Tupaia_belangeri Locus EIF4A2
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri EIF4A2
Tupaia_belangeri
EIF4A2
GeneScaffold_1479
SNORA63, SNORA63, SNORA4
2870..2996, 3709..3840, 4017..4153
10352
ACGCGGGGCACAGGCGGCGCTAACAGGCCCGGACGGGAGGCCGGCCGGAAGTGGAAAAT
GAACTGCCATTTGAAATTACCCCTGCCTAACGTCTCGGCCCTCTTCGCGGAAACCAGGGC
GCGCCACTCCCTGGCGGGCACTGTAAACACCGAGCCAGCCGACCTTGCGCCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCGTCCCTTCAGACTAGAGTATCCTTG
TGTCCTTCGAGAAGCTTCCATAATGGGTAGGGCCCGCAATTGCTGAGAGCTACGAGGCGA
GAGACGCAGTGAGGTGTCTTCTGGCGACCTTGCGCACTGTCGCGGTCGCTTCCCCTCCCG
CCGCGGAAGAGGGCAACTATTTAGATACGAGCCGTGGCGTAGTCGGCATTCTGTCCAGTG
GGTCGGACTCCGAAGCTTCCCGGGCGGTCAACGGCGCGAGTCGGGCCCCTGGGCTGTAGC
GGAGTCGGGCAGGATGGCCGCGGCGCCCACTGGCACAGCTAGAGGCGAGGACATTGGGCT
GGCGCCGGCGGACCGTTGGCATAGCCCTCGCCAGGCCTCTCCGCCTGCGTCAATCACCCG
GCTTGCGCAGTGTTTGGGGCGGAGCTCAGCGCGTGCAGCTCTCGCGAGAAGCTCCACTCC
CCAAACGGGAGCGTCGTGCGCGGGAGCCTAGGAGGAAGGGGCTGGTGTTGGCGGGGGTCT
CCCGAGGCTTCTGCAACCCCCTATCCTCAGGGAGGGCGCCCAGCTCCTCGTGGGCCCTGC
ACCGCTACCCAGGTGTGCTCCTGCAGTAAGTGTACGCGTGTAGGTGTAGGGGAACGTAAT
GCGAGAGACGGCTTATAAAGGGTTAGCCCTTGAGCAGGGTGCGGTTAGGGTGGTTTCGGA
GAGGTGGAGGTTCGTCTAATTGCAGTGTTCTTGTCAGCAGAGAACATGGCGGCTCAGAGG
GAATGGACCCCGATGGTGTCATTGAGGTGAGAAATCGGAGTGGATTTTGGAGTACTAGGA
AGGTGAATTTGTTCATCTCATTTATTCCTGTTTTGATACTTTTAACTTACAGAGCAACTG
GAATGAGATTGTTGATAACTTTGATGATATGAATTTAAAGGAGTCTCTTCTTCGGGGTAT
CTATGCTTATGGTTTTGAGAAACCTTCAGCTATTCAACAGAGAGCTATTATCCCTTGTAT
TAAAGGTAAAAAAAAAGTTATTGACGTTGTGGAAAAGTGAATTCTCTGTTTTGCACAGAC
TGGACCATAAAAGGGACTGGTAACCTCTGGGGGAATTAGCACCAGTTTGTATTCCTTAAA
GTGAAATGATGGCAATCATCTTTCGGGACTGACCTGAAATGAAGAATACATTTTGCTGAT
CACTTAATTATTTGGGCATATTCATGTTCCAAATGGAATACATGGTGTAAAGTAGAAGTG
ACTATTTGAATTAGGATCGGTAAATATGTATCCTACTTTTTTTAGGGTATGATGTGATTG
CTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGT
TGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTC
AACAGGTATTGATAGTGTAGTTCAAAAAAACTGCTTGCGTGTTGCATAGATTTCAGGTTT
CACAACTGTGAAGAATTAAAAACTTAGTAAAAAATCCTATTAGAGCCCTTTTAATTGACC
ATGCATGCAGGAGTTTTGTTAAAAGTAAACAGGAACTGGGTGTGCAGTATGTTGTAGCAA
TGTATAGCACAGATAGATTTGCACTTTCTGTTAGTTAACTAGTTGTTCCCACTTTGACTG
AATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCTGTTGCATGC
TATGTTTTCAAAGCTCACTGCTATATTGGCTTTGAAGTAAACCTTCCTAATAAAGCGGCA
GGCTTTATGAAGGCACAGTACCCCCTGGGAGGGGAAATTAACATTTGCCCTAAGTATAAC
TGCAGAACTTGATTCAATATTTACATTTCTCTACACAGGGAAAAAGTGTAGGCAATGTTA
TTGGTTCGTTAGTTGCCTAGTTGATACCTGGGGTACCGGAATCTTAGTTTTAAACCAAGG
CACAAGAAAAATAGGGAATTTTATTTTGAGGCAGTTATGTCAGTGCATTTTAAGCTTGGA
AGTAATTTTGTGCTGTGCATGCATAAACGCTGGCAGAGGAGATATTTTGCCATTGTGCTT
TGGAATTTAACCATAAAGCCTGTAATTCTGTAGGAAAATAATTGAAACTTTTGCCTTTTA
GATACAAAAGGTAATTCTGGCACTTGGAGACTATATGGGAGCAACTTGTCATGCCTGCAT
TGGTGGAACAAATGTTCGAAATGAAATGCAAAAACTGCAGGCTGAAGCACCTCATATTGT
CGTTGGTACACCAGGCAGAGTGTTTGATATGTTAAATAGACGATATCTTTGTAAGTTTGT
TTCATATTTCTTATAAAGAGATTTTAGAGAACTTAAAACATTTGTGAAGATCTAGAGATG
ATGGTGTGACTTTTTCAACAGCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAGCAG
ATGAAATGTTGAGCCGAGGGTTTAAGGATCAAATCTATGAGATTTTCCAAAAATTAAATA
CAAGTATTCAGGTAAGCTTTATTTCATTTTCTGGCTGGAGATTAGGTTTGATGCAGGTAC
TGTTACAATATAACTGAAGTGTTTTATTGTCGTTCCCCCTGCTTAAAACATCTGATACGT
GACTATCTCTGTCTAGCTCCATTCAATAGTAAGACAGAGACGCTTGGTCTCAAACATTTT
TTTTAATGTTACTGTGGTATATGCTTGAGTGACAATATAATCATTGTCTCTTTAAGGTGG
TTTTGCTTTCTGCCACAATGCCAACTGATGTATTGGAGGTGACCAAAAAATTCATGAGAG
ATCCGATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATCAAACAGTTTT
ATATTAATGTTGAAAGAGAGGTAATTTATCTTAATTGCAAAACATAAGTGTCTACTTTGT
TTTACCTTCTTGTATAAGCACTGTGCTAAAATTATAGAAACTAGGACTGTGTCTTGGTTT
TTGTAATAATGCTAGCAGAGTACACACAAGAAGAAGAAAAACTGCACTAGATNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCTAACAAAATTAATTTCTAACAAAT
GAAGTGAAAGTTAAATGACTGTTAAATTTTCTCTTTGAAAGGAGTGGAAGCTGGATACAC
TCTGTGACCTGTATGAGACTCTGACCATTACACAGGCCGTTATTTTTCTCAATACAAGGC
GCAAGGTGGACTGGCTCACTGAGAAAATGCATGCCAGGGACTTCACAGTTTCTGCTCTGG
TAAGAGGCATTCAACTTAGGAAGGCTAATTGAAATGTCAATTTCTGTTAAAGCAGGATTT
AGACTACAATATAGCTGTTAAGTGCTGTGTTGTCGTTCCCCCTGCTCAAAATAAATTTGT
TTCTTAACTATACCTGTCTGCTATACTCAGGTAGCAGCCAGGGACGCTTGGTCTCATACA
TGTTGATAACATTAAATATTGATCTGACTGGTGATTCTTGAATTAAGGTTTGTTAATTTG
CAGCATGGTGACATGGACCAGAAAGAAAGAGATGTTATCATGAGAGAATTCCGGTCAGGG
TCAAGCCGTGTTCTGATCACTACTGACTTGTTGGTAAGTCTCTCTCATGCTTTTCATCTA
CCAAAAGTAAGTGTTTTGGGGGAAGGTTTTTCTGATAACCTTGACCACCTTGAGCTATTT
GGGAGATTAAAGACCACACTCCACAGTGGGCTATATCACTTAGTACAGTCCACTACTATT
ATGTGGCCTACATGAGTTATCCCAGGTTTTTTTCCTAAGTAGAACTTAGAACATATACCA
TTGTATTTCAGGCTCGTGGGATTGATGTGCAACAAGTGTCTTTGGTTATAAACTACGACC
TACCTACTAATCGTGAAAACTATATTCACAGGTGAGATAACTGTTAGTGTATTGGCGAGC
TAATTTTTACATACTGCTTTTTATACTGTGATTTGTGTGAATGGTGATGTAAAATTAAGG
AATAGTTTCTGCTAAAAAAAGTAAAATGTAGTTGTTTGGGAAAACCAGTCAGAAAAAAGA
GAAAACTTGCAAATCAAGTGTCCAGATTGTGGACATGTACAGATCAGGTTGTATTAAATC
TGTTGGTTTCAGCTTATGTTTGAGCTTTACTTTTAGTGATGCTTTTGTCCATGTGCTTTT
TTTCTTGGTGATTTTCTGTAGTTGGGATTTTCTTGGTGTCGCCTGGTAGCATTTTGAGTG
GTCCCTGGTTTAGTTAATAGTGGCTTTATCCCTAAATAAACTGAATTGTACTTTGTTATA
TGATGTAAAAAAAGACTTTTTAAAAAATACAGGAGTCGATAGCAGCAGTTGATGACGAGA
TGGCGCTCAGAAACGGCGTTGACGTAATTTAGGACGTGGAATCATAAGCGAAACAGCACA
CTGTTTGAATAAAGAGCGAGTCGGTATTTATATTTGTTTTTCTTTTGTCATGATTATTTG
ATATTTTAAGTTGTTCCAGCCAAGGCATTTTCTATGTCAGTTAGGGAGATTTTCTATTAG
GTGGTTTGTATTGTCTGGTTTCTGTCAGGAAGGTAGAGAGCTGTTTTGGAGGTAAACACG
TTTGAGTAACTCGAGTTTGATAACGTGTGAAACTGAGCAAAAGCAGTGATAAGTTTGGGG
TTACCATACCAAATAGTTTTCCCATTTCAAAAACTTGTAGGTTTTAGGAAAATAGTTAAC
CTGTAGCATTTGTGTTTACAGTTTACAGTTCCAGAAGTGCGTCGAAATGGATANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCAACAATTATGCACCGTCTACTT
CCATACTCATGCCTAAAATCAGGACAAACCCTGTCATCAACACTTCTTGACATAACTTGA
CTAGAGATGGCACTACCTAAATCCATCGCAAATACACAACTCATAGCGTCCATAAAAATC
TCCAATCAAAAAGGCCAAATTAAAATATACTTCATCCAATTTTCAACTTGCACCTACCAC
ATATCAAGCATTCAATATCCACTATAGTGGACAGCTCAAATATAATAAACTTTCGTCATC
ATAGAAAGTAGAAATTAACATATTTCTGAACTTCTAATTGTCTAGAATAAATCACACCAA
TAGTTAAAAAGTACCTTAGAAAAAATGAAAATTAAGCATCTCATATGACCTACCAAAGCT
TGTGAATGTAGTTAAATAAAGTGAAATGTATAGTGTTAAAGGAAAGTATCAGAAAGCAAT
GTAAATGAATAGAATCTAAAGAATTTAAAGTAAATTAAAAATAAAGAAAAAGAAGGACAA
AATAATAAATTGGAAATCAGCAAATATAAAATAAATTTGCAATACAGGAAAATCACTAAA
GTTGATTCTTTGAATATATTAATAAAACCAACAACAATATACTGGCATGAATTTTTTTTT
TTTTTTTTTGGAGGCACACTGTTTGAATAAAGAGCGAGTCGGTATTTATATTTGTTTTTC
TTTTGTCATGATTATTTGATATTTTAAGTTGTTCCAGCCAAGGCATTTTCTATGTCAGTT
AGGGAGATTTTCTATTAGGTGGTTTGTATTGTCTGGTTTCTGTCAGGAAGGTAGAGAGCT
GTTTTGGAGGTAAACACGTTTGAGTAACTCGAGTTTGATAACGTGTGAAACTGAGCAAAA
GCAGTGATAAGTTTGGGTTACCATACCAAATAGTTTTCCCATTGGAAAAAACTTGTAGGT
TTTAGAAAATAGTTAACCTTGTAGCATTTGTGTTTACAGTTTACAGTTCCAGAAGTGCGT
CGAAATGGATTACATAACTGTTCTTTTTGTTTTATCCCTGGTGTTTACATCTGTCCCAGG
CTGACACCTGCTCTTGGCTGGCCCACTTTGGTATGGGCTTTAATTTCACTACCCCAAACA
CAATACTGTCATCTGCTTTAGTAATGCTCAAGACGCCTGATACAAATCTCATTTTTGCAG
CCAGACAAGCCTTGAATCCTTTTGGCACTAACTGCAGAGGAAGATTTTTTTCTCTAGATA
TTGATTAGCAGCTAGTGCTCCAATTAGAAGCACGAACTGTAACCTTTATAAGTAAGCAGC
AGCTGATGGTTAACAAGTGGATCGTCATGTTCAGTAGTTTCATAAGCTATGACAAGTAAT
CTTATTGTTGATTTCTTTTCTTACACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAG
GTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTT
TCTACAATACTACAGTGGAGGAAATGCCCATGAATGTGGCTGACCTTATTTAATTCCTGG
GATGAGATAGTTTTGAATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATT
GTGCTTCTTTCTTTGGGAATATTTGAATCTTGTCTCGATGCTCATAACGGATCAGAAATA
CAGATTTTGATAGCAAAGCGACATTAGTCGTGAGCTCTTGTGAGGAAAGTCATTGGCTTT
ATCCTCTAGAGTTAGACTGTTGGGGTGGGTATAAAAAAAGATGGGGTCTGTAAAATCTTT
TCTTAGAAATTTATTTACTAGTTATGTAGAGATGGTTGTATTAGATGTTCTCTATCATTT
AATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAA
ACTAGCATATCTGCCTTTATTGTGTTATTAGCCTGAATAGTAAGGCCTTTAAAATGATTT
TTTTAAGAAAGTATTTGAATGCGTTTTGTTTGGTATTGTATTTATTCAATAAAGTATTTA
ATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCCCAGCAAGCAATCATATCTTAG
GTAGGGTTAAAACCCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATG
TTAAATAAATTGTATATTCACTTTAAAAAAAAATCCTTCAGTGGTTTTATTTTTATCATA
ATTCACATTTATAGAAGGCACTTTAACAATTCTGAGTTAACTGCTGCATCACAGTTGCAC
AAAGGCTAATCAGTTGCAGGTATTCATCAGCTCCATCAGCTAAGCATTTGTCAACTTCCT
ATGAGAAAGAAAAAGTAAAAAGTAAGGTTTGTTTTTCCATTGTACCCAAATACTCATTGA
CATAATGTGTACTTACAGCAAGTTTTTCTGTAATAATGGACTTGTGTTTATCAGAAAGGT
CGTCATTTTCTACAACTATATCATGAAGTTGGTTTATAAGCTGACTTGCTGCATGACCTT
CATCTATTAAGTCCTATAACAAAGGAAAATTAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 1132..1264, 1545..1684, 2461..2629, 2721..2830, 3056..3199, 3521..3658, 3903..3992, 4211..4290, 9208..9352
1001..1045, 1132..1264, 1545..1684, 2461..2629, 2721..2830, 3056..3199, 3521..3658, 3903..3992, 4211..4290, 9208..9349
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved