Tupaia_belangeri Locus RPS13
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri RPS13
Tupaia_belangeri
RPS13
GeneScaffold_1321
SNORD14
2201..2295
4849
AAAAGAATGTGGGTGGGCGTTTTGGTACTAAGCGTCTTTCAATGTCTTACCAGTTTCTT
TATGGACCAACTGGAGGTTATTGATTTCACTACCGTCTCTCCTTCCCAGGCCGTGCTCCC
CCCCCCCTTTTTTTTCTTTTTCTTTCTTTTTAATTGATCTGCTTCATTTGCTCATTCTTT
CAACGCATTTGTCTGTCAGTAGTGGATCAGTCTTAAAAAGTGCTTCCTCAGTGGTGGGTC
CCTCTTCCCAAAAAGTTCAAACCGTTCATTTTCTCCCCCAGCCGTAAACGCGCTCCCAAA
GCTCTTCCTTGCTCACCAATTCTCACTGGAGTCGCGGCTCCGTGAGCCTTAGCTCAAGGC
TTTCCCGCAGGCGAGTGGGCGGGTCCGCCAGGGCAACCCCCGGGTGAACTCTCCACCATC
AGGGATCTCTCCCCCAGAGAAATGGGATGAGGGTCTAAGATAAGCAATGAAGCGCTGGCT
AGCGGTCAGCCTATCATTACTCCCAGTGTAGACCTGCCACGCCGTTTTGTACCTGGAACA
ATCTTAAGGGCAAGCGCAGACTGGGGTCTAGTGTCAGAACAAAACCTGGGGCTGGCGAAT
GAACGAAACGTGTACGGCTGGTCTCGGCAGTTCTCTGCGCCGCGCCCACCCCCGGGCCAG
GATTCGAACCTTTACACCTCAGGGTTGGCAGCACCGCCGGTCCCAGAGGCGTCCGCAGAC
GGAGAACTTCGGAAGCTGGAAGGAGAGAGACTGAATTTCTCGCTCAGGCCGCCAGGCTGA
CCAAGGAGCGACGCACGCCGGGAGTGCGTCTCGAGGAGGAGGAGCCCTTAGGCCGCGCCG
AAATGCACCTCGGGATAGAGTCTCGCGTGCTGTGGCCGCGCGGCGTAGCCCCGCCTCCCG
CGACGAGAAGCGCCGCCGTGTGAGGTCACTTCCTGCGTGCTGGGTGGCTTCCTGCGCCGC
TTCCACGCTCGCTCTCTTTTTGCTGCCAGACCGCCGCCATCATGGGTCGCATGCACGCTC
CCGGGTGAGTTTGGGGCGCCTGGCGGGATGGCCGGGCGGGTTGCGGGGAGGCGGCGCGTG
TGGGCAGCGGGTCGAGGGGCTGATGCTCCGGGCTGCTGCGGCACGGGCCACCGCCTCACC
CCCAGACTTCTGTCCCCAGGAAGGGCCTGTCCCAGTCGGCCCTGCCCTATCGCCGCAGCG
TCCCCACGGTGAGTAGCGCGCGGGGACCGGGCTGAAGCCGGGAATGGGGTGGCATTGGTC
GCCTGGTGAAGCGGCACAGCGGGGCGTGTGGGGACGTGGGTGCGCGAGGAGCGCGCGTCT
TCGAGGGCGGAGTGGCGGCCCTGCTCCGGCACGGTCCTTGGTTTCCCAGCTAAGGCGGTT
TTCTGCCCCGTGAACAGTGGCTGAAGTTGACGTCTGACGACGTGAAGGAGCAGATTTACA
AACTGGCCAAGAAGGGTCTGACTCCGTCACAGATCGGTGAGTGGCTTGTGCCTGACGGAG
ACCGCTCATGCCCTGTGGGACTCGACGGATAGGAAACGTGCCTCATACATGCCTAGGAAA
TCATCTTGCGTTTTTTCTAGTTTGCTGTTGAGGACTGTAGGCCTTACCTTAATTGAGCTT
TCAGGTTTTTATTTAATAGGCTGGAGAATTAATAAAATTCTTGCCAAAACTTAATGAGCA
ATTACTGTGGACTAGGCACCCTCTAAAGTACATTTTAAGTAAATACTGGTAGCCCAGCCT
CACACCCCTCCACACCCATTTTGCATTTGAGGAAACAGGCAGCGTGCACCTAAGTAGTCT
CAGATTGCAAATCTACCAGGCGGAAGATTTGGGATTGGCTATGCAGGGTGCTCAGCACTT
CATCACCCTCCGCTGTGGTTTGGATCTCAGCTGTGTGTGACTTAGTGCCAATGGTTTCAT
TCAGCAAACATTTGCTTGCTGTGTGCTGAACATGGTTCTGGGCCCTGAAAATACACTCGT
GAGGGACAGGCATCATCTCTGCTTTCCTAGAGTTTAAGTCTGGCGGAGGTGACACACACA
CACACAAATGTATACATATGACATGATAGACTGTCCAGTAGGACTTGTTTGGGATTTTTA
AAAAGGGTATATGTAAAGTTTTTCAAGGAATGTTTGATATAAGCTGTCAGTAAATGCCAG
TTGATTTTAATTATTCAATAAACAGAGTTAAAGTAATCTCACCAAACTCACTATGAGATG
GTCTTCCAGCATTTGCAGTTTCCACCAGAAGGGTATCCTTAGTGTTGGGTAAAATCCTCC
TTGGATGTCTGAATGGGGTTTACCTGCATTCTTGTGTTGGTTTCTAGGAGATGTGCTAGT
AGATAGGCCCCCTCTAACACAGGGAACTTGGGAAGTGACTTCATAGCTGAGCTGTGACAT
CACACGCTCCAGTCTGTTGGGTGTTAAAAATGTGTGATTCCCTTTACAGGTGTGATCCTG
AGGGACTCACATGGTGTTGCACAAGTACGTTTTGTGACGGGCAATAAAATCTTGAGAATC
CTTAAGTCCAAAGGACTTGCTCCTGATCTCCCTGAGGATCTCTACCATTTAATTAAGAAA
GCCGTTGCTGTTCGCAAGCATCTGGAGAGGAACAGAAAGGTGAGAAACTGAATAAATATA
AATAAAGGGCAGGTGCTTAGTTGAACTGCTTGCATCTGATTAGCATTTTCTAAGGTGGCT
TAGAGCACAAATTAGCAAGCACTACAGTGGCAAAAATTCTACCAGTAGAAGAGCTCATCT
GTGACTTGCTGTTTAGTCTTTTTTTTTTTTTTTAAATTGAGAAGTTTTTATTTTGCTATA
GGGCACACACGCTCCTGAGAAAGGGGAGCAGAAAGTGAGGACTCACCCCCTGGGGGCAGG
AATGGGCACACAAGCCTGGCATGAGTTTAAGTCACCAAGTCCAGGACTTGAACTGTCATC
AACTATATAGGAGTCCAGCAACATAGCCATTATGCCAACTGCTCGTTCTGCTGTTTAGTC
TCATCCTGGAAGACTACACATGAACTGTAGTTTATGATTCTATTATCAAGCATTAGGTAA
CTGTTTCTCTGTTAAAAATAATGTTTTGGTTTTTTATTCTGGAAGGTTTTCATGAATTGT
AACAAATTGTATTTCAGGATAAGGGATGCCAAATTCCGACTGATTCTGATTGAGAGCAGA
ATTCACCGATTGGCTCGCTATTATAAGACCAAGCGAGTCCTCCCCCCCAATTGGAAATAG
TAAGTATTGACCTTTTAAGTGTAGGAGTCAACCCAGGCAGTAAATACCAAATATAAATGC
TTTGGGTCTTGCGGGCCATATGGCTAACTACTACTCTTCCAGTTTTGCCGTGGTAGTGGG
AATGCAGCCACACACAACATGTCATATGGGCCTGCCTTTTTCCGTGGAAACGTTATTTAC
AAAGACAAGCGCAGGGCCTTATTTGCAGACCCCTCGTTTGGACCATGAACAAGCACTTTA
CCTTTTAGATAGAGGGGAGAGTTTCATGTCACGTTGCTCCTAGGTGGGTGGGTGTGTGTG
TGTGTGTTAATTTTTGCGTGAGTTCCTGTGGTGGGCAACTTCCACCAGAAAGATCGTTCT
CTATGTTGGCTAGTTCTTGGATGTCTTGAGTGAGTGTCTTCATTAAATACCTGAGCGCAG
TGAGCTGATTGAGAAACGCAGCAGTTTGACGCATTTTGTATAGTTGGGGTTTAATTTAGC
TGTTGTAAGTACCTCCGTTAGTGGGGAGAGTCTGAATGTTTATGGGGGGACCAGTATTAA
TCTTGATTTTTCTCTTGTCCTTCTTTTCCTTTTCAGTGAGTCATCCACAGCCTCTGCCCT
GGTTGCATAAATTTGTGCATTCAAGGAATAAAATCATCGTTTAGCTAAATGCATGTTTTG
TACTTTTTTTTTTTTAATTACGATGTATTAGTGTTGTGTGTGTGGATCGTTTCTGTTGGG
GAAGTGCCTTAGCTGAGTGATTCCATGAAGAGTGGTAAGATAGTGTCCTATCGGATCACA
TACCTTCACTGGCCTTTAAACTAGTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGT
TTTGCCTTAGGGACACAGAGACAGAGGGAAAGTGAGAATTACACACACACACACACTACC
CCGGGGGGGTGGCCACACCACAATCCCTTTTCCATTCTCCTCCCAGGATCTTGGATGCAC
ACTCACCTGGCATGATTTTCAAACCACCAGTTCTGGGGTTCCAACTGTAGTTGGCTACGT
GGAAGTCTAGGAACCTAACTGCTACTTCATCTGCTGGCCCCAGAACAATTTTTTATATTA
CTTTATTCATCATTATGTTTATAATTTGACTTGAGAGAAAGTAAGCCATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1159..1207, 1397..1475, 2449..2618, 3137..3141, 3143..3238, 3816..3849
1001..1023, 1159..1207, 1397..1475, 2449..2618, 3137..3141, 3143..3238, 3816..3846
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved