Tupaia_belangeri Locus EEF1B2
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri EEF1B2
Tupaia_belangeri
EEF1B2
GeneScaffold_146
SNORD51
1966..2043
4154
AGGCACCTCAACCTTCCCACCCAGACACGGCCTCACCTTGTCCTCGGAGCCGCGGGGGC
TGCTCTGATGAACTGTCTGGACCACACCGACACCTCCGAGACCCGGTCACTTATTCACTA
TGGCGGCCTCGGCGAACTCCGTCAGCCGGCCCCGCAGAACGGAAGGCCAGGAGGGACAAG
AAGCCTCAGATTCGACAATTTCCCACTTCGTTGGATTTCGGTAATTTCCGTCAGTCTGAC
AGAGGGCGGGACGGAGGTCACAGCCGCGAGGAGGAGGCGGGGAAGACAGAGGAGCCGCAG
TTCCGCCGGAAGTGGCCCGAGTCTCGAGGCCGAGCGTCTTCGATCATCTCCGGCGCTCCA
AGGGGCGGTTCCTGTAATCGTCGCGAGCCGTTGAGGTACAAATTTCAAATATGCGGCTCT
TATTAATTTCCTTTGGAACAACGAAAAAGTCCGCGGGCACCTTGTGGGCCACAGCATTCA
GAGCCCTTAGTTTTTACGTGGAGGAATGAGAATGCGGACATACTTTGACCTTTAACCTTC
GGCCGGGTGGCGAAGGGAACGCCTCCGTCTCTATATAAGGAATTTCCGGTGGATTCCGGG
TCGTTTTTTTTCTGGTAGCGCAGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCCATGTTCCTTCTTTAAGTTAGTGTTATCCAGTAGGTAGAGCAAGTCTGTT
AAGTGACAGGCATTCCTTGGAACAGCGCGGCGGTGACCCTAACAGGTGCCTCTGATCTTA
AGGAGATTAAGATTTAAAAAAGAAAAGAAAAAAAAAAGTAAAGTAACTTAGGTAACATGG
GTGATAAATGAACGAGTTCTCATTGGGTATGGCGTTTGTCATTGCTGAATTTGTGTCATT
TAGAGCTGTGTGTGTGTAATTGCTTTGGTATTGTTGTCAGGTATGTTCCATCACAAGCAG
ACGTGGCAGTATTTGAAGCAGTCTCCGGCCCACCGCCAGCCGACTTGTGTCATGCCCTCC
GTTGGTATAATCACATCAAGTCCTACGAGAAGGAAAAGGCCAGGTAGTTACCTTTGTGTT
TTTAATGACTGCTTTCCAAGCTTAATCAGGATAATCACATGACAGTTGGGCCCAGCTACC
TTAATTCTGATGGGATGTTGTAAGCTGAACTTCTTTGTCTTTAGAAGGCCAAGAGACTGA
AGCCCTCCATTTTTTCACAGAACAGGTAGAACGTGGACAACAGTTCAACTTTTCCCCACA
CTGCCCTGCCAATGTGCCTCAACCCTGACCTGGGGGGGCCACCTCTGGGGTGAGGTGAGA
GGGTGGCTCATTCATTCAGTCCCTGGCCATTCTTCTGAAACTGCCAACAAGGGTGAAAGT
TTGGGGAAGTGGACTCCAGTTCACTAAGAATGGAACTGAGCATACTTAATGAAATCTCAA
AGAGAAATGTTCATACTGAAAGAGTAAATCATAGTGAGTATTGAATGTAATGTCTCACGT
GCTAACGTTTGTTGGGTGAGGAGTTGAACATAACAAAAAATATTTACCTGGAAGTATAGT
AAAGGATAAATCATTAGTATAAAGGAATCTAGTGATAAACGCAAGTTCTTGTGTGTTGTC
TGGAAAGGGCGTTATTCTTAATAGTGATCAGATTTGAATTTTTTTCCAAGCCTGCCAGGA
GTGAAGAAAGCTTTGGGCAAGTATGGCCCTGCCAATGTGGAAGACACCACAGGAAGCGGA
GCCCCTGAGAGTAAAGATGATGATGACGACATTGATCTCTTTGGATCTGATGATGAGGAG
GTATGGCATCTTTATGCAGGAGAATAAATTGTGTGTAAGCACAAGGCTTGTAGCCAAGTT
GCTTGGATTTGCATCTTGGCTTCATCATGCCTTCTAAAAATCGTCACTGGTTACATGATG
AATAAAATCAAATCACCATCTTTCGGCTGAGGTCCTGATGGATTTGCTTTTTCTGATAAA
GCTGGTCTATTTTTGGATGACCCCCACACCAATGGTAAGCAGAGGCCAGCTTTGTGAAAT
ATATTTGATTTTTTTTTTGTATAGGAAAGTGAAGAAGCAAAGAGGCTAAGGGAAGAACGC
CTTGCACAGTATGAGTCAAAGAAAGCCAAAAGTAGGTCATTTTATAATTTGTGTTTACTT
AATGAGTTCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACTGAA
ATGAAGAAACATAACTGGATATTTAAATAGTGCTGAGTTTTTTATATTTTCTTTTTTAGA
TCCTGCACTAGTTACCAAGTCTTCCATCTTGTTAGATGTGAAGCCCTTGGGATGACGAGA
CAGACATGGCAAAATTAGAGGAGTGCGTCAGAAGCATTCAAGCAGATGGCTTGGTGTGGG
GCTCCTGTGAGTGTATTAGTCTTTGCCTATTTAAACTGGTATTTGTAATTTGCATATAAT
TTTATGTCATACCGATCTGTAAGTCTTTTCTAACCAAGATTTTCTTAATATTCTTTTTAG
CTAAATTAGTTCCAGTGGGATACGGAATTAAGAAACTTCAAATACAGTGTGTAGTTGCAG
ATGATAAGGTTGGAACAGACATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGC
AGTCCATGGATGTGGCTGCCTTCAACAAGATCTAAAATCCATTCTGGATTGTTGCACTTA
AATAAAAGCTTGAAGGATAATCCTTGGTCCTTGAGTTTATTCAGTGGGGGAGAGAGGATA
AATACGTCTCTTTTGTTGTGAGGGAAGGAATTGAATGGATATGTGATTTATAAATTAAAA
TGTCATTCAGCATGTTAGACATTTAGCAATTACTATATAACTATATTAGCAAAGTCCTCA
GCAACACATGATGATCCCATTTTTATTATTACAGTATTCTTGGGTTTTCTATTTACTTCA
TTTCAAAAGAAATCGGAGAGATAAAATTCTTTTTAAAATTTTGTGTCCAGAAGTTGCTAT
CTTAGATGATTAACCCTGTAGGTTTATAATAATTCAGGTCCTGGGCTTTGTTGGGCTTAC
GAAGTTATTTAGTATCCAAGCTGATTTTCCTCAAAATAGGAAATTTAAGAGTATACTAAA
TGATCCATGAGAGGCAGCAGATGGTGTAGCAGTTACGTTGTTGGACTCTCACATGGCTGA
CCATGTTTTGAATCCCAGACACAATGGCTTAAAACTTGACCCAGGCGTATGTGTTTGCAT
GTGTGCCCAAGATCCCAGAAGTGATTGCAGTGTGGCCATTTCCACTGAGGGGGTGATTTC
TCACTGTCTCCAAGGAGTGGATGGGCCTTAAGGCAAAAATGTCTTTTTTTTTTTTTTTTT
TTAAATGAATCCATGAGAAATGAGTTTACATATAAAACTCTTAGGACAATACTGGTCACA
TAGTGAATACTGAGAGTTGTAGGATCATTAGTGAAATCTTGGAAATGAATTAAACGCCAA
GACTAAAACTGAATTTCTCTTCTAGTTAAGAACAGTAGTTTAAGTGACTGGTGTGATTCA
TTGTAAGCATATTCCAGTTGTGATTAATTGTTGGCCAAAACACAATGACAAACCTCATTT
GAAACTACTAGGGCTGGTCCTATGACTTGGTGGGTAAGGAAATGATCTCATATAGCTGAT
GGCAGTCTAAAACCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1122, 1730..1859, 2124..2190, 2759..2804, 2806..2885, 3000..3154
1001..1122, 1730..1859, 2124..2190, 2759..2804, 2806..2885, 3000..3151
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved