGATCTCCAAAGTAGAACA
AGATCATTTTCAGCTACCAGGACAAAGTCACTTTCCACAAAGACAGGTAGAAATGACAGA
AACATTGAGTACTTCGGATGTGTTCACCAGACCGTCTTTGGAATTGGAAGAACATCTAAG
ACAATTTTCACAGACTGAAACACAACAGAGAGACTATAAATTAATCCCTAAAGAGTCTCT
TAAGACTTTGTCACATGATATGCTACCAAGATTACAGGATGCTGAAAAAATACCTGAAAC
ATTTCAGGCAGCATCTTTTCAAGCCTTCGACTCCAAGCAAATATTCTCAGAGAGCAGTGA
AAATATATCTTCAAACCTAACCGAACCTTCTTCATTCTTACCTCTGGTACCTGAGCATTC
CTTTAGTTCTTTGCCTATTAAGGTTGAATCTGGAAAAATCCAGGAACCTTTTTCATCTGC
AAGCAAAAGTACTATTTTTGCAAGCCATTCAGTAATTAGCCAAATGTCTGATAGGCCTTT
GCCATCCTCAAGGAATGTCACAGCCCAGCAAGGTCATTTGAAGGCTCTCCAAGAACAGTT
AGACCTACAGAAGGAAGTTCTTCAGGCAAAACAGGAAGCTCAGGAACGATTGCTTTTGTA
CAAACAAAAGGAATTGGAAGAGCAAACTGACCTCTCTGTACCCCTTCCATCAGTAGCCAC
AGGTTCATTTGCTACCCTGCCTTCTGCCAAAACTGACTTAGGGAGAATCCGGGAGTCTTC
TCCCACCAAGAATGTCACTACAGTTTCCTCAGGCCAACCTGTGGTCTCACGGCTTCAGGA
TAGGCTTCTAAGTTTTTCTCAACCTATCTTATTGCAGCAAAATAGCTTTGAAGTTCTCCA
AGAACAGTTGAATATTCAGAGAGATAGTCTTCAGGCAAGGCGAGAAGCCCAGGCGGTATT
GTGTGTAGATGCACAGGGTGAATTGGATGGAAGAGCTTATTCTGAACAGGCTGAGCCCTC
TTCTCTCCCATTTCAGGTAGCTCAGCATACTTTGACTTCACTACCTTCTGCTGATCCAAG
ATCCAGAGAAACCCAGAAGCAGTATTTGTCAAAGAGTGAGGAAGGGCTTCTCTCAAGCCA
GTCTGAAATCCCAGAATCTCAAGATGGATCTCTGAGTTTTCTGGAGCAGTTCCTACCTCT
ACGTGATAGTCCGAAGCTTCTCCAAGAACAGCTGATTGCACAGAGAGATACTCTTCAGGC
CAGGCATGAAGCTCAGGTGGCATCACTTTTATATAGACAAAGGGATTTGAGGGACATTAA
GTCTGAGCACACAGGTTCTTCATTCTTACCAGTGCGTGTTCAGCATTCAGTTGCTTCACA
AGCTTCTGCTAAAGCTGAACCTAGGGAGGTTCAAAAATTTTATTTCTCTGAGAAGGAAAG
TCTAATTCCCTCTGGTCATTTGATAATCCCCACTCAGCAAAATTTGATGGCACTGCAAGA
ACAGTGCCACATGCAGAGGTCAATGCTTGCTGCTAAACAAGCAGCTCAGGAACTTGTACT
CAAACAAAGTGACTTGGAAAAGGGTGTTTCTTCCGAACAGACTGGCATCTCTTCATCCCT
GTCAGAAGAAGCTGAATCTGAAAGATTCCAGGAATTTATGTCAACCAAAAGTGACAGTAC
AACTCATTTAAGCCATTCTAAGATTCCAAGATTTCGAGAAAGACTTTTGAGATTTTCGCA
GCATATGCTACCACTGCAAAGTAATTTGGAGAAATACCAAGAATGGCCATTCAAAGAGAA
ATCCCAAGAAGATGCATCCTCTGAACAAACTACCTTGTCTTCATTTATTCCTCAGTTAGG
ACAGCATTCATTTACCTTACTACCTTCTGTTGACTCTGGTACAACCCCGGAACCTCATTT
AACAGAGAGTGATAGTCAAGTTCCTTCAAGCCATTTACAGATCCCGGAATTGCAGGATAG
ACTTTTGAAGATATCGCAACTTATCCAGCCTCGACAAGTTAATTTGAAGGCACTTCAGGA
ACAGTTAGCTACAGAGAGGAGAGCCATCATTCAGTCCAGACCAGAAACCCAGGGAGAATT
GCTTTTACATGAACAGAGTGAGTGGAAGGGAAGAATTTCTCCTGAGCATCTGGGTACCCC
TCCCTTAGCCGTGGTAGCACAGCATTCATTTGCTTCGTTCCCTTTCACAGAATCGGAAAG
AAGCCAAGACCCTTGTCCAACTAACAGTGATGATACAGTCTCCTCAAGTCCTTCCGAGAT
ACCAAGTTTGCCTGACAGGCTGTTGGGTTTATCATATTCTCTTCTACCGCAACAGGATAA
TTTTATTGCATTCCAAGAACACTTGAATGCACAGTCAGATTCCCTTCCTTTCACTGAGAA
AACCCAGAAAGAATTGGTCATGCCCATAACATGTAAATCTGATGAAAAGATACCTTCCAA
GCATTTTATTCAGCCTCACCATGGTGATTTGAAGGCACTTCAGCAGCAGTTAGATATACA
GAGGAAAGCCATTCGATCTAAACAGGAGGTCCAAGAAGAGCTGCTTTTGCAAAGATTAAG
TCAGTTGGAGAAAAGGGTGTCCTCTGAGCAGATGGGCCCCTTTTCAGGCTTATTCCAGGT
AGGCCTGCCTGTTGCTGACTCTGAAAGGAGCCAACAGTCCATCCCAACCCAAAGTAACGA
CACTGTTCCCTCAAGTCATCCTGAGGCCTCCAGATCACAAGATAGGCTTTTGAGTTTATC
CCAGCCTGCTGTGCCTCAGCGAGATAATTCGACAGCACAGTTGGACTTAGAACAGGAAGT
GATGTATTCTAATGAGAAATCCCAGGAAGAACTGCTGCTCAGCAGGCAGAGTAAGATGAA
CAAAAGTGAATCCACTGAGCATGCTGTCCCCACTTCATTTCTTCCCAAAGAAGCAGAGCA
TTCATTTATTCCACTGCCTTTTGCTAAAGCTCAGTCTAAAAATGTTCATGGATTTCATTC
ATCTGAAAGTGAACATGTAGCTCTCTCGAGTGGTTCTTTGATCCCAAGATTTCAAGATAG
ACTTTTGAGTTTTTCACAGCCTGTCTTAGCTCAGCAAGGTAACTTGGGACTTCAGAAGCA
GTTGGATCTACAGAGAGAGGTTCTGTATCACAGTCAGAAAGCCCAAGAAGAACTGCGTGC
ACAGAGACAGATAGCATTGCATCAGCAGGTACAGAGACATCAGGACACGCTGAAGGATTT
CTTTAAAGACAGTCAGGTATGTTTTGAATTTGACAATGTAAGAATTAAAAATTATAGGTT
TAAACCTAATGCAGTTTGGGGGCCAGCAGATGGTGTGATGGTTATTCACTGTAGTCAACT
GTGGTTCAAGTCCCAGACCTGGTGGCTTAAAACTCACGCTGTGTGTGTGTGCATGTGTGT
CCAAAATCCCAAGAGGAGAATGGAGAAGGGACTGCAGTGTGGTCATCCTCTGGGAAGGGT
CGTAGGGTAGTGATTTCTCACTTTCTGTCTCTAGCGAGCATACATGCCCTATAGCAAACA
TCTTACTTTATAAAAAAAAATACAATTTTAATCCTAGGTCTATAGCTTTTTAGTTATTGT
GTGTAAGTGAATTTACCTTAACTGTGTATTTATTTTCTATCCTAAACAAAGTTGAAATTA
AAACAAAAGTTAATGTACCTACCATGATGTTTAATAGGTTGATATTAATTTGAAACCCAG
CTAATTTAAAATGCAAACGCTAGAAAAGAATGTGGATTCTTACTTAGAGTGTTGTTAAGA
TGAGGGTTTTTTTTGTTGTTGTTGTTGTTTTGCTATAGGACATTTTACTCGCTGGAGAAA
GAGAAGGGGAAAGTGAGAATTCACCCGTGCCCCTAGAGCAATGGCTACACTGCCATCCCT
TTTCCTCCATTCTCCTCTCAGGATTTTGGGCACGTACACACTTGCAGTGGGTGTACTTTT
CAAGCTACCTAGTTCAGGACTTGAACAGTGTAATCTCTCATATGAGATCTAGCACTTTAA
TCTTAATTTAATTTAATTTAATTTAAGCTTACCATAAGATTAAAATTGTAAAATTAAGTG
GTTAGCAAAAATTTTCATACAGTAACAGACTTATATTCTTTATGTATAAACGTTGTTGAC
ATTCGTATGTAAATCAAAATTAGCACCATCTTTTACCTTAAGTGGCTTTGTTATTACCTG
TGGTAACCACCAACCTATTGTAGGCTGAGGGAGAGCTCAGCTTGCAGCCGGGTCTGACCT
GTGGTGCAGACTCAGGCACAGTCGCTCCAACACTCAGTATCTCTGAAGAGGAGATGCGAG
TGTGTATCCTAAATATTATGTATCTATTTTATTTTAGAGGGTCACTTTCTGAACTTACTA
TTTAGCCTAGCCAGAATTCTACAAATCTGTTGATTTTCAGAATAAGCTACAGGTGAGTTC
AGGAGAGGTTGCGTTCTAGGGACTTACCGGTCATTTGAAGGAAAAGTAACCAAAAAGGAA
AAACAGAGGGGACACTTAAGTGCAATCTCTGAAAGGCAAATGGAGGCTCGGTTTTAGGTT
CAGGCTATGCATGGTCATACTTTTCAATGGGAATATTACCCTTCAGTATTGAAAATGTAT
CTCATTCTTTAATCTGTGGGTGAAATCGTAAATTGTGATTGACGAAACGATTTATTCGGT
TAGAGTTCTAATTTAAGAAGGGAGATATAAATTGAATGAAGAATTCTTCACAAGATTTTT
CAACTTGAGTCATTTCTATCCTGTCCACTTGTTCAGACAAGTAAGCTCACAGTTGAAAAT
GATTTAAAAGCTCAACAGCGGCAGCCCCAGCAGCTCAGAGAGTGGCTTCCTCATATCCGA
GACTTGGCAAGAGACAATCAGGAAAGCAGTCATGCAGGCAGGAGCAACTCTGGTGGTAAT
CAGCTGCTTTGGGAAGATACAAGTACCAAGCAAAGCGGTAAGATAATTGCATCTTATTGT
GTTATTCTATGGCTACTCTCTATTCTCATCCCCTGCATCTTGATGGCTGGGGAAAAGTTT
GTAGCATGTGAGTAGATTTTTATTGTGTCTAACTTCGTCATTGACCTGGTAGGTGAACAC
CTGGAAAAAGAACTGGGCAGACGATCCTCAAAGCCACCTGTAGCAAAAGTTAAAGGTGTA
ATGGACCTAAACCAACATGAACTTAGTGCTATACAGGAAGTAGAATCACCAGCAAGTGGC
AGAACTTCTGTACTAGGTAAACAGATGTCCTGATAAAATAAGGTTCTTTTATTTTTTTTT
TTTTTTTGGCTAAAGGGCGTGTATTCATCAAAGAGAGTATCCCACATGGAGAATGACCAC
ACCACAATTCTTTCTCCTCCATATTTCAAACTCTCTTTTTTCTTTTTCTTTTTTTTTTTT
TTCAAGGTTTTTGCCATAGGGCACATGCACTTGCCAGAGAGACAGACAGACAGACAGACA
GTGAGAAATCACCCCCTAAGCAGGATGGCTATGCCGCATCCCTCGTCCTACACTCTCTTC
CTGGGATTTTGGGCATGCATGTACATGCACCTGGTGTGATTTTCAAGCTGCCAGGTCTGG
GATTCAAACCAAGATCTCTCATATGGTAGTCCAGTGCCTTAAACACTGTGCCGCTGCTGG
TCCCCAATCTCTCTCTCTCTTTTTGAGCTTTTGGGCACTCATGCACAGACACCCAGAATA
TTTATCAGGACACTAGGTTCACAACTTGAACTGCATAGTTGACCACATGAGAACTGTATG
CCTTAATAGCCAGGCCATAGAGTTGACCTTATAAAATAAGATTTTTTAAATAGTCTTCTA
GTTTCCTAGCTTTTTTTTCAGGATGTTAATATTTTTGTTTTGTTTTATTTTCTTAATGAA
ATGTAAGCTGTGAATACTTGTGAAAGGAATAAAAACTAGCTTATGTATGTAGTATTTAAA
ATTCGTGGGCCAGCAGGCAGCATGGAGGCTAAGGTGCCAGATTCCACATGGCTTACTGCG
TGGTTCAAGACCTATACCTGGCAACCTGAAAATCATGCTAGGTGCATGAGTGTGCATGCC
CAAAATCTTGATAAGAGAATGTAGGAGAAGAGATTATGGCATGGCCATCCCCCCTGGAGG
GTCATTTCTCACTTTCCCTCTCTCTATCTGGCAAGTAAGTGCATGCACCCTATGGCAAAT
AAATAAGTAAATAAATTTTGACACTTGATCCCTCTGCTTCCTTTCATGTCTGCCTTCTAA
ATCTGTTTCTTTAATATGTAATTCAAGTTTTGTTTTTTTTTTTTTGCCACTTTTCTATTT
TAGTGCTTTCATTGCTCTATTCCTGTTTATAGGCAATTATGTGTAAAATCAGGCTTCAAG
GACTGCTCGTAAAACAGATGTATCTCTTTCCTGTACTTCTTTCTACATCCAATTATCTGG
AAAATTCTTCCCTGTGATCTTTAGTAAATAGTCCAGATTTCTCTGTCCATCAACATTCTC
CCAGAGGTAAGTAGGAATATCACTACAAACTTAGTAAAATTGAAGTAAAGGCAAGGCCTG
GCTGGTGAAAATAAGCAGTAACTGACCCAGCCGGTGGCATGGTGGTCAAGACAGCTAGAT
CCCACGTGGCCAGCTGTGCAGTTCAAGTCCCAGATCTGTTGGCTTGAAAAATACAACAAG
CACATGTGCATGCATGCCCAAAATCCCAAGAAGAGAATGGAAGGGGAAGGATTGTGGTCT
GGTAATTCCCCCAAGTTGCTTTCTCTATCTCTTCAGTGAGCGCACACACCTTATAGCAAA
TTATGAAAGAAAAATAATTCATTACTATTTTCTTGCTACCTATATCAGGTGTTTAGATTT
TTACCCATAATATAAGTAGCCGTTTTAGTGTTGACTAGCTGTAAAGGTTCAGTGGAAATC
TAATGAGTCTGTTTTCTTTTTGCTTCCCAGGTAAACCAGATTTTTACCAAGACAGAGACC
CTATGAGGGTCTCAGTAAGCCGAGAACACAGTTTCCCTGGGAGTCCACTGACCTGTGAGC
CATCAGGATGTCTTCAATCACTTGCCGAGAACATCCGTGGTGATGACTATGGTGACGAGG
CAGGTGAGAGAGAAACTAATTGAGAGTAGAATTGTGCACGGGTATAGGTGGACAGAAGCT
ATTGTAGAATTATTTGTAATAGTGTAAAGTGGTAAATAACCTCCATGACTGGATGATCAA
GTCATTAACATACAGCTGCACTGTGGTGTTCTCTGTCACTGTTGCAGGAAGTGAGGTGGA
GCAATCTGTTCATGCACAGTTGTCTGGAGTGATGATCACCAAAGTGTTGGTACAGGTTAT
CTTTGTTAGAGACTGGATTTCAGCATCTCTATGTCATACACTCATATATTGTAGGGTTTT
GTTTGTTTTTATAGAGGCACATATTATTTCTGTCAGATAAGTGATGAGAAAGTGAGTTAT
TAGAAATAATTTACTTTAGTTTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAACTGCAGTCCTTTCTCCTCCATTCTCCTCTCAGGACTCTGGGCACACACATCAT
ACATGTACCCAGTGTGAGTTTCCAGTGACTGGGACTCAAACCGTGGTCGGGTACATGGGA
ATCCAGTGAAATAACCCTTATGCCATCTGCTGGTCCCATGAGGGTATGAGCTTTTTACAG
TTGGCAGCCACTGTAAGTTTTGTAACAGTCTACATTTTTAATTACATGCTATTGAATTTT
AAATATTATTTTGCAGGACCAACAGTTAGCATAATGGTTGTGTGGCTGAACTCCCATGTA
GTCAGCCAGGGTTCGAGTCCCGGACCCAGTGGCTTAAACTCATGCCGGATGCGTGTGCGT
GCGTGTCCAAGATCTCAAGAGGAGAATGGAGGCGAAGGGGTTGTGGTGTGGCCATCTCCT
CTGGAGGGTGATTTCTTGTTTTCTGTCTTTCTCTGTCTTTCTGGCAAGTGCATGCGCCCT
ATAGTAAATACCTCTCAAAAAAAAATTATTATTTTGAAAAAGTTCTTTAAGTGGGTCAGC
AGGTGGCATGGAGGTTAAGGCACTGGGTCCCAGATGGCTGACTGCCCGATTCGTGTCCTA
GACTCAGCAGCTTGGAAATCATGCCAGGTGCATGTGCATTTGTGCTGAGAGGAGAACAGA
AGAGAAGGATTACAGTGTGGCCATCCCCCCAGGGACTGGTTTCTCATTTTCACCCCCTCT
GTCCTCTCTGGGAGCACTTGTGCCCCATTGCTAAAACTAAAAAATTCTGTCAGTGGCATT
CTAAATGAGGTGCTTTATGCTTATCTGTAAATACTTGGAGGCCAGCCTGTGGCATAGTGG
TTAAGGTGGCTGGATCCCACGTGGCTAACTTTGCAGTTTGAGACCCAGACCTAAGCTTGT
GTGTGTGCACCCAAAATCCCAAGGAGAGAATGGATATAAGATCATAAATTATGATTGAAT
ATTCTTGTTTCCACTTAAAATAATGACAAAAGCATTTCCCATCACATTGGCTCTTTTCTA
ACTTTAAAACCTAATAAAATATTTTCCCCAAAACATTGTATTTATAAAATAAGAATGACA
TCTGTAATTTCCCAAATAAAAAATTTTTTATGCTGACTAGCGAATGTTTTTTAACAAATA
ATGAAATGAATCTTTCTTTGGGTCTGGATAAGCTAACTCTAAAATGCAAAATATAAAAGT
AAATTGTGGCCCGCAGGTGGTGTACAGGTTAAGGTGCTGGATCCCACATGGTCAGCTTTT
CAGTTTGAGTCCTGGATGTGGCGATTTGAAAATTACACCAGGCATATGTGCACGTATAAC
CAAAATCCTGAGAGGAGGGTGGAGAAGAAGGGGTTATGGCATAGCCAGCCTCCTGCCCCC
TGGGGCGGTGGCGGTCTGTTACTTTCCCTTTCTTACTTTTTCTTATCTGGCAAGTGCACG
TGTTCTACAGCAAAAACTTTTAAAAGAAAAAAAAAAAAAAGGCAAATTGTAGGAAAACAG
GGAATGATGCCCTGTGAAGCTAACAAGTATCTAATATACTTTTTTTTTCCATTTTGAACT
CAAAAATTTATTTTTTAGTTAAGGTCAAGGAGTCTGCTGTTGAAAACCATGCAGTATTAA
GTCATGCTGTAGAAGAAGAGCATACACATCTGGGTCCAGCTATACTGCCTGATAATAAGG
TTAGGAATATGTTGGTGTATGTCATAATTTTGATTACTTGGCCTCAGGTTCTTTTTGTTT
AATTTATAGAAGTTGTGAAATATTGAAGTTCTCTGAGATCTGCTCTTACCGAAGTAGATC
AATGATGAAACTAGCCAAATCTGAGCATCAGAAGACCTTCCAGGCTACCTGATGCATGAT
CTCTCTAGTTCTGAGAAGCAAAACTTATAGTGTAAAACAGAAAGGACTTATTATTATAGC
TCTGGGTGTGCATGTGTGTGTATATGAAGGTGACAGTGGATAACTGAGGATTGCTGAATG
GTGAATGGGATATTGTGTGTGTGTGTGTGTGTGTCTGTGTCTGTGTGTGTCTGTCTGTCT
GTCTTTAAAGGCAAATCATTTCTGAGCGATGATGATAAGGTTTTCCTACTGACCTCTGTA
ACTCTGAAGGTTTTTACACTTGATCTGAGCTCAGAAATGACAACTGCTGACACTGGTCAT
TTGAGTTTTTTCCTATCTATTACTATCCTGTAGTCTAATACTCTCTTTAATTTCTAGGCT
GAAACACAAGAGATTTCTCATGAGCCATTATCTTCATTAACTGTTTCTACTGGAAGCTTA
AGTTATGAAAACACAGATTTGAGCCTTACAGATCCAGGTAATAATGATAAAATATTTGTA
ATTAAGTGGAAAGACCCACACCAGTTGGGTTGTAAGATAGAGTGGTAGGTGGAAGCATTG
CTTTTTCATAGTACACTGGGTGTGTACTATTTATTTAAATCTCAAAAGCAAATTGTTAAT
GCCCCATAGAATCTCAGTGTGGTATTCTAAACATGACTACAAGCCACAGCAATTTCTGTG
GATCCCTGACAGTATTTTGAAAAGTAGTCATTAATGTGACATTTTTCTGTTTAGTGGAAA
TCTGAGCAAATGTTCTTGGCTGCACCATGCCTCTCTACCAAAGTATGTCTCTAGAGAAGT
ACCCAGCCATTAAAAGAATATAGTGTCAATGTCAGGTAAATATTTTCATTAAATTATTTT
CAGAGTCATTTTCAGAGCATCTGGATCCTAGGGAAGAAGAATCTACTACAGGTAAAGAAG
AGGAAACAAATATTTCAAGCTCTGTATTTCTTTCAACACAAGTTATTTATCAACAGCAGA
ATTTTTTAGACATTTCTAAATCCCTGTTGCCTGCAGTGGAAGAATTTATATCTGGGCCCA
CACACTTTCAGCCAGTCATAGACATAAATGAAACAGATTTGAAACCTGAAGAAAAAGGCT
CACAAGGTAAAATTATTTTAAACAAATGCTTTTATGTAAATTTATTTTTAACTTTTCACT
TTTCATCCTTTCTAGTTTTAAGTAATGATTGTTTGAGCTTTATACTTTTATGGCCTGCTG
CACCCGTTACACCACAGGAAGTATTGAGGTCATTTAGAGAGAGAGGATCTGGAACAAGTA
GACTAGCTGAAGAGTTCAGACAGACCTGGATTCAAGTTGTAGTTTGACAATTTTCTGGCT
ATGCTGACCCGTGTCTATACACTCATCATTATACATTATACTGCTGTTATTAAATGATAA
AAAGAGATACGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGTGGC
ATGCACCTTTAGTCCCAGCTACTTAGGAGACTGAGACTCTGTCTCAGACTCTGTTTAGAA
GTTTGGTCACTGAGAGGATCTCTATTTTTTGGACCTTAGAAGTAATCTGGTAGGAGTTCA
TTTAAAAGCATCTGTTGAACCTGAAAAAAAAAAAAGGAGGTAATTTTGTTGCATTGAGGT
TATCTAAAAATAAGCTTTTATGAATGTGTTCTGAGTACTCCTTTTCTAGGCTTCACTTTA
AATTTTAAAAATAAATTTGTGTTTTTGTTTTTTGTTTTTTTCCTTTTCCTCAAAATTCTG
ACAGTTGACCTTGACTTCCCAGAATTGGAACACATTTTTCCAAATTTGCATCGTCAGCTT
TTTAAACCCTTAGAACCACATCCAGATTTTGATTTATCATCATCATCCTCTGGGATTTCT
CAAGACAACAGAGACTTTTACCAGGTATATTAAAGCAGATTGTTCATTGCAGTGAATAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1064, 10725..10858, 11401..11431, 11433..11599, 13337..13461, 14339..14432, 19759..19854, 23586..23726, 25449..25632, 25837..26004, 28599..28820, 30520..30612, 31037..31140, 33631..33768, 34071..34168, 34746..38175, 39696..39876, 40012..40155, 41850..42002, 44058..44158, 44697..44796, 45183..45283, 45289..45318
1001..1064, 10725..10858, 11401..11431, 11433..11599, 13337..13461, 14339..14432, 19759..19854, 23586..23726, 25449..25632, 25837..26004, 28599..28820, 30520..30612, 31037..31140, 33631..33768, 34071..34168, 34746..38175, 39696..39876, 40012..40155, 41850..42002, 44058..44158, 44697..44796, 45183..45283, 45289..45315
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved