Tupaia_belangeri Locus GNL3
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri GNL3
Tupaia_belangeri
GNL3
GeneScaffold_2981
SNORD19, SNORD19, SNORD69
3446..3521, 4337..4411, 5509..5583
8210
CAACAAAACGGAGACCCCGAGCGTGGGAGAAACGAAGAACTCTCCCCGACCTGTCACTG
GGACGGGGAATCAGAGAAACGTTGACAGCTTTGAAGCTGCCCCGGGAAGAGCGGGAGCGG
TCGGAACTCTCGCGCGCGTGATCTCTTGTCCCGCCCGCAGAGGGTGAAACACTCAGACTA
CCGCGAGTAGAAGTGGTCCCACCTCATACCAGTGCTGCGTTTTGAGGTGCCACCTCGGGG
GGTGGAGTGAGTAGTGGAAACTCGGCGGGCACCGCTGTTCCAACTGATATGGATTTCAAT
CAATAGGGTCCACGGCCAGGGTGGGTGTGAGAAACTGGCATGTCGCCAAGGTTTCTGGAT
TTTCTATATCTATTAACTTACGATCATGTGTATAACATCANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGGTATAAGATCCAATAAA
AGATAAATTGTGTGCTTAAGAGAGCTATCCCAAACACATTGCTGAAATATTGTTTAGCCT
CAGGAAATGCGGAGTGGTGGCCTGACCATTGCATAAGGAAGTTGGTAAACTTTGCTCAAC
ATGCTAATGTCTTCAGAGAGAGCCACTTAGTGACCTTTTTTTAAGTTGGGTGTCTTTTTG
TTTTTGCCATAGGGCACGTGCCAGAGAGAGACAGACAGACAAACTGAGGGAGAAAGTGAG
AAGTCACCCCCTAGGGATCCAGGACAGTCACACTGCAATCCCTTAGGAATTTTTTTTTTT
TTGGAGAGGTTTTCGCTATAGGGCGTATGCCCTCCCCAGACAGAGAGAGACCTAGAGACA
GAAAGCGAGAAATCACCCCCAGGGGGGATGGTCACGCCGCAATCCCTTCTCCTCCATTCT
CCTCTCTGGATCTTGGGCACGCACGCACATGCGCCCAGCATGAGTTTTAAGCCACCAGGT
CCTGTACGCGAACCACGGTCGACTACGTGGGAATCCAGCGACATAGCCATTATGCTAACT
GCTGGTCCCAATCCCTTAGAATTTGGGGCATGATGGACATGCACCTTACGTGATTTCAAG
CCACCAGGTCTGGGACTTGAATCTCAGTTGTCCATGTGGAAGTCCACTTCCTTAGCCACC
ATGCCACTTGCTAGCCCCTTCTTGCTGTTTTATACATATACATGAATGCTCTGTTTGATC
CCAATGAAAAGTTCCTGTACTTCTGTGATGTTTTACAGGCATAACTTTAACCAGATTGAT
TTCTCACTTCAGTAGAAAAATACTTACATGAACTGACAAAAATATTTTTATTATAATAGA
TTCGAGAGCACCATCGAAAATTGAGGAAAGAAGCTAAAAAACGGGGTCATAAGAAGCCTA
AGAAAGACCCAGGAGTTCCAAACAGTGCTCCCTTTAAGGAGGCTCTTCTTCGGGAAGCTG
AGCTGAGAAAACAGCGGGTAAGTTATGTTAGCATGTACTTTCAGTAAGTGGTGTAAGGTG
GGTATGTGTTTTCAAAGTAAAGTAAAAACACTAGCCACTGGATCATCCATGTCTCTTATG
GCCTGGACACAGCTTGAAGAACTCAAACAGCAGCAGAAACTCAACAGGCAGAAGGAACAA
GAAAAGAAAAGAAAAGTTGAAGCTAACCCTGATGTTAAGCCATCTGATGTGGAACCTGTG
AAGGAGGTATGATTGGGTCTCTAAATTAGAAATGAGTCTGTATGTAGAAAGTGAAGTACA
TCCACAGGACAGAGGCTGCTAACCCTCTTGGAAGGGGGAAAAAAGGAACTGGCACTCTTA
ATATACCATCTGTAGTCCCCGAAATTAGCTGTAGGAAATGGAGATACATATGACAACTGC
TGCTTATACTTCTAATTTCATGTCTTTTCCTTCCTTTCTTTATCCTCTAGGAATCCGAGC
AGTGCAAAACTAACAACAGAACCAAGTCTGTTAAACAGAGCCCAAAGAAGTTATATTGTC
AGGAACTTAAAAAGGTATCTTAGTCTAGGTTAGTGTCTAAAAACGGTATAACGAGGTTTT
TGAAAGACTAGTGTTTTCCCCTGGCCCAACACCCGCCTTGTAAAGGTGGAAATAGAGTTC
ACTGGAGCTGGAAGACTCCTTTAGCAAGTTAGCTTATTGTATTTTAGGCTTTTCTTGTTA
TGATTAGATGATGGGATACTATCTTCCATTTTAAACCTGTGCACTGTTGCCCGTAACCAC
GATTTATAAAAGCGGCTTTTGGTGTTAAAGTAACAAGTTGACATAGTTAAAAAATTTTTT
TTTAATAGAAGAAAATACACTAGCATGTAAGCAGTGTGAAAATAAGGATCTTTTAGAGTA
GTCTACTGAACTAAGTGAAGGAAGCCAAGAGCCGTGGTGTATTTGCTCCTCGACATTCCC
ATCCCTGGCACCCATTCTTCCAAGCTCACTTGTTTACTGGGGATTAAACCTGTCTCTCAG
CAGTTCTTGGCAAGGCCAAAAGAGCTATCAAACTACTTATGTTCAAACATCCCGGTATTT
CTGCTTTTGAAGTGCACATTGATCAGAAGCTGCTGAGCATGTGTTTTACTCTTGTGTGAG
AAATGATGAACATATCAACGTTCTTCATAACAAAGTGAAAATGTGAGCTCCCAGTCTGAG
CTCACCTCGGGGCCAGGTGGATACTGCCAGTATACTCGCATTGAGGTTGCTCCTAGAGCA
AGGGGTGATGATAGGATCCTTTCTTGTTTGACAGGTGATTGAAGCCTCAGATGTCGTGTT
AGAGGTACTGGATGCCAGAGATCCTCTTGGGTGCAGATGTCCTCAGGTAGAAGAAGCCAT
TGTCCAGAGTGGACAGAAAAAGTTAATACTTGTATTAAATAAATCAGGTGAGCAAGAGAG
ATACTTTGTCTTCCATATGCACTAGTGAGGTATGAGGAAGACATCTGAACAGTCTGATGA
CACTGAAGACTGATAAGATCCAACTCTGACCTCAGCAAAGCCAGAGCATGTATGCTCAGG
TTGCCAAAACAGTGCTGGGCAGTGGGGAGGTGGTGGTTTCTGCAAGAATTTTGACTGGTT
TCTTCTGTTTGCCATGCAATACTTAACCCTTTATCTTATTGAAGACCACAAGCTTCTATA
CCCAGGTAGTACGCTAGTATGCAGTATATCTCATGTAGGTAGTGTTAGCAGTGTGCCAAG
TTCCACATACCTGCAGTATTTTCAGGTGTGTGATAAATTAGTATGTGACATAATATTTAA
GTAAAATGCATTATCTGTCTGAAATTTGAGCAGGAAGAACAAGATAACCCAGAGCAGAGA
TGAACAAAGTAGATGTCAGGAACAGGATCTAACATTATTTTTGGGTTAGAAAACAAAGGG
CTGCTGAAAGCAAAGCTGTGAGATTACTAGGGTTGTAATCCAGAGGTTGACTCAGTTCTG
ACAGGGTGAGCAGTGGGGGGGAACTGAAATACTAAAGTGTGGATATAGTTTCCCCTTCCA
CCTAGTCCAGTGAAATCCTTCTGAGGGGGGAAAAAAAAAAAACCTAGAAAAAGCCAAAGC
ACAGTGACAGCTATAGTTTATCAGATTTTGCAAATTCATCTCAAGAAAATGACCATATGG
AAGCATGTGTCTTATTCCTGTCAGATCTGGTACCGAGAGAGAATTTGGAGAGCTGGCTAA
ATTATTTGAAGAAAGAATTGCCAACAGTGGTATTCAGAGCTTCGACACATCAGAAGGACA
AAAGGAGTAAAACCAAGGTACTGTACCTTTACTGCTAGTGGTGGGAAACGTGGTCCTTCC
TGATATTGAATATAGTTGAAATATGATGAGTGTACAAAATTTGATGTAAAAAATGAAAAA
TGTTAAGATCCAACTCTGATTTCAACTCAGGTTCATCTTAAAAAGCTGGGCTTTGTAGTC
AGATTGGTAAGTTTTCTTGATGAGTGCAGAATACTAAGTTAGACTAATTATTTGGAAGTT
TAACACACGAAGGTAACGAAGAAGCTGCTCCATTTAAGAGGTAAGTCTGCTTGGGAAAGG
AAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATACTTGACTAAGA
ATTCTTCTGGGTTAAATGACAGGGTATGGTGGTGGTGGTGTCTGAAATAAAAGGTTTACT
CAAACATCAGCATCATGCCCACCTTGTCAAACACATGCAGTTTGAAGGAAAGAAACTAAT
TCAAATATTTGCTGCCAGTTTCATATCTTTGTTAGGAGAGGGCACTGCTGGAGGTTAACT
TTTATAATGTCTTGGTTTGTTTAGTCATCTCCCTGTCCTTTATTACCTGTGCAAGAAATG
ATGCTAACTAAGATTGGTCTTAGTGTTGAAGTGAAGACGCTCAGATCCAACTCTGATCTT
GCTTTAAGTTTCCTGAAAACAAATGCTACAGAGAAAATTGTGTCATTATCAGCACATAAT
GCCTATGTCTGGATTTCTGTTCATTTGTAGGTTTCCCAAATGTGGGGAAAAGCAGCATCA
TCAATAGCTTAAAACAAGAAAGGATATGCAACGTTGGTGTATCCATGGGACTTACAAGGT
AAACTGAGCTATTTCATAACTGGAGTTATCTTGTTAATAGTAAATATTTTATCTTGGTTA
TCTCGAAGGACTTTTCTATTTAAAGCTTTTTTTTTTTTTATCACTTATTTAAAGAAAGCC
CAAGAGAGTAAAGCAGTGCTATGCTTGGGGAAGAATTAGCCACAATCTAGTTGAACTGCC
CACAATTCAGATAGAGGAAAGCTACACCAGGAAGTGATGTTTGAGTCTGGCCTTGAGAGA
TGAATGTAGTTTCCTAGCTAGAAGGGATATTAATGGCAGAAGGACGCACATGCTTAGGTA
GATAGATAGACAGGCAGCATCAGTAGTTTCCCTTTAGAGCATCTTTGATAACATGAGCAA
TGATGATAAACTGGATCTGACTGACTGTGCTGAGTTTGTTCAATCCAACCCTGAGCTTCA
TGTTCTTTGTCTTGCCCTCGAAAGAAAACAGTGCCCTCCCATCAATTGTTTTTTTCTTTT
CAGGAGCATGCAGGTTGTCCCCTTGGACAAACAGATTACAGTCATAGACAGCCCATGCCT
CATTGTCTCTCCACTTAACTCCTCCGCTGCACTTGCTCTACGAAGTCCAGCGAGTATTGA
AGCAGTAAGGCCAGTAGAGGCTGCTAGTGCCATCCTTTCCCAGGCTGACACTCGACAGGT
ACAAGAACCCCTGCCCTTGAACTCTGCCACCGTTTTCTCTTTTCGTCATAAGCAGTTTAA
GCAGAAAATGTGCAAGTTTTTTTACATTTGCTTTGTTACAGGTAGTACTGAAATACAATG
TCCCAGACTATAAGAATTCACTGGAGTTTCTCACTATGCTTGCTCAGAGAAGAGGTCTGC
ACCAAAAAGGGGGAAGCCCAAATGTTGAACGTGCTGCTAAACTGCTATGGTCTGAGTGGA
CAGGGTAAGGCTTCTTTATGTTGACATTTTGGGACCACAGAATGAAGGAACTGGGTTTTG
ACAGATCTTGGTTTTAATTTTAGTGCCTCTTTAGGTTACTATTGCCATGCCCCCACATCC
TGGACTCCTCCTCCACATCTTAATGAGAGTATCATGGCAGACATGAAATGGGGCTTTAAT
CTGGAAGAACTGGAAAAAAACAACGCACACAGCATACAAGGTGAGTGAGACTGTCAGTGC
CTCTCGTCACTGGCTGATAAGGACTGTATCCATTTACTTGGACTTACTTTCTTTCCTAGC
CATCAGAGGTCCTCGTTTAGCCAATAGCATCCTTTTCCAGTCCCTGGGTCTGACAAACGG
GGTAACAGAGGAAAAGGATATACCTGAAGGATTGCCAAAACCAAAACAGAAGAAACAGGA
GGAAAAGGAGGAGGACGAAGACATGAACAGTGACCAGGAAAGTGTGGATGCAGAAGTGGA
CGTAAGTATACTCTTCATGAGTTATTTGAAGCTGAAGTGAGTTTTCCAACACTTTAATGT
ATAATGAATGGGAAGGTGCTGAAGGTAGAAGTTAAATATTTTATAATTGATTGGAATAAG
TTGCATACAGTTCAGGTATTTGAGGCTTATGATCATTGGCCTTAATTTTGTGCCTCCCCT
TATATGTACAGGAGGTATTGTCCCCATACACACACACCCCCAATGGGGGTGTATTTCATG
ACCTCCAGTGGATGCCTGAAACCTCAGATGGTATTAAATCCTATTTGTGTTTAGGTTTTT
TCCTATATGCACATACCTAGGTGAAGTTTAATTTTGTAGACTTGTTTTCAGGTTTATAAT
TTCTTAGATACATGAGCAGAAAAGGGTTGCTAATCCAATGCCATCTCTCTCTGTCCTGTA
GGAGAGGGCTTCAAACACATCCCCTGCAGAAGAGACGTGGGTGGCACAGCCTGAAGAGTC
CGTACCAGGTGAGTCTAGGAGGAGTTTTTCTAACGACGCAGCTTAATGTAGAATCACATA
TTTTCTTAAATAAACAAATAAAACCTTGCTTTATATTTTCCTATGTAGGTAACCAGTCTG
GAAGATCTTTTATCTTGGATAAAGTGACTGAAGAGGATGATGTTTATGACTTTAGTACAG
ATTATGTATAACACAACCATGTCTACTTATAAAGGGTATTTAACATTTTAAACAGACTGC
TACTGTTAAACTGTCCTATGTGTATAACATAGTTGTTTGTTACAGTATGATAAAAGCTAT
GTGAATTCTGTAAATACATATCCATGGTGTCATTTAAACAGGCAATTTACAGCGTGTGCA
GATTCTATAAAAAAGACTCACCTCTATAGTGCAAGAAGAACGGTATCAAGTATATAATTA
TCTGGAAATAAAAAATGAGCTACTAGAAAACGTGGTTTTATTTAAAGATCAGGCCACAAG
TTACAAAATTAGATCCAAACAGCAGTCTTGAACTAGCTGCACCAGCCACCTGGACTGGCA
CTAGCTATGTCAGTGCAGCGGTTCATTCTGGCCATTCGGCATTGGAGTAAGACACTCTGT
GAGGCAGGTGCAGACACATTTATGTTCTATCTGGGAGGCTGACTTCCAGACAGACCAGTC
TGTCATTTTTGCCCAACTGAAACACACTTTTTTTTTTTTTTTTTCCAACTGAAACACTCT
TGTTCCATGGGTTGCTGCAGGTAGACATTGAAGCCTAGCAACTGTTACTTCCCACACATA
CTGTTTCCAGGATTTCCTGAGAAATGTTTTTTAAATGGCTGAGTGCAGTGCTCACCAGAG
AGAGAACAACCCCTCCTGGTGTTGCTTTATCTCTGTTTTCTCACTTCTCTATCCCTTTAA
GATTCTCTGTACATGTGTGCCCAGAATGTTACTCAAGATACCAGGGCAGGGATTCAAACG
TCAGTTGTCCATGAGATCCTGCTTTCTAGGCGCAATACCTAATTGCTGTGCTACAGGGCT
GTCCTGAGAAATATTTGGTTTTAATTCTGTTTTACTTTATGTTTGAAATCTCTGTGTGTC
TTCGGAGTAGGCTGAATTTGCCTGTTGGATCTGGAATATACCACTTTTCCCAAACATCAA
TATAAGCAGCAGTTCTTCCCCATGGCTTAAAGTGTCCATTCCAATGGAGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1019..1021, 1859..1996, 2112..2225, 2450..2533, 3274..3406, 4164..4276, 4503..4520, 4523..4540, 4544..4560, 4565..4632, 5070..5157, 5643..5817, 5921..6063, 6143..6279, 6359..6540, 6961..7027, 7128..7210
1001..1015, 1019..1021, 1859..1996, 2112..2225, 2450..2533, 3274..3406, 4164..4276, 4503..4520, 4523..4540, 4544..4560, 4565..4632, 5070..5157, 5643..5817, 5921..6063, 6143..6279, 6359..6540, 6961..7027, 7128..7207
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved