Tupaia_belangeri Locus UQCRC2
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri UQCRC2
Tupaia_belangeri
UQCRC2
GeneScaffold_2789
SNORA57
25569..25716
35388
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
GCAGGGGCCCGCCTCAACTTTCAGCACAGTGCCTGACCCAGGCACCGTTAGTTAACACGC
GGCTGTTGGGGTGAACTCTATTCTCTCAAATTGTCATAATGACTACCTTTCTCAACACGC
AGGTTTCGAGTCGCAGACACACCCTTACCATTCAGAACATTTATTTTGCTTACAAAGAAA
CTACAGGTCTTATTTTCTGTCATTCCAGCCTAGGCTGTAGATTCATGGGCGCAGGAGCCC
TTAGGTGTGACGATGCCCCGCTGTTTTAGGGGGGACGGCAGAGAACGCGTTGGAAAAGAC
CTGCGCTCTCACCGAGCTAATGACGTAGTGAGGATTTCAACCGAGGAGAGGGAGTCACGG
CTGTATTCGAGGTCCAAAACCTTCGCACGGAGCAGACAGGGAAGAACCGGAAACCACTGT
TTCCAGGGCCTGGAGAAGGACGCAGAGGGGCGTGGAGTCCGGGAAAGGCGCCGTTCCATT
GGGCCATCGAGGTCGGGAGAATCCAAAGGGCGGGGGGGATAAAGGGCGGTCGAGGACGCA
GCTAGAAAAGGACTCGAGTGGCTACTCAGGCTAGGAAAAGACCCCCATTAGGTCCTGCAC
ATTTACTTACGAAATGACGCACCTCGCGCTCCCAGGTCTCGGAGGAACTGCACTAGCGCC
CTGGGCAGGGAGCAGTAGAGTGCAGTTCGTATAGAGAGGCCCCTCACGAAAGGGGCGTGG
GAAAGCGCGCCCGCGGGGAGCGCTGGGAAGCTCCGGTCCTCCGCCACCATCTTGCTTTCC
TTCAAGCCGGCTGTGACCGAGGGTCAGAGCTGTCCTGGGCCATGAAGCTACTGACGAGAG
CCGGGACCTTCTCGGTGAGCACCGCGGGCGGGTTTGGGGAAGGGATGAGGACAGTCTTTT
GTTAGCAGGATGATACGGACCGGAGGTGCCTGGTTTGCAGTCCCGAGCCTTGGACTTCCG
TCTGTCCTTCACCTGAACCCTGCGAGCGAAGCGGGCTGCCGGCCGGGCCAGGCTCTGGGC
GGCCCGCTCGTGCTGTGGGCAGGAGAGCCCTGACGTCCGGAAGCCTGAAGAGACGGACAG
GACTCGGGAGCGGAGGGGAAGCGACTCCGTGGAGAGGCTGCCGAAGGTCACTCCTGCAGA
GGAGACAGCTAGCGCCGGGGAGGGCGGGAGATCCAGCCCCCTGCCAGCCTCATCGGGAGG
GGCTTCTGCTCCTCGGTTTGTTGCGGAACATGTTTCCCCAGCAGTTAGTGGGTTTGCGGA
AAAAAGTATTCGGTATGAGTTAGTGTCGGGTACGGCGCTTATCACAGTGCCTCGGGCTTT
ATCGCTAGTTATTATGGTGTCCCGCGGTATAACCGGTGCATTTCTCGGTCTGGAGTTGAT
TTCGGGGTGGTGGTTGGGCTGCTCTCAGAAGTTGCTTAGCATAAAAGCTCCCCCTGCCAG
CCCTAATTAAACTTAAACGTCGCTCAAGCGTCAGTGTTATTTAACATGACTGAGGAGGGG
AAAGAGGGGAATTTTTCTTCATTCCAGTGTGAGACGACTTGAACAGTAGCAGGGTCTGAG
ACATTCGGGCTAACAACTTGGGGGAGGGTGGTTCTGGGATCTAAGGCGCGTGGGGAGGTA
TATGCATCTGTGGACATAAACAGCACCCTACGATGAAGAATTGCCCTGCCTAAAATGCCA
ATGCCTTGAGGAAAAAATGGAATTTCCCTGTGCTTTATGTTTAAGCAGATGGACTGCGGA
GTGTGCAGTTCCATAAATCCCAGACTGTAGTGGTGTGGCCCTTCCAGGCCTACCTAGACA
AACCAATGATTAACAGCCCTTTTGAGTGCAGCCTAGTTAGACCCCCAAATCGCCTCCATT
CCATCTACCTATAGAAAAAAAGAACTCAGGGCAGGTGGCATGGTGGTTATGGCACTGGAT
CCCACGTGGGCGACTCCAGGGTTCTGTACTGGGCACCTTAAAGACCATGTCAGGCATGTG
CGTTTGAGTGCCCAAATCCTGGGAGGAGAATGGGAGTGAAGGGATTGTGGTGTGGCTATC
CCTCCTGGGAGGTGATTTTTCACTTTCCCTCTCACTGTCTCTGAGCCCCTCCTGGAGCAC
ATGCGCCCTAAGGCAAAAATCTCTAAAATAAATAAATAAAAATGAGAGGACCAAAGTAAA
CAGTCAAGTTGAAAGCAAGTGTTTGTGCTTCTGTTGTAATTGAAGCACTTAGTTTCAATG
AAAATAAGCATACATACTTTGTTACCAAAACAAAATACTTGGGGCCAGCCCCACATGCCT
AGTAGTTAAAGAGATCCAGGTTCCACCATGGTTGAATCCTGGCCCAGTGGCTTGAGAAAC
CCACCGAGGAGGCACACATGCCTGATGGAGAAATGGAGGAAAATTAATTGTGGCATGACT
ACACCCTTGGGGGAGGAGGGTGTCTTTCTCCCTTTCTCTCTCTGTCCAGAGTATACACCC
TTTGGTAATTAAAAAAACCTTCAATAATTGTAATAATTATCAGAATAATTCCAGACCTGC
GGGGACAGCAGGTGGTGTTTTGGTTAAGGGCGCTGGACTCCCATGTGGCCAACCACAGTT
TGGGTCTGGGACCTGGCGGCTTGCTTTCTCACTCTCTCTCTCGCTCTTCCTTTCACTCCG
TCAAGATAATTGTGGACCTGAATGGGGCATATAAGAAATGACCAAAGTGTCACTATTTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAACATGAGGCTCTGAGAAAGCTGTG
TATTGTCTTCTAAAGTCATGACATGATGAGAGATAGTCATACATAGGAAAATAACTAAGT
AGGTGAGACTCTGGGCAGATAAAGGAAGCATTAGTACTGAAATCTATAGAAGAATTTGAA
TGTGGCAATCCAACACAAAAAAAATTCTAAGCACTAGAGCTAGAAGAAACCACTTGAAAC
TTTAATAAGATATTTTAAATTTAAGAGAAAATACATTTCTTTATATAGTAAAACAAAGAG
GTTTAAGAATGGCTTGGGGGGACCAGCAGTTAGCGTAATGGCTATGTCGCTGGACTCTCA
CGTAGTCGACCGCAGTTCATGTCCCGGACCCAGTGACTTAAAAATCACGCCAGTCGTGTG
TGCGTATGTGCACAAGATCCCGAGAGGAGAATGGAGGAGAAGGGATTGCGGTGTGGCCAT
CCCTCCTGGGGGGTGATTTCTCGCTTTCTGTATCTCTGTGTGTGTCTGGCCAACGCATGC
GCCCTATAGCAAAAAACCTCTCCAAAAAAAAAAATAAAAAAGAATGGCTTGGGTAGGAGC
TAACAGATGGTGAAGTGCTTACATCACTGGACTCACAAGGGGGTTTAGGGTTAGGGTTGA
TGGCCAACCGTGGTTTGAGTTCCAAACCCAGTGGCTTCAAACTCAAGCCAGGTGCATGTG
CGTGCATGCCAAGGTCCTGGAAGGAGAATAGAAGAGAAAGGATTGCAGTGTGGTCATCAT
CCTTGGGGGGTGATTTCTTGGCTGTCTCTCTGGTGAGCCCACATGCCCTTTAGCAAAAAA
CTCGCCAGAAAAAAAAAAAAATGGCTTGGATAAACTGGTAGGTTAATAAATCCACAGTAG
ATATTATGCAAAATGGAGGCTGTTACAGTCAGTACCATTCTTATAAGAAATGTGTAATCT
TTTTGTGTTTAGAGATTTTATTCCCTCAAAGTTGCCCCCAAAGCGAAAGCCACAGCTGCG
CCTACTGGAGCTCTTCCACATCCTCAGGACCTTGAGGTGAGTCCCACTAAGCTGCTCACT
GAAACCCACACAGACCCTACTCTTCTTGGTAATAAAAAGACTTTAATCAATACATCTGCT
TTATTTCAACACAGTTTACCAAATTACCTAATGGCTTAGTGATTGCTTCTCTGGAAAACT
ATGCTCCTGCGTCAAGAATTGGATTGTTCATTAAAGCAGGCAGTAGATATGAGGACTCCA
ACAATTTGGGAACCTCTCATTTGCTCCGTCTTGCATCCAATTTGGTAAGTATCTTTACTA
CCTTGTTGTCTGGAAATGCTTTGGTATCTTGATCCATGAAACAGATGACTTAAACCAAAG
AAATTTCAGGCCGGCTCTGTGGCACAGCAACAATGCACTGCTTGAGTGAAACCAGGTCTC
ACATGGCAATCACAGCAAATCCTGGCCCAGCTCGAACCTCACCAGGCATTGTGTGCAAGT
GCTCCAGGTCCAACAGGCTAGAGGACTGGAGAAAGGGGATCGCAGCAAGACCCAGACCCT
GCATGAGATGTTCATGTCTGTCTCACTTCCCATTAGTCTCACATGCATACATTCTATCAT
GAATAAAGAAAAATAAGAAAAAAGTTATTTGTCATGGTTCTAGAGGCAGGAGTCAAAGTC
AGGGTGTCAGTAGGGCCATGTTCCCTTTGAAAGCTCTAAAGTAGAATACTTCCTTGCCTC
TTTCTAGCCTTGGGTAGTTGCCAGCAATGTATTTTTTTTAGGAATTGTTTATTTTAGTTT
TATTTATTCATTCATTTATTTATTTTAGTTAGACCAGAGAGAGACACAAAGAGAAAGTGG
GAAAGCAAGTCACCAGGTTCGGCTGACTGGTCAGCCATGTGGGAGTGTCCAGCGCCTTAA
CCACCACGCCACCTGCTAGCCCCAACCATCAATCTTTTGTTCCTTGACTTGCTGCCACCT
CACTTCAGTCTCTTATCCATTGACACATAGCCTTCCTTCAGTCTGTGTCCTTGTGTCCAG
ATTTGTCTCTTAGGAGAACAGCAGTCATATAGGATTTATGGCTCAGCCCAATCTATATGA
ACTCATCTTAAGTACTTAAGTCTCTGAAAAGACCCTATTTACAAATAAAGTCACATTCTG
GCCAGGCGTGTATTTGGGAGACAGGGGGAAACAACCCAGTCCAGCCCCTCAATATAAATG
AGAAACATAAGATATTTTGCCACAGAAAAGTATCACCTTGATATCTGGCTAAAAGTTGTT
ATTAGAACATAAATGTCAGGGGGAGCGGGGTACCAAAAATCAAAAGAAAATTACTCCTTT
CCCCTATGTAAGTTTCAGAGTAGAGTAATAAATCCAGTTGGCTTGTATTTGATAATGGAA
TTATTACTGTACTTTATATAAATATCTATACTTGCGCTTTTGTTGAACCTTACTTTGTAA
TTCCTACCTAAAAATAATTAGTTCTCATGTTAAATTTAAAAGAATTAATCATTTATTAGA
ATTTAATTCAAGTTTTAGATGATGAATATGTAGGCTTTTGTTTTATTATTATTGTACTCT
TTTATACATTTTTTTTCCCCCAAAGAAATTGGTTGGTTATAACAAAGATAAGAAAGCTTC
TTATGGTTCACATAACTTGACTATTTACTTAGTCAAGTTCTTTCTAAATCGGCTAATGGC
AATGAGACAGTGATTTTGATTGGAAAACTTAGGATAAAAAACTAAGAAAATGGGGCCGGC
AGGTGGCCTGGTGGTTAAGGGCGCTGGACTCCCACATGGCCAACTGCAGTTCAAGTCCCG
GACCCAGTGACTTGCTTTCTCACTCCCCCACCACCACTCTGTCCCTCTTTGGTCAAATAT
AAATAAAATAAATAAATAAAATGAAATGAAATAATTCTTTAAAAAAAAACAAACTAAGAA
AATTATGCTTTTTTTTTTTTCCTAGACCACAAAAGGAGCATCATCTTTCAAGATAACCCG
TGGAATTGAAGCAGTTGGTGGTAACTTAAGGTTTGTTAAGTAATAGGGAGTAAATAGTGA
AAAATGCCAATAGGTATTTAGTTGTAAGGGGACTTTTTATTTCTTTTCAAGGTGGTTGAG
AATTTCTTTTTTTGTTTGTTTTAATAGAGATTTATTGCTATAGGGTGCGTGCAGTCACCA
GAGAGACAGAAAACAAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTG
TATTCCTGTCCTTTGGTAGATACCCAGGAGTGACATTGATGGATGGCATGGTAGTTCTAC
TTGTAGGTGTTTGAGGAATCACCATATTGTTTGCCACAGTGACTTTTCAGGATTTTCCTC
TCCATCCATCACAGTAAGATGGCTATATTATTATTTTTCTTTCTGGCAAACATTGCGAAG
TAAGAGGCATATTTCTTTTTCTTTTTCTTTTTTTTTTTGGAGAGGTTTTTGCTATAGGGC
GCATACGGTCGCCAGACAGACAGAGAGACACAGAGAGACAGAAAGCGAGAAATCACTCCC
CAGGGGTGATGGCCATGCTGCAATCCCTTCCCCTCCGTTCTCCTCTCAGGATCTTAGGCA
CGCACGCACACGCTCCCGGCGTGAGTTTTAAGCCACCGGGTCCGGGACGCGGCAAGCGGT
CGACTACGTGTGAGTCCAGTGGTGTAACCATTATACCATCTGCTGGGCCCAGTTGAGAAT
TTCTTAATTGAGCACAAGAAGGAAAAGACTGATGTCTTTGACTACATCAAAATGTGAAAC
AACTTTATGACTTCAAGTAAAAATTTAAGAAACTGACTACATAGGTATCTTTAATACACA
TAACACACAGGATTACTATTTGGAAAAATAAGAACTACAAATCAGGATAGGAACAGGCTA
TTCCCAGAAAAAGAAGCCAGAAACCACCCATCATTTTTTTTTAATATATCACGTATTGGC
AGTGATAAGGAAAATGGAGAATCTCTTTCTGCTGGTGGGAGTACAAAGTCATATAGCCAC
TCAGAGAAGAATCAAGAAATATTGAATAATATTGAAAAAAAATTTTTTCTTAACTCACAT
GCACAGAAACATTCTTCTTTATTTTAAAGACTGGAAACTTTTTTTGTTTTTTGGGGGTTT
TTTTTTTGCCATAGGTCATGTGTGCTTACCAGAGGAAGACAAAGAGGGAAAGTGAGAAAT
CGCCCCTACCACCACCACCTGGAGGGAGATGGCTGTACCACAATCTCTTCTCCATTCTCT
CAGGATTCGGGGCACACATGCATACATGCCTGGCATGATTTTCAAGGTTCCAGGTTCAGG
GCTCAAATCATGGTTGGCCATGTGGGAATCTAGCACCTTAACCACCATACCACCTGCTGG
CCCCAAGACTGGGAAGTGATTAAATGTCCATTTTTAGGGAAATATATAAAGAAAGTAAAA
GTTGTGTGATGGGACTACTTTACAATTAAGGAATGAACTAGGTCTGTATCAGTCTAACAG
CGCTTAAAAAAATTATGTGAAAAAAGTTTCACGATTATTTTTAAGGTATGATGTATTATT
TTTTAAGCAAAAGAATACTGTGTATCGCTTATAATTCCAGTTATTTCTAGAGTGGGAGAA
AGTAAAGAATTATCTTGGGGGAAGTACAAAGAGATCCTCAACACTATTTGCCATTTTTAG
AAACTATGGTATATTGACATAAAATGTTTTCTTTCTTCAGTGTACAGCTCTGACATTAAG
TGACAGCAAACATTACCACCATCGATCCCCAGAATTTCTCATCTTTCCCAGGCGAAACTC
TGTACTCACTAAACAATGGTTCCCCATTCCCTCCCCCAGCCTCTGGCAACCACCTTTGTT
TTTTTGTCTCTGTGATTTGAGTACTCTAGGTACCTCACAGAACTGGAGTCCTACAATATT
TGTTCTTTGGTGACTGCTTTATTTCACCTAACATAATGCCCTCAATATTCATTTTGTTGT
AGGCATGTGTTAGAACATCATTCCTTTTTAAAGTTGAATTATATGCCACTTTTTGAATAT
TTTCAAGTTTTAGATGATGACCATGTGGGGTTTTGTTACTATTGGACTCTTATACCTCAA
AAATGTCCTTTCCAGGGACCAGCAGTTGCGTAATGACTATGTCGCTGGACTCCAATGTAG
TTGACCGCTGTTCAAGTCCCAGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
AAAAAAAAAAAATGTCCTTTCCAAGGAAATTGATTGGTAATGACAAAGAAGATATAAAGG
AGTCCTTATTCTTCTGGTTCAGATTACTTACCGTAATTTATCTCTCATTCAGTGTGACTG
CGACACGGGAAAACATGGCTTACACTGTAGAATGCCTGCGGGATGACGTGTGAGTATCTG
CATGCATTTAGGACATTTGCCTTTAAAGAAACAGCTGCTCACGTCTTGTCTTTGTAAAGT
TGTCCTTACAGTCCCAAGCTTTGGTTTTGGATTATTCACTAACTTTGTGCTTGTAACATT
GTGTTTACATTAAGACTTAAAGTTTAATATCAAGACTATTCCAGTTATGTTGAATATTGG
TTTTAAATTTTTGACTTCGAACTCTTATCTTGATGTCCTCTAGTGATATTCTGATGGAGT
TCCTGCTCAATGTCACCACAGCACCAGAATTTCGTCGATGGGAAGTGGCTGCTCTTCAGT
CTCAGCTAAGGGTTGACAAAGCTGTGGCTTTTCAGAATCCACAGGCCCGTAAGCACATTT
CCTGGTTTCCTTAAGTGATTTCTAAGATACTGGCTTTTTGAGAAGATAAATGTGTAGAGG
AAAAAAGATGCTGTTGAAATTTTTTTCTATTTGGGTTTGAAATATCTTTGTTTTTGTTTT
TAATATTTATTTATTTATTATTTATTTTTGACCAGAGAGGGACAGAGAGAGAGAGAAAGT
GAGAAAGCAAGCGCCAGGTCTGAGACTCGAACTGTGATGGGCCATGTGGGAGTCCAGCGC
ACCTATCCACCATGCCACCTGCCAGCCCCTGAAATATCTTTTTTTTTAAATGTGCTTAAT
TGTTTAAATACTAGAGGGACTTCAAAATGTCCATGGAGCAAGCCTAAGTAGCATAGGCCA
TAGCATGCTGAACCGTAGTGATGGAAACTACGTGGCCAACTGCAGGTTCAGATCCCAGAT
CCCCAGAACTGCCACATATGCACAGGTGTCCCAGATTCTGATGAACTAGAGAGCTGGGGA
AAGGGAACCGTGGCATGCCGAGACCCTGTTAAAGGTGCCTCCCCTACCCTCTTCTATATG
TACATGTGTGCTTGCAGTATCTTGAATAAAATAAAGAAACTTTAAGAGAAAAGTGTTTAT
AGAAAAGCAGAATTAATGTAAGTATGAGTTTATTTGATGCAAAAAATATTTTGAAATCCA
GATACGGGGTTCTCATAATACATATTTTACATTAATTTTTCAAAGCTTCCTTTTATATTT
TGTTTTTAAACATTTACATTTATTGTTGATTAGTTTTTATGTTTTATGGTAAGTTGCCTC
ATCGAATTCGAGATATTTTTCCTGTTTCCTTTCANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTATCCCTTCT
CCTCCGTTCTCCTCTCGGGATCTTGGGCACACACGCACATTCACCCAGCATGAGTTTTAA
GCCACTGGGTCCGTGATGCAAACCACGGTCGACTACATGGGAGTCCAGCAACATAGCCAT
TACACTAAATGCTGGTCCCAATACAGAGACATTAAAATCCCCACTTCATCATTCAATAAC
TTTTCATTATTTTCCTGATCAATATTATTATTATTCCAATAATTTTTTTAACCAGTCAAT
CACTATTTCTCATTTTGCTTGTAAAAAGACTTTGCCCGTCATGAAATACTTCTCAGACCA
ATCCAGCTGAGAATACTATACACGTCATCATCAACAGGTAATAAGCCATATCTGTTTCCC
ACTAACTTCCTGCCTCTCTATTTGTTCTCTTGCTATCTTTCTCTATCCTCTTCTGCTGTT
CCTGAGACCGAAGAAAACCGCAGTCATGCTGTGATCGAGGGCCAGGCCCTCTGAGTCTCC
TAGCTACAGAAGTCCAGAGAGGCATTGTTTTTAAGTTTATTTATTATTTATTTCCTCCAT
GAGTGAAAGAGTGAGACTGAAACAGAGACAGCCCTCAAACAGGGACTTGATACAATCCAA
CCCCAGCTGGGCACACACATGCCTGGCGTACTCAGAAAGGTCTCCAGAGTGAGCCTAGAA
CCTTCCCATGTGGATCAATCTCAGAGTCTCACAACACATTTTATACTGTGCCACCATTCA
GTCCCCAGAAGCTCCCAGTTTTGACTGGAGAATAAAATGGATTTGTGTCTCCTAATTCAT
TTACTTTAAATACCATCTTAGAAATGCTTTGATTTTCAATGTGATTTAAAAAAAAAAAAT
CTTAGGTAAGCTAAGAAACTGAATGAATTCCTTACATGGGATCGCCCTGGAAGAAAAACA
CAAGATTGGGACCAGCAGTTAGTATAATGGCTATGTCACTGGACTCCCATGTAGTTGACC
GTGGTTTGAGTCCCAAACCTGGTGGCTTAAACCCACACTAGGCGCATGTGCGTGCATGCC
CAAGATCCCAGGAAAAAGGATTGTGGTGTGGCCATCCTCCCTGGGAGGTTATTTCTCCCC
TTCTGTCTCTCTGTCTCTCTCTGTCTTTCTGGCGAGCACAAGCGCCCTATAGCAAAAAAA
TACCTCTCAAAAAAAAAATTTTAAATGAGGACTTTTTCAGTATTCATATTTTTATGTTCA
CATAATGTTTATCTATCTAATCTGGCCACGTACAACTGGCAAAAAAAATCTGGAAACAAG
CAGTGCTGACTCGGATATCACACAATTCCTGGTGGGTGCAGAAGTGGGTAGACCTGGGAA
CCAGCAGTTAGCGTAATGGCTATGTCGCTGGACTCCCACGTAGTCGACCGCGGTTCGTGT
CCCGGACCCGGTGGCTTAAAACTCACGCCGGGCGCGTGTGTGTGCGTGCCCAAGATCCCG
AGAGGAGAATGGAGGAGAAGGGATTGCGGCGTGACCATCCCCCCTGGGGGGTGATTTCTC
GCTTTCTGTCTCTATGTCTCTCTCTGTCTGTCTGGCGAGCGCACGCGCCCTACAGTGAAA
ATCTCTCAAAAAAAAAAAAAAAAAAAAACAGAAGTGGGTAGACCAGAAGTAGGTGGCAAA
CTGCAGGGGCTCGACCTGGAATGGGCTTTCTCAGAGTCCAGGCCTATCAACAGAAGGTCC
CCTGGAAGTGTCTGAAAGATGGTACTTCATTCATGTTGCTAGTGTTATTTCATGGTGACA
CTTTGTGTCACGGAAGAGTGTGATCTTTATTGCTCTTTATCAAAGAAATTAATAGAATGT
GAAATTGTTGAAATGATGACTCTCACATCCAGAGTCATTGAGCTCCAGCCCTCATTGTTT
CAGTTGCTGTAGAGGTTCCTGGCTGGGGTTTCTGCCCCCAGGTTTATAGCTTTGGTCCAT
CTCCATCATTACCATCACAGTGACCCTTCTAATGTGAAAATCTGGTGGGAATCTTGTAAA
GGCTCTTCGTTGCCTCTGAGGTTAGCACATGTGGTCTTTCATGATCTGACCCCACTCTTG
CTCTACCGTCATCCTTCCCAGCTGTGGTTCCCTTTCAAATCACAGTATTGTCATACTTTA
AGCCTCAATTTTGTCTGAGTCCTCTGCTGAAATACTGTTTGCAAATCATTCACCTGGGGG
ACACCTAGTCACTCATCCCAGGTTACACTTCTGTTCCTGTTCATCTTTTCCAGTTCCCAC
AGCCTTCCCTTGTGCCGCTAGTAACTTTTGACATAATACTTTATTTCACAGTTTTCCTCT
CAACATGTTCAGGCATTGCAGCCTCATTTCTGTATTTATAGCACCTGGCACAGTGCCTGT
CCTCGGGAGGTGGTCCATTGAGCAGGGCAAGGAAGCACACATCAAGCAAAGGCAGAGCAG
GGATGCAGGGACATTGAGAGGAAGCACTTGGCCCCTGGCAGCTCATAAGATGACCCAAAG
CCAACATTTGCATATCTCCTCTTACCCTGACAGCTCCCTCACTGCCTAGAGAGGGAACCT
ACAAGTAAGTGAAATTCAGATTAAACAGCTTGTCCAAGGCTTCGGGTAGAACCATAACTA
GAGTCAGGCATCCTGGAACCCAGGCCATTAGACTTTTCAGGTGATACCTGATGGTAGATT
AAAGTGAGAGAATAGTTTGATGGGCTCTAGACCTCTTCATATTTGAATGCCATGAGAGAA
CCAAATTTGTATAGGCTGGTTGATTTTTTTTCTTTTTAAGAGAGATTTTTTGCTATAGGA
CATGTGCACTCATTGGAAAGACAGAGAGAAACAGACAGAAAGTGAGAAATTACCTCCCCA
CTGGGGATGGCCATACCACAATCTCTGGCATAAGTTTTAAACCACTGGGTCTGGGATTCG
AACCACGTTTGACTAGGTAGGAGTCCATTACGCCATCTGCTGCTCCAGTCTTATTGATTT
TTAGGTGTTAAAATATCATTGTCTTTACTTGATTGCACTTCAGTAACTGCTTTTTAATTT
ATTTCACAGGTGTCATTGAAAATCTACATGCTGCTGCTTACCGAAATGCTTTGGCTAATT
CCCTGTATTGTCCTGACTATAGGATTGGAAAAGTGACATCAGAAGAGGTATTAACAAAAC
TTTTTTTTTTTTTTTAAAGAGTTTTTTGCTACAGGATGCGTGCGCTCACCAGAAAGACAG
AGAGAGATGGAGAGACAGAGAGTGAAAAATCACCCTCCAGGGGGATAGCCATGCTGCAAT
CCCTTCCCCATTTTCCTCTCAGGATCTTGGGCACACATGCACATTCACCCAGCATGAGCT
TTAGCCATCGGGTCCGGGACTCGAACCATGGTCAACTACATGGGAGTCCAGCAACATGGG
AGTCCAGCGACATAGCCATTACGCCAACTGCTAGTCCCCAGAATCCACTTTTGAATATGT
TTATTTTCACATTAAATTGAACATTCATCTGCATTTCACTTTTTTTTTTCTAATTTTCCT
TTTTACCATCTAGTTTTTAAAAATTCAATTTGCCTTTATTTTTTTAGCAACAGCTTGCTT
TTTAATTAAAATACTTTCTGAACAGTTTTTACATAACTTTTTTTTTTTTTTTAAGAGATT
TTTGCTGTGGGATGTATGCACTTGCGGGAGAGACAGAGAGAAATCACCCCCTGGGGGGAT
GGCCACTTCACACTCCGTTTCCCTCCATTCTCCTCTCAGGATTTTGGGCGTGCATGCACA
CACACCTCCAGGTCCAGGACTTGAACTGTACTCAGCCATGTGGGAATCCAGTGCCTTAAC
CACCACATCACCTACTAGCCTCACATAACTTTTAACAAAAAGTTTGTATGACAAAAGGGA
TATGATTCTAACAGAAAAATCAGAAAATAAAGGTACCAAAAGGAAGGAAAACATGTTAAT
GCCAGGTATGTTTCCTTCTAGGACACTTTTCTGTGTATATGTTTTTTAAAAAGGATTTAA
ATGTTTAAATATCATAATACATCTTTTGACCAAAAATCTTTAGTCCCTGTGAATACGCAG
GTAAGAATGAACCTCACATCTGTGCACTCCATCCCATCATTGGGCCATCACCAGCTTATT
TGCCTTCTGCAACACAGCAGCTTACTTCCCTGGCAGTACGGATTTGTCACTTGTCATAGC
CATGTGTCTATCATAGAACTTTGTCGCCAGAACATGAAACATTACATGTTAAATCGGCAT
ACAAGGGCAGATAGATGTATGTAATCTTAATTTCCTGCTTCTGCCATCCTGTTTCTAAAA
AAAGCTTTATCCAAAGACATTAAGAGAAAATGTCGGAATAACCAAAACTTCTGAGTATAC
CTGACTCAGAAATGAAGGTTTTTATTTTCATTTCATTTCTGGTTAGCCACTCCAGAAAAC
TAAACTGTATATCCATTTCTCCTGATACATGTATTAATAATCTAATGCCTATAATCTTAT
GGCACTTCTACTTAAATCCGAACTCAGCTTCAACAGGCAGCACTGTTTTCATAAGACTGG
ACTTTAAATGAGTTTTGATTTTTTTTTTTGTTTTGTTTTTAGTTTTTTGCTATGGGGCCT
CTGTACTCACCAGAGAAAGACAGACAGACGAGGGAGAGAGGGAGAGAGAAGGAGGGGTGT
GTAGGTGGGAGGAAGGTAAAAATCACCCCCTCAGGCCACATCGCAAGTCCTCCTCTCCTC
TCAGGATGTTGGGCATGCATGCACATGTGCCAGGCATGTTTATCAGGCACGGGGTCCAGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAATCTCCCCAAAATAGAAAAGAAAATGTATGCTTGTA
TTACTAACAAAAACAAAGATATTAACTAAGATAACTTGGTTTTCTCAAAGTCATTTTATT
TTTTAAATGTGTCTTAGGCTAAAGGAAATTCTAAGAAAATTGGTGCTCAAAGGTAGCATC
CATAGAAAAACATCAATAAAAAGAAAAAAGGATGGCTTTCCGAGATGAACCCTTAGAGGC
AGATGCTGTTCATTCTAGGGCACTCAGTCTCATAAACTGGAAAATCAGTCTCCTTACTTT
AGCCCAGTGATTCTCAATATTAGCCCCTTCCTTCCCCAAGGAGCCTTTCTAGATATTTTA
TCCTAAACTCCTCAAATGGATCTTTCTTTTTTTTTTTAAAGAATTATTTAATTTTATTCC
TTGTCAATTTATTTTTTATGGCCAAAGAGAAAGGCAGAAGGAAAATGAGAAAGCAAGCTG
CCAGGTCCGAAACTCAAACTGCGGTCAGTCGTGTAGGAGTCCAGCCGCCTTAACTACCTT
GCCACCTACCAGCCCCTCAAATGGATTTTTCATACCACAAATACACTGTGTATCTGCTTA
CCTACCACATGTATATTTGTGCTGTATACATAAAAGGAGTACAATTTTTTTTTCTTGCCT
CACCCCCAGGAGCTGATTTTGACCCTCTGGAGGTGATAATCACTATATTAAGAATGCATG
TTTTAGCCCTAGTTTTATATATTAAGCCTAAGCTTGAGGTAATAGTATAAAACATTGATT
TCCAAATTTCACTAATCCCTTTGGTGACCTTGGTGTAGTTGATTGGATGGAGGAGTATTT
AGTTTTAAACAAAGATGCTAAGGTTCTCCATTGAATCTATTATATCAGTCTATAGGGAAG
GGGGTCCCAGGAGTGAGATAGGAGTTGATGGACAATGACAGTTTCCTTTTTTGTGTTTTT
TTGTTTTTAGATTTTTGCCATAGGACACATGAACTTGCCAGAGAGAGAAAGTGAGAAATT
ACCCACTAGAGGGCTTGGCCCTGCCACAATCCCTTCTCCATTCTTTTCTTCAGGATTTTG
GGCTTGTATTCACATGAGCCTAGAGTATTTCTCAAACCACTGGGTCTGGGACTCAAAGTT
CAATTCAGCCATGTGGGATCCAGATGCTTAACCACCATGCCATCTGCTGGTCCCTGACTT
TGTTTTTTAAGCTTCCTAAGTGATTCTGTGATCATCCAGGTTAGAAACCCTGGTATAGAC
AGTGACTTCACAGCAAGAAAAGCTTTGTAGACACTGACTCTAAAGATGGGCAAGAGGGCT
GTTGTGTTGTCATTCTGCGAGCTCTGCTAGAGGATGTTAATCATGCTTTATTACTATCTG
AATAAGACAGAAACCTGGTGTACTGCTTAAACCGTATATACTAAGCTTAGTTCCAGTTTT
TTCCAGAATCAAGCCAGTGTGTAGTATAATTTCTTTCCATTCTTTTTTTAATAACAACTT
TTTTAGATGAAATTCACTTTCCATTTAATCCATTTAAAGTGTATAATTCATTGGTTTTCA
TTATATTCACATAGTTGTGCAACTATGACAACAATTAAATTCTAGTTCTTTTAAGCTGTA
GTTTTTGTCATAAAATGCCTGTGTAGTTTGATACTAATTAATCTCTTGTAGTTCATTTTA
GCAGCTTTTAAGACTTGAGTATTTATTTTCTGTTGAACTGCACTTTTACTTTTTTACAGA
TTTTATATTTATACAGATAAAATCTAATAAGTGTTTTTAACTTCCTCAGTTACACTACTA
TGTTCAGAACCATTTTACAAGTGCAAGAATGGCTTTGATTGGACTTGGTAAGTTGGCAAT
TGACCACATGTCACTTTGCTTCCTTAAGAGCAGTCCCTTAAACTGTAATTACATGAATAT
ATCGTTGAACAAAATGTGGAAACTCCATCTTCTGTTTATGTCAGGCATACAATATGTGAT
AGGCTTTTAATTGTTAGTCATTTGTTTTGGAAAGCAGACTCTAGCTTCTAATTTTGTAAA
CTACTTGTTTTAAATTTTTTACAGTATTTACAAAATCTGTGATAAGGGTGAATTTCGCTA
AGCAAAATTTCCACAAAGTGTCTTTTAAAAAGAAGTACAACTCAGTGCAAAAATAGGCAA
AAGGCATGAACAGACAGTTCATTGAGAAATGTGTACGTATGTGTGTGTGACAGCTATCTT
TATTTTAAAATTTTAAAAGATGGTCAGCTTCACTAATAATTAAGACAATTATAAATTGAG
AGATTAGTAAAAATTAGGAGATTGGCACTGCCCAAAGGTATGGGGAAATAGTCTCTCTCA
AAAATGTTTATTTCTTAGACCCAGTGATTTTACTTTTAGATTTTTTGCTTTTCTTTTTTT
TTTAATTATTATTATTTTAAATTTTTGCTGTAGGGTACGTGTGCTTGCCAGAGACAGAAT
TCCCCTCTTGGGATTTTGTGCAACTATTACCACTATCTAATTTCAGAACATTTTTCATAA
TCCCCAAAGGAATTGCATACCTACTAGCAGTCGCTCCCCATCCTCATCTTTCCTCCTGCC
TATGGCATCCACTATTCTACTTTCTGGACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNATCCCTGCCAACTAGGTCCAAGCTCAGAGAGCTTATTTACTCTCTTTTAA
TTTGCCATAGGGTATGTGTGCTCACCTTAGAGAAACAGAGACTTAAAAAGTGAGAAAGCA
AGCCACCAGGTCTGGGACTCAAACTGTGGTCGGCCATGTGGGAGTCCATTTCCCTAACCT
CCTTTTCCCATGCTTCCTGGCCCCACAATGTTTTTTTAATTTGCCAGAGGGCACATGTAC
TTGCTGGTGGGAGACAGAGGGTGAAGGAGAAAGCATCCCTCAGTGGGGCATGATCACACC
ATAGTCTCTTCTCCATTTCTTCATCCTGTCAGGATTTTGGGCTTGCACACACATGTGTCT
GGTGTGTTTTCAAGCTGCTTGGGCCAAGGTACAAACTGTGTGGTCAGCTGTGTGGGATCT
AGCTACCTTAACCACTAGGCCATGAGGCAGGCCTACCCCTTATCTCTCTTTCTGATTATG
CCATCCTAGTGAGTGAGCGTGAAGTGGTTACTGTGGTTTTGATTTTTTTTTTTTTTTTTT
GCCAGATGGTATGGGCATGCACAAGGGGAGGGAGACAAAGAAAGGGATAGAGGCCACTTC
CACACACACACAGTGGGCCCAGTCCTTCCACAGTCTTTTTCCTCCATTTCTCTGTCCTGT
CAGGCTCTTCAACATGTGCATATATGTCCATCAGAGCTAGGATTCAAATGATGGTCAGCC
AAGTAGGACTCAGCTCACATACTGCTTAACTGTCATGCTGTGGGGCCAGCTCTGATTTTC
ATTTTCCTAATGACAGATGACATTAAACATCTTTTCATGTGGTTTTTGGCCATTTGTGTA
AGTTCTCTGGAGAAATGTCTGTTAAGTCTTTAGCCCAGTTTTAAATTGAGTTGTTTATTT
TTTATTGTTGAATTGCAAAAGTACTTTATACATCTGGATACTAGAACCTTAGCAGATATG
TAATCAAATATTTTATTCCATTTCATTGGTTGTCTTTCATTTCTTCAGTGTTCTTTGACA
CACAATACCATATTAGTAGCCAAGTATTGGAAACATGCGAATATCCATCTTGAAGGGATC
AATTAAGTAAATAATGGTATATCCATAAAAGAGAGTTCTTCGTAACTATTAAATAGTTGG
TGTAGACAGTCACTTAGAAAGATGTAAATTACAAAAGATAAATTACAAAAATATCAATAG
AATGATACCATTTTAAAAATAAAATGAGCGTAATATTATTAACTACACAGGAAAAAAATT
CTTGATGAGTAGTAATAACTGACAGTTTAGTTATAGTAAACGGTAAGTGGATATCTGTAT
CTGGGAGAGTGACATTATGGTGGGAAGACGATACTGTTTTCTTTACTGTTTATTTCTATA
AAGTTTGAATTTTATAATCATATTTTTAAAGCAATAGATGTTTTACAATTGTGTTTGGAA
ATTCCAATTCTAGCTTTGTTTTTGTGTCTGTCGAAACAGGTGTGAGTCATCCTGTTCTAA
AGCAAGTTGCTGAACAGTTTCTGAACATGAGGGGTGGGCTTGGTTTGTCTGGTGCAAAGG
CCAAATACCGTGGAGGTAAGTATTTTCTTTTATTAGGGTTAATTTATCAGAAGGAAGTTT
CTTCACTAGAATGAGATGGAATAGGGACAGAATAAGCCTGATAACTTACTCCCCAATAGT
CTCACTTAGGTTACCTGAGTGTTGTGTAATAAATTTGTATTTTACATGTGTGTTGGGGCA
AGATGACATGGGGAAAACACAGGGCCATAGAAAAAAGCTTGATCTTGGGGCCAGCAGATG
ACGTGGTGGTTAAAAGCGCTAGACTCCCACCATAACCGACCATGGTTCAAGTCCCAGACC
TGGCAGCTTGCCTTCTCACTTTCTCTCTCTCGCTCTTGCTCTCGCTCTGTCCCTTTCTGG
TCAAATTAAAATAAATAAATGGGGGACCAGCAGGTGGCGTGGTGGCTAAGGTGCTGGACA
TTCCCACATGGTTGACCATGGCTGGAGTCCGGGACCTGGTGGCTTGCTTTCTCAGTTTCC
CTCTCTCTCTCTATCTCTCTGTGTCTCTCTCTCTATCTCTCTGTGTCTTTCTCTGCTCAA
ATTAAGAATAAATGAATAGGGACCAGCAGTTAGCATAATGGTTATGTCGCTTGACTCCCA
TGTAGTCGACGGCAGTTTGAGCTCCAGAACCAGTGGCTTAAATTCACACTGGGCACATGT
GCGTGCATGCCCAAGATCCTGAGAGGAGAATGGAGGAGAAGGGATTGCGTCATGGCCATT
CCCCCAGGGGGTGATTTCTGTCTTTCTGTCTGTCTCTGTCTTTCTGGCGAGCACACACAC
CCTATAGCAAAAACCTCTACCAAAAAAAAAAAAGTAAATGAATAAATAAATAAAATAAAA
TATTTTTTTTATTTTTAAATTATTAAATGAATAAATTTAAATATATCATCAAAAAAAAAG
GCTTAATCTTGGTGGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGGCCAGCCAGTGGCATAGTGGTTTAAGCAGCTGGATCCTACACTTGCCGACTATA
CGAATCCTGTACCCAGTGACTTTAAAAGCATACTGAGCATGTATGTGCACGTGCTATACC
CAAACGTGCGGTGCAAGAGGAGAATAGAGGAAAATAGAGGAAAGGGGTTTGTAGTGTGAC
CACCCCACTGGGGTGCTTTCTCAGTCCCCCCTCCATACCACTCTTCTCTCTCACATCACA
CATACCCTGTAGCAAAAAAAAAAAAATTTTTTTGATGATTACTTAAATTAGTCCTAAATT
AAATTTAGCAGCTGCTTTTTCAATTTCCTCCAGATTTGTTTTCTCTGTTTTATTCACACT
TTACTTTTCACCAATGAATGTTACTGAAGGCTCTGTGGTTTGAGTTTAGTCCTAATCCAA
TGACATAATGTAAAAGAAATTCCCGTCTCAGACTTCGGCCAGAAATTTGGAATGTAAATA
GAATATTCTCAGAATTAAACTTCAAGTAATTGATGTATATATCTTCTTATACTTTACATG
GACTGGACCGGTGAGTCTCAAACTTTAATATGCCTAGGAATCACCTTAAACACTGGTTAT
AAATGTGACCCTTCTTTTCTTGGTGGTCCAAGTGTATGGTCCTGCTCCCAGTTTTGCACT
TAGGCAAAGGGAAAGGGGCTCCGGCCTCCTCAGCATCACATCTTCAGAGCTGGCAATTTC
CTGTTCACTGATTTTATCCTCAAGTTGTGGTAAAGCACAGGCTTAGAAAAGAAAAAGAAA
TGTGGGCTTCCAGGCTGTATGCATAGGGATCTGAGTCAGTAAATCTGCAGGAACCTGAAA
GTCTGTATTAATAACAGCTGAGAAGACTTTCAGAATAATGACCCACAGAAATGCAGCAGA
AAATGCATTAGGAAATCAAGTCGTCCTTGAGATGCTTAGAACTCTGCTCAGTCAGTAGAC
AGCAGCCCAGGCTAAACTCCTTGGTGCTGTGGACATCTGTATAACGGCCACTGAACAGAA
ATGTTTCTCTGATCCTTTGACTTTAGTGTATGAAATGATAACAAATTGCTGAAAAAGTTA
CCACCAACAGCAGAGAGAAGAAACCAGGTCTGCCCAGTGCCAAATCCCATGACCAGGACA
ACTCAGCCATGATGTTGTCTAGATGGTAGGAATAATGCTTGCAAATCAATGTTTGTATGA
GCCTTTAACTATCAAAAGATTAGAAAAGAGCCAGCAAAAAGGAAAGTGAGTGATCATCTT
AGAAAGATTTAAATTTTAAAAAAAATGGTTAATCAGTTTTACTTATACTGTGAAGGTGCA
AATGTCTGTCTAGATATCCTTAGGGATGCTATGCCTGTTTTTACATGGAAGACTGTCATA
ACAGTAAAGTTTCATTTTCATTATTTTTCAGGTTTCTGCATTTAATGCCAGTTACTCAGA
TTCTGGACTCTTTGGGATTTACACTATCTCCCAGGCTGCAGCTGCTGGAGATGTAAGTTG
CAAACTTTCCAGCTCTCATAAACAAGGTGTTCTTTTCTCATTATTAATGTGTTTTAGTTA
AAGTATGGAATGTTTGGATGTCCTGATTTATCAGAGCTCTGTGTAATATCATGTGATGTC
ATTGAGGTGTATCTGCTGTTAGAAAAACAAAACTTATGTACTAATGCCTCCAGAAAAGAC
AAGGAAATCCCTCCTTGATATTTTGGTTCTGTGGCGCTGAGTTGGCACAGACGTCTAAAT
TGAGAATCCAGGAGAAACTGAGGCCAAGATGTGTATTTGTGAGTCCTCAGTATAGAGGCT
ATGTTGGAGCCAGGGTTGCATGTGAATAACTGTAGAAGAAAACTGAAGCTCAAGTTCTAG
GAAACGCCCACCATGTACAGACCAAGTGACTAAGGAAAATAGCCAAGAAAACAGAAAAAG
AAGAGAAATTATTTTTGGCGACAAGGAAAGAGAGAATGATTAACTCTGGGTTTAATTTTT
GTTTTATTTTGTTTTGTTTTAAGAATTATTTATTTAATTTTATGGGGCCGGCAGGTGGTG
TGGTGGTTAAGGGCACTGGACTCCCACATGGCTGACCACGGTTTGAGTCCTGGACCTGGC
GGCTTGTTTTTCTCTCTCTCTTTGTCCCTCTCTCTGATCCAATTAATATGAAATAAATTA
ATGAATAAATAAATAAAATAATTATTTTTAAAAAGAAGAATTATTGGGACCAGCAGTTGG
CGTAATTACTATGTCACTGGACTTCCATGTAGTCGACCACGGTTCAGATCCTGGACCTGG
TGGCTTAAACTCACGCTGGGCACGTGTGTGTGTGCCCAAGATCCCGAGAGGAGAATGGAG
AAGGTATTGTGACCTGGCCATTCCCCCAGAGGGTGATTTCTCGCTTTCTGTCTCTCTGTC
TCTGTCTTTCTGGCGAGCGCACGCAGCCTATAGCAAAAACCTCTCAAAAAAAAAAAAAAA
AAAGGAATTATTATTTATTTAATTTTATTTATTATTATTCTTTATTTCGACCAGAGAGAG
TCAGAAGTGGGGCGGTGAGAAACAAGCTGCCAGGTCCAGGACTCAAACCGTGGTAGGCCA
TGTGGGAATACAGCACCTTAATCACCATACCACCCCTCGCCGGCCCCAGATTAACTCTTG
TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTCTGCAAGCGGCCAT
TCAAAAGTATGAGGAAATTGGGCCAACCAGTAGCATGGAGGTTAAGGCAGCTGGATCGCA
CAAGGCCAGTTATGCAGTTTGAATCCCAGAGGCTTAAAAAACATGTGCACATGTGCATGC
GTGTCCCAAATCCTCGGGGGAGAATGGAGGAGAAGAGATGATTTGTGTCTTATCTAGAGA
AATTGATAGAGAGACAGTGGCAAACCAAGTAACTAGAGATGTTGGTAAAGTGGAAGAATA
GGTTAGAGACTGAGGCCAGGAGGTCTTAAAATTGAGGATTTCAGAGGTAGGGCAAATCTA
GGATATGTTTATGTCTGAGATGTGGCTGTGGAAATGGGTAGCTAAAATGGAGGGCCGAGG
AAGGTCCTACAACTTAGTTGATCAGTGGGACAATCAGTAGCAGACCCAGAATGGTGCCAG
TGTTGGGATGGAGAAAATCGCAAGCCAGGTTTATTAATTTACTTTATTCAACAAATATTT
ACCAAGGGGCTGGGATAGTGTGGCACAGTGTAACCGTGCTCAGCAAGGATGACCCCTGTG
GGGCGGTTCTGGGTTCACGTCTGTAGAACTCCCTGAACATGCTGGCCACGTGTGTCCATA
GTCAGTCTGGCTGAAACGGGGGTGGATGAGACGTGAAGACCTTATTGAGGGTCCCTATCT
TAAAATAAATATTTCCTTCCCTTCCTTCTTCCCTCCCTCCCTCCCTTCCTCCCTTTCTCC
CTCTCTCTGTCACACTGAAGGGAAGAAACTTTAGTTTACCAAGTATTCATATCCCTGAAA
CTCAATTCCTTCTTTTTCTTTTTCTTTTAACTGCCAGAGGGGTATCCACTTGCCAGAGAG
AGAGAATTGCCCCCTTCCCATAGGGCATGGCCATATCACAATCCTTTTTCCTCCATTCCT
CATCCCTGCCAGGACTTTGGGAACACATGCACACACACCCCCTGTCTTTCAAGCTGGAGC
CAGCCCAGCATTGTGGGCTCATGCTCCCTTAACCACCATACAGAGGTTCCTTCTTGACAC
AGACACTGCAGGTATGAACCAACCTTACAAGCTGGGTGTGTATGGATTACTGCTTCCTTC
TTAGTGAATAGTGAGAGAGAGAACAGTATTCATCGACGGGCACTGACAGGCCAGAGAAAA
CTTCAGGGTGCTTTTCTTTTTAGGCAATTATAAATCCATGTGTTTTGCTCTTCCGTTAAA
GAAGAGCTATCCTCTTCAGGCACTCTGTTTTGGGCCACTTAGAAGAACTTTGACTACTTG
GATATTTTAAATTGGACAGGACCTTATTTTGGAAACATGGGAAGGATAGAGAACATAATA
GGTGCTACAAAATTCCTGACAGATGCTGTGCGGTTCCTCTTGAACTAAACTCCCATCTTG
TGCTTTTGCCCTGCCAGCAGAGCATTTGCTTGCTGCCGGAGATGCTGGCACTGAGCACCT
CTTCCTTGTCCGTTCTAGGTCATCAAGGCTGCCTATAACCAAGTCAAAGCAGTTGCTCAG
GGAAACCTTCCCAGTACAGATATTCAAGCTGCCAAGTAAGTCTTCGTATTAACTGTGGTG
TTTGGTTTTTTTGTTTGTTTGTTTGTTTGTTTTTAAAAGAGATTTTTGCTATAGGGCATG
TGTGCTCGCCGGACAGACAGAGACAGAAAGTGAGAAATGATCCCCTTGGGGGAATGGCCA
CGTTGCAGTCCCTTCTCCTCCATTCTTCTCGGGACTTTGGGCACACATATGCGCCCAGCT
TGAGTTTTAAGCTGTCGGATCCAGGACTCAAACCGTGGTCAACTATGTGGGAGTCTAGTG
ACATAACCATTACAACATCTACTAGTCCCAGTATTTACTATTTTATGTTCAGTTACTTGA
AAGTTGTCTTTTCTAGTCATAACAGTATTGTAATATATGCTTATAAGGGTTGAGAAATAC
AAAAAAGTATTAAAAGGGACAGGAAAGCACATCCATATCCATCCATCTAGGTAAATAATT
ATTAACATTTTGCTTATATTCTCGACCATGCACTTTTTAAATGTAATTATTAATATTTTA
AATCTGTTTATATCCTTCTTTTGTTTGTTTGGGTTTTTTGGTTTTTGTTTGCTGTAGGGT
GCATACTGTCTCTGGAGACAGATACAAAGAGAAAGAAAGAAGAAACATGATAAACCACCC
CCTAGGGGAAAGGGCCATGCATAGCGAATTCCTTTTCTTCCATTCTCCTCTCAGGATTTT
TGGCATGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACATAGCCATTACGCTAACTGCTGGTTC
CTGAGTTGACTCTGTTTCTGACAGTTTGAAATGTGAATCTTAGAATTCAAACAGTCTTTA
GGATTATCTAATATCACCCACAGTGGAAATAGGCATAGTGAATTACATCAAGAATGAACA
ACCTTTTAGTTATTTCTGTTCCCTTGGTGTTATTAGTGCTGTTATGTTGAGCATTCTACA
AATAACGTCTTTCGAATAAGTACAGCACAATTTACTACATATTGTATTCATGGAATCAAG
AGTTGATAGGATGTAGTTCTGCTTGATTGCACCAGAAACAAAAAATGATGAGAATAAAGT
GACTGAATTTACCTAAGAAAAATCTAAATTTCAAATCTAAAAAATTTTGTTTTCTTAATC
AGTTTAGCATAGTTCTTATAAGGTATAGCAATATGTAGAAAATGGGATTTCTGTTAGGTC
AGGATATGGTTTGTTTTCTGCCATTTTGATGGAGCGGGTCATTTTTCTTATCAAGTTCTT
AGAGAGAAAATGAGGTGTCATTGCTAAAGGGACAAACCAATAGCCTCCTGGTAAAGTTTA
TTATAGGTAAAGTCCTTTTTAAATTAAGCTGACAGTGTAGTTAAGTTGTAATTACATTTA
AATGGAAGTCTTGCTATAGAGTGCCAAAGGATGATAGCTTTTGGGGGTTTAAATTACTCA
AGTTCCTTATTGAATACCATATTTATAAGGAATAATGGTTTCTTTCTGGATGAATCATGA
TTTAGGTATTGTTTTGCTTTATTTCAAATTAATACTTTTATGCCCTTTTTAAGCCACTGG
GGCTTATGAGACTTATGCTGTCCTTCAGAATCCTTTATGCTCTTCTACCCTTGTTAAGGC
CAGTCCCGGTGTAGGAATAGTGGATGGGGAAACTAGGTATACAGAATTGACACAGTGTTC
AGCTAAGTTCATTGTGCCTTAAAAGCCCACATATGTATCTTCTTTAATAAAAATGCCTGA
AATTGGGGCCAGCAGGTGGCATGGTGGTTAAAGATACTGGACTCCCACATGGCCAACTGT
GGTTCAAGTCCCAGACTTGGCAGCTTGCTTTCTCACTTTCCCCCTCTCTCTCTCACTCGG
TCCCTCTCTGGTCAAATTTTGATTCATTAATTAAATCTCAAGTAAAAAAGAAATGCTTAA
AATTATCATAAAAGTATCAGGAGGAAAATTACTTCACTAATCATACCTCACATTAAAATA
GTTTTAACAGATCTAAGTTCTAGTCCAAATCAGAAAGCAGTCTGCTGAATTTCAATGTAG
TTTCGTACTAACAGCTTTCCAAACAACAATGTAATAAATTGCTTGGTGAACTAAAGAAAT
AGAATGGAGGCTTTTAAGTGTCATAAGCTAATAATTTTTCTTTTTACCAGAAACCTGTTG
AAGAGTTTTAGGAACACATTTTAAAATTACATTGCTCTGTAAAACTGATTCCTGCCCTTT
TCTGGACAGGAACAAGCTGAAAGCCGGATACCTAATGTCAGTGGAGTCTTCTGAGGGTTT
CCTAGATGAAGTCGGGTCCCAGGCGCTCGTTGCTGGTTCGTACATGCCACCATCCACAGT
CCTGCAGCAGATCGACTCAGTGGCTGAAGCTGATGTCATAAACGTAAGCAAATGAAAACC
TATCATTTAACATCAGAGAACTCAACCTTAATGATCCAATTTCAGGAACAATGCGTAAGC
TTCCTTGGGCCGTGTGTGCTGTTGTGCTGTTAGGTGCAGGTGCTTAGCTGTCTAGTGTGG
AGGCAGGAGGGCTCGTTACCATCAGATTCACAAATAGCTTGTCAACTAGGTTACACGTAA
CTTCCTCATTCAAATAAATTACCATTAGGTTAAACCATTTTAAATTCCTAGAGATCAAAA
TGAGTCAGATATTGGCAGTTTCATATGATTCAACCTAAATACAGTCATGTGCCACTTAAT
GATCTTTCTATTAGCAGTGGCCCCCATATATGAAGCTGGGCCAGTAAGGAGTAGAAAGGC
TGTGCACACAGCTGGCTGTCCCATCTGGCTTGTGTAAGTGCAATCTGTGATCAGCACACA
GCGATGAAATCACCTAAAATTGTGACTCTCAGAACTTATCCTTATTGCTAAGCAATACAT
GACTATAGTAAAGTATTGCTGTTTTTCCTTTTTCACTCCTGCAAAATAAACTCTATCCTG
CTAATCCTTCACTATTCCACATCTCAATGTTTTTTTCAGCTCAAGCATAAGACAGTTTCC
TGTTCTTGCTGTTTATTTTCCTCACGTACCTTATTATTCCCTATAGGACCAAGCTGTCTT
TTTTTTTTTTTTACATTTTTTTAAAATAATTATTTATTTAATTATATTTATTCACTCTTT
TTTTTTAATTTGACCAGAGAGAGACACAGAGGAGGAAAGAGAGAGGGGGAAAGTGAGAAA
GGAAGCCACCAGGTCCGGGACTCGAACCGTGGTCGGACATATAGGAGTGTCCAGCACCTT
AACCACCATGCCAACTGCTGGTCCCAAGGACCAAGCTGTCTTGAGGCAGCACTATGCCTT
ACACCTCCTTGCATTCCCCATTGTATCTAGCAAGCACATGGACTACAGAATAAATTAAAC
CTCACTGGGTTTTCTAGTCCCTTCTCTATTAAAAATGCCAACTTGCCTTCCATTTAGATG
GTTCAACCATCTTCTCACCAACAGCTCTGCCTAGTATAAGGACAGTGGGAGTGGAAAACA
AGACAAGGCTATTTTAAGGTAGCAACCCTAACTTAACTTCACCTGGCCCCTGAATTCATC
TGTACATATTACATACTTTTCCAAATGGTTATCCTCATCTTATATACCATCCTTACATGA
GTCTCAACACAGCTGCCACTTCTCCATTGCACAATCTGGCCTAAGAGGGCCAGCATGTGA
TGTGGTGGTCAAAGGAGCTGGACTCTACATGGCTGACCATTCAGTCCCAGACGTAGTTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGT
TTTTATTTCTATTAACTTTTATTTTGTTTCTTTGTTTGTTTAAAGGCTGCAAAGAAGTTT
GTTTCTGGCCGGAAGTCAATGGCAGCAAGTGGAAATTTGGGGCATACACCTTTTGTAGAT
GAGTTGTAATGTTGAAGTACATAGTACAGGAAAGAGCTGAACATCTCAGCCCCAAGCAGC
AAACACCTGAAGGTCAAAAGTCTCTAAATGAAATACTCATCCTTTTTTGTCCCCATGGGG
TAAAATACTTTAAACCATAAATACAGATAATTATTCCCAGCTGTCCTAAAGTCAATAAAA
CATTCTGCTTAAATGTTTTTCCTACATTTTTCCTAAACAACAAGCATTTATAATATACTG
AGATCTTTGTTTTACATGCTATAAAGGAAACAGGAATACAATAATTGACTATAGAAGCAT
CAGAAACTAGTAACATGAAAGCTTAACGTTTAAAATGAAGGTAAGTATTTCCAGATTATT
ATTGGTAGCTTTTTAGAATATAAGCAACTTTTAAAACTGTCATTTGAGAGGCCCACAGGT
GGTGTGGTTGAGGCACTGGATTTCCACATGGACGATCGTAGTTCAAGTCCCAAATCTGGT
GACTGACTTTCTCACTTTCTCTCTCTTGTCTCCCTCTGGTGAGCACATGTGCCCTATAAT
AATAATAATGAATAAAATTAAATTAATTAAATTAAATTAAATAATTCTTTTAAGAAACCT
CATTTGGGTAGCAACAGTTAAATGATCTGGGTTTTACCTCCTTTTTGCCCCCTTTTTGCA
TAGAATTAGTTCTGAAAAACATAAATTCTCTCTCAATCATATGTATTCCCATTACTTCAT
TTTAATATGTCTGATATATCTTCACTGGGAATTTTGTCTTTAATTTCCCATCTCTCACAT
TCATCTGTTTCTGTCTTGTCTTGCTCAAATAATNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1033, 3972..4055, 4154..4303, 5965..6029, 11032..11088, 11323..11447, 16629..16726, 20329..20386, 23019..23114, 24392..24591, 26371..26451, 29178..29254, 32409..32562, 34305..34388
1001..1033, 3972..4055, 4154..4303, 5965..6029, 11032..11088, 11323..11447, 16629..16726, 20329..20386, 23019..23114, 24392..24591, 26371..26451, 29178..29254, 32409..32562, 34305..34385
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved