Tupaia_belangeri Locus GLTSCR2
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri GLTSCR2
Tupaia_belangeri
GLTSCR2
GeneScaffold_1075
SNORD23
9679..9789
17244
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCTCTCTCAGGGAGGCATTAGCATCTTTTTGCGAAACC
CGAACTTAAAAAACTAACTGGTTGAGCCCTGAACTTTTGGTAACTTTGATAATGTAGATA
GTTTTAGAGGTATTTATTAATTATTATTAATTTGCTATTGGGTGCGTGTGCTCATCAAGG
ACCGAGGTGGGATGGGGGGAGGTGATGGGGGTGAGAAAGAAAGCCACCAAGTCCAGGCCT
CCGTTGGCCATGTGGAAGTCCAGCACCTTAACCACCCCACCACCTGCTGGCCCCATATAT
TTCTAATATTCTCCCAATATAACGTTCCGTGATTCCAATCTCAAGGTTCCTAAATTTCTT
CCAAACTTTTAGAACTGGAAACGTTCTGAAATTGGAACCAGTCTTTCTTTTTTTTTTTTT
TTAAGAGGTTTTTGCTATAGGGCGCCTGCGCTCGCCAGACAGAGACACAAAAAGCGAGAA
ATCACCCCCCCGGGGGGGGGGGATGGCTACGCTGCAATCCCTTCTCCTCCATTCTCCTCT
CGGGATCTTGGGCACACACGCACACGCGCCCGGCGTGAGTTTAAGCCACGGGGTCCGGGA
CAGGAACCGCGGTCGACTACAGCAACATAGCCATTACGCTAACTGCTGGTCCCGGAACCT
GTCTTCTACTGAATCTGCCACTGACGATTCTAATTTTCCCTTAAAAAGAAGAAAGAGAGA
TTAAAGTTGGTTTACAGGTCCCGCTGCAAACCGGGGCAGGGAGGAACGCCTGGATTTACT
CTTTACCAAGATGGCAGCCTCCCGGCCTCTTTGCCGCTCGGGTCCCTTTACCAAGGTGTC
TGTCACAGGAAGTGCGTCACGGGAGAGGCGGGGAGATGTGCGCGCGCAAGCCCCGAACCG
GATATCAGGGCCCCGGCGGCTGAAACCTTCCTTTAAACAAGATGGCGGCGGGGAGATAGT
AGTGGTGGTGGTAGGCGCTCCTCCAAAAGCGATGCCAATTCTGGTTTCCTGGACCTGCGG
CCCACGTCGGTGGACCCGGCGCTGAGGCGGCGGCGGCGAGGCCCAAGAAATAAGAAGCGG
GGCTGGCGGCGGCCTCGCTCAGGAGCCACTGGGGCTGGAGGTGGACAGTCTGGAAGACGT
GCGGCTGCAGGAGCGCACCACGGTACGTGGGGCGGACTCGGGGCTGGGCCGCGTCGCTGC
GGCCAGGTGCGAAACAACGTGCTGGGGCACTTCCGGGAGGCCGGGGGCAGCTGCCTAGTG
GGCTGGGGACCCGGGGCAGGAGGCTGGGCGGCCTGGTAGTTAGCAGATTGAACACCCCAT
TTATTTGAATATCGGGTAAGCAGCGATTACTTCTTAGATGTAATTGCGGCCACTCGTGCT
CCCCTAGCTCGGTTAACTTTAAATATTAAAACGTGGAGTCAAGGGCAAGGCCTTAGCCAG
AAGGGGCCCGTGGCGGGAAGAAGGTGCTTGAATGAACACAAAAGGAAGGGTCCTGAGGGG
TGAAACCTCAACACCTTTGGCTGACTGACTTTGCATTTCCCAGTGGCTTGTTGTCAGAGG
CCCCGGATGAAAAACTCTTCTTCGTTGACACCGGCTCCAAGGAAAAAGGTGATAAGGGGC
TTTCGTGGTGGTGGTGTCCGGTAGCTGGCAGTGATTGGTTGCCATCTAGCCGAGGGTGGC
CCGGGAGCACCTGTGCTAATGGTTTGGCTTGGAAGGCAGAGGGGTGTTGCTTTAATGCAA
GCAGGACTTCTGGCCTGCTCGTGGCACGGCGGTTAAGGCTGATGGAGTCCACTTAGCAGA
CTGCATGGTTTGAGCCCCAGGCCAGGGACACGTGTGTGCGCCCAAAATCCCAAGAGGAGA
AATAGAGGCGGAAGGCTTATGGTGTTACCATCCCCATGCTCTGTGCTCCTGAAATTATTA
TGCCTTCCGGAAACCCGCAATGGAGGGAGGTGGTAGGAGTCATTTGAGGGCACAGAGGAG
CAGGCTGCTTGGTGAGGTTCCACTGTACACAGGAGGCTACAGCTCCATCCCGGTAGGTCT
GTTCTGGAGGTCTTCCTCTGAACCCTTAGGCTTTAGAGGTGAAAAGCAGAGAACGCAGTG
CTGGTAATCAGCCTTCCTGGGTCCTGCGTCCACCCAGTGGCCCTCCCCAGGCCACCTGCT
CTCTTCCCTGTTCTGGGGCAGCTTCCCTGCTGTGTCTGGGCGCCCTCGGGTGTCCCAGCG
CAGGGCCTGCCCCCTGCTGGCTAAGGATATGGGGGTGGTGGAGGGTTATACTGTGTGCCC
TGCCCTGTGGGACCTCTGCCCTGGGGTGGATGTCAGGGTCAGCCTGGGGACTCCAAGTCC
GTGCTGGTCACTTGGGATGCAGCTCAGGTGGCTTCATGGCACTGAGGTCAGGGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTCCCATGGAAGGGCAGAGTGGGCC
CTTGGGGTGACCACCTGGGATCTGCCCCTGGATGGTGACGTGGGAGGAAGTGGGCTTTTG
GTTTTGACGTGGTTGTGAGGTGTCGGGATATATCCAGGGTGTGGCTCTTGCTTTGTGGAC
TCTGCAGCTGTGGGGAGAGAGCTGAGCTAGAGACAGATGGGGGGGCATCTGAAGGGGAGG
TGGGCACCTCCCTTGGGAGAAGTCCTGGAGAGGAAGCCTGGGTTCTGCCCGGTGGCGAGG
GTGCCCCACTAGGAGGCCACCTCACCCACTGCACCTGTGCCCTTCTCTCCGACCTAGTGT
CCTCGCCCACCAAGTCCCCCAATGCCAAGAAGCTCAGGCGGAAGGAGCAGCTGTGGGAGA
AGCTGGCAAAGCAGGGCGAGCTGCCCCGGGAGGTGCGCAAGGCCCAGGCCAGGCTCCTCA
ACCCTCCCACCGCCAAGGCCAGGCCTGGGCCCCAGGACACTCCCGCACGACACTACTATG
AACTCTGGGATGTGGACAGTGAGTGATCCTGTGTCACCCGTGGGCGGGGCCAGGACTGCT
GTGCGCAGTTGTACGTGTCGTGCACTGTGTGAGGGCGCCCCGGGGTGGTGGTGATCACCC
AGCAGAGCCGTGCGGCCTGAAGTGGCGTTTTCTCACTTGTATTTCCTGTCCTGAACGTGG
CGGTCGCCCTCCTCAGTTTGATCTCTTCCGTTTTCTGGACCTTGTCCAGGCGGTGTGGCC
TGTGTTCAGGCTCATCGGGGTCAGTGAAAGAGTCCTCCTCTTGCTTGAGCTTCAGCGCTA
TCTTTGAAATGAGGGATCAGAGGGAGCCCCCTTGGCCATGCTAGAAAGCCCCCAGTAGCT
ACCCCTCACTGTCTCCTCAGATCCCCTGGACAGGCCACTGGTTGGCCAGGATGCGTTTTT
CCTGGAGCAGACCAAGAAGAAAGGCGTGAAGGTGAGGTCTTGAGGGAGGGCGTCGGGGTG
AGGGTGGTCTAGGGTGGGGGGCAGCTCTAATTCGGGCTGTGGTGTCTCAGCCCCAGAACC
ACCTGTCCAGGGGAGTTGACCTGGGTGCTGGAGCCAGGAGGCCCGGTTCCTGCCCCCACT
CTGTACTGACTGGGAGGTGGCAAGACCTCTCAGTGTCTCCATTCCTTAGTTCTGGGGTGG
TTGGGAGAATAGATCAAAGCACCCCATGAAACGCTGGAGATGGCGCCTGGCGAGGGTGTC
CCCTGCTGCAGGCTGTGATTCGTGGCCTTTTCACCTCGAGCTGCTGGACCCAGAGTGTGA
GATCTTCAGGGTTCTGTTTCATTCGTGTAGCAAGTTACAGGGGTCTTCCTGCTAGGCTCT
GGGTGCCGGGCAGTGGGGAGGAGAGGGGGGCTGTCCTTAAAAATAAACCTGGCCTGGTGG
GCTCCAGAAGGGGAGATGGCAGGGCATGGAGGCCAGGTCGGCAGGGCAGGGCGTGCTTTA
GGTAGGCCCCTCCTGGAAAGAACTCGGTACCCACGGGTTAGAGACCTGCAGGGGGCTGGG
GAGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNACCACGTATGTTCAGGAGCCGTGGGGAGGCAAGCTTGGT
GTGGGTGTATTCGGAGTGGGGCGGGGTGGGGTGGAGGATGGCGGGGGGCCACACTGAGGA
GGGCAGACTGTGGGCAGGTGTGTGGGGCCATGGGTGTGAGGGTGCCTTCCTGAATCTGTG
TGGGCTGGGGTTCAGGCAGCCTCTCAGGTGGTTGGGTTTGGGGGAGGCTTGGTGGGGATG
CAGCGAGGCCACAGCGTGGCTCTTACTTGTTTTAGCTTTGTCTTCCCCTAGCGCCCCTCG
CGTCTCCACGTCAAGCCCTCCCAGGCACCTGCTGTGGAGGTGACGCCTGCCGGAGCCTCC
TACAACCCGACCTTTGAAGACCACCAGGTACCTGGCCTGGCCCCAGCCCCGGTCTGGCCT
CTGCCCTGGGCTCTAGTGCTGGCGTGGCCTGCTCTTACTGGGGTTTGCGTGCTGACCCTA
GCTAGTGGTGCTGGGGTCCCGTGACCGAAAGAGCCCTAGACCTGTCCTTGTAGGGTACAT
GGACTGGTGGGGGGACAGACCTGTTCCCAGCCAGTGAGGGTGCAGAGTGTTGGGCTGGAA
GCCCAGAGAGGACTGGCCCAGCTCGGGGTTGGGAAGGGCTCGCTGGAGGAGGGACAGCTG
GGCTGAGGCAAGGCTGAGGGGGACTTTGCTGCAAGGAGAGGGGAGTGGGTTTTACCAGGC
AGAGGGGACAGAGACCACATGTGGCACCTTTCAGGGATGCCACAGGACAAAGGTGTGAAG
GCCTTCTTCAGACTGGCTGAACACCAGCGTTTGTCCAGGTGCAAAGGGAGTTAGCAGTGG
GAGGGTTGCTGTTAGCAGGCGTTTGTTCAGCATAGGGGCTGCAAACCAAGGGACGACGAC
CTCCCTCGGAGCACATCTAAGGGCAGGGCCCTGGCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCCCGACCTGGGGATTAAGACTCACGCCAGGTGCGTGTGAGTGCGTGCC
CAAGATCCTGAGAGGAGATTGGAGGAGAAGGGATTGCGGCGTGGCCATCGACCCTGGGGG
TGATTTCTTGCGTTCTGTCTCTGTCTGTCTGGCGAGCACATGCCCCCTATAGCAAAAAAA
CCTCTCCATAAAAAAAGAGCACAGCAGCTGGAGGGTCCTGCCAGCGGCTCCAATTGGGGC
CTCGCCCTGAGGGCTGGGTGGTACCCACTCACTGCGTCCCTCCCTGCCCCATCTCCACAG
CGAGCCCAGCAGGCCAAGCTTCGGGCTGCCCGACTGCAGCACCAGGAGCTCTTCAGGCTG
CGTGGGATCAAGATGCAGGTGGCCCAGCGGCTGGCGGAGCTGGCTCGGCGGCAGCGGCAG
CGGCAGGCACGGCGTCTGGCTGAAGCCGACAAGCCCCGCAGGCTGGGGCGGCTCAAGTGA
GGCCCGGGCTAGGGAAACCAGGGGACGATGGGGTCCAGATCCCACATCCTGGTAGCTTCC
TGTCTGCTCGGGAAGACCACCGGATATCCTCTGTCCCTCAACCCCTCTCCCCTGGGTTCC
GTCCCCCGCCAGGCTAATGGCCTTCCCTGCCCTCCAGGTACCAGGCGCCCGACATCGACG
TGCAGCTCAGCTCAGAGCTGTCCGGCTCACTCAGGACCCTGAAGGTACCTGCCCACTGGG
CACGGGGTGCTGCGGGGCGTGCCCAGTGATGAGACCATCCTTGCTCCCCATGCTCCCCAG
GGGGCTGTGGGTGACACTATGGCTGCCCCCGGGCTGGGCCAGGTGGGCCAGAGCCCGGGG
GCTGAGGGCACGGGGTCTTGATATGGGGTGCCCAGGGTGAGGGGCTGGGAAAAACTCCAC
TGCAGCATCTGGACAGCGACCTCATCCTATCACTGCGAGAAACAGACTGTGTGCACTAAC
TGCCGCGTGTAGAGAGCACAGGCCATATTGGACACTTGGGCTGGACGCACATTAGAGCGG
GAGCTAGGTGGCGCGGGGGGCGGTGATCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTACAGAATGTGAGAAGTTACTCTCCCGTTTGGCCATGCCATAATCCCTTCAGTCTCAC
TTTGGGCATGCAGGCACATGTGTTCAGTTGTGTTTTAAGCTGCCAGGCCCAGGACTCTAA
CCGCGGTTGACCATGTCTTACTCCAGCACGTTAACCACTATACCACCTGCTGCTGGCCCC
CTTCTCTAGTTTTTGGGTTTTTTTCTCTCCCTTTTTTTTTTTTTAATTTATTTTTTTAGA
GGTTTTTGCTATAGGGCACATGCACTTGCCAGAAAGACAGAGACGGAGAGATAGAAAGCG
AGAAATCCCCCCCCAGAGAAGATGCCCGCCGCATCCTGTGCATTCTCCTCTCAGGATCTG
GCACGCACGCCCCCACTCCAGCGGGAGCTTAAGCCACTGAGTTCTGGCACTCAACTGCGT
CACTACATGGAGTTCAGCAACATAGCCATATGCTAACTCTGATCCCAGTATGTTATCTTT
GATTAAAGGGCAAGGTGCACTGCTGGAGAGAGACAGTTGAGCGGGACAGTGAGAAAGCAC
CTCTCAGAGGACTGACCATGCTGCAAACCCTCCATTCTCTTCCCAGGCTCTTGGGGCATG
CATGTACACATACCCAGCGTGAGTTTGAAGCCACTGGGTCCGCGATTCAAACCGTGGTCT
TCCATGTGGGAGTCCATAACCGCTATGCCATCTGCTGGTCCCCTTCTCCAGTTTTTGTTA
TGGTCTTAGGGATGGTTTATCCAGGACCAAATGTTTATAAAAATAGAGCAGGCAATTTAT
AAAAGAATTGGGGGGCTGACATCAGAGCGCCCCGTTTCCACTGTATCCTGCAGGACAGGA
CCTTAGGAGCTATTCTGCTGTCCCCCTTTCTTATCTTAAATACAAATGAGCAGGAATTTC
CTACAGACAACATCCTTATGTGTGTGGTGGGGGTGCAAGTGACAGCGGGTGGGAGGGAGA
ATGAAAGCCACCTGGTGTCCAGTCTGAGAAGGAGCCTCTGACCCAGTGCTAAGAGTGTGA
AGGAACCTGCTAGAAGAGGGGAGGAGTCACCCAGCCAGGGTCGGCCACCCGTGCTCGTGT
CTGTTAGGTACTGGGGTGCCTGTGGGCAGGGGTGGCCCCATGGGCACGTTTCTGTGGCCT
GGACACCTGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATAG
CTCAGCCAGCTCAGAGACCTCCGTGGTTCTGTGCCTGCCACCCCATGGCAGCCCCTCGAG
CTCCTGCCAGGCCAAGCACCTGGTGCTCACGAGGCAGCGCTGGGGGGACTGCAGAGGGCG
AGCCCCCCTGTGCCTGTGGAGCAGGCTAGTTCTCGCTCCTGCCAGGCCGCTGAAGCCCCC
CCCCCATGTCCGCAGCCCGAGGGCAACATCCTCCGTGACCGGTTCAAGAGCTTCCAGAGG
AGGAACATGATCGAGCCCCGGGAGAGAGCCAAGTGAGGGCTGGCGCCGTGGGGGGCGGGG
CGCTGGGACGGTCCCACGAAAGTGGCACTGGTCGCTGACCACACCCTTGTCCCCCAGGTT
CAAGCGCAAGTACAAAGTGAAGCTGGTGGAGAAGCGGTCGTTCCGCGAGGTCCAGTGAGT
GGCTGCCCCCGTGGCTGCAGAAGAGGGCCGCCTCCCTCCCTCAGGACCCACTGACTCAGG
GCCCTTCCCAAACCACTGGCTGGCCAGCCCACCAGAGGCACCGGGGCCCAGAGTGGAGGA
GGGACGGTCCCCAGAGGGAAATGAGGCCAGCAGGGAGTGTCGGATGGCAAGGACGCAGGG
CCCCTTGGTGGCCCTCAGCCCCCTCTCTCTGTCCCCAGGTTGTAGCCGCTGCTGGATGCT
GGAGCCTCCTCCCACTAATAAAGCACCTTCCGACCAGCTCAGAACGCTTGTGACTTCCCT
CTCTCCTCCCGGCAGCTCCTGGGGGGAGGCGTCCTCTACTCCCCCACCGCATTCCCTCCT
GGCGCACAGGGATGTTGGCACCAGGACCTCGTCTCTGCCGGGGCCTGGAGAGGGCCGGCA
GCCGGCCAGTCCTGCCCACGGTGCAAGGCCACAGCCCCACAGGGCGTGGTGGATCCTACA
CAGACAGGACGGGCGCTGGTGGACTGGCGGGGCTGGAGGGGAGGGTGAGGCAGGCAGGGC
CGCGTTGGGAGAACGGCCTCTGGGCCCGAGAGCAGGTCCTGATGGCCCTCACACTCACTG
GCAGAGGAAGCAGCAGCAGCGGGCGCCTGAGCATCTGCTGTTTCTCGGTTCTTCAGACGG
TCGTCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1011, 1013..1151, 1153..1182, 1185..1187, 1189..1218, 1220..1221, 1603..1667, 2688..2796, 3357..3378, 3380..3557, 3920..3990, 5271..5366, 7279..7383, 7484..7666, 9240..9415, 9577..9643, 15795..15871, 15957..16013, 16238..16244
1001..1011, 1013..1151, 1153..1182, 1185..1187, 1189..1218, 1220..1221, 1603..1667, 2688..2796, 3357..3378, 3380..3557, 3920..3990, 5271..5366, 7279..7383, 7484..7666, 9240..9415, 9577..9643, 15795..15871, 15957..16013, 16238..16241
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved