Tupaia_belangeri Locus ENSTBEG00000000418
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000000418
Tupaia_belangeri
ENSTBEG00000000418
GeneScaffold_1652
SNORD46, SNORD38, SNORD38
1332..1435, 2221..2290, 2701..2770
3997
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGCACTAACATGGCTGCCGGGTTGAGGTTCGGGCCGGGTCGCACGTGGT
GATGACACCTTGGTAATGCTGCAGACTTCCGAGTCGCTATGGGGAAGCCAACCTTGGAGA
GCTGAGCGTGCGGCCCGCCGGCCGCGGGCGTCTGGACCTGGCGAGCCGCCCGCGCCGAGT
CGCAGTGGCTCAGACTTCCGACCCCGCTCCCACACACAGGTATCTCTCGGGACAACTGGC
ATAAGCGCCGCAAGACCGGGGGCAAGAGAAAGCCCTACCATAAGAAGCGGAAGTATGAGC
TGGGACGCCCCGCTGCCAACACTAAGGTGGGTGTCCATGTGGCTGCGCCGCCTGGGAGAC
CGCCTTTCCCTGCTCTCCACGGTCAGGTCTACGCCGGGCTGTGGTAGGTTCTTGGGCCAC
CCACATGCGGGGTTAGCATGCAGGACTCGAAGGCGCTGGAGGAGTGCGCTTCTCGAGATA
GGAGCCTAATGTTTGTGTTGCACAGAGACTTTCTTGTGGGGGCTTGGGGGTCAGGGGTTT
CCTTTTGGAGGTCACTAGGGTGATGAAAAAGCATCCTTAGGCGTGGTTGTGGCCGTCTTG
GTCACCTGTGTGCCACTTGCCAATGCAAGGACTTGTCATAGTTACACTGACTGCTGCCTC
CATTCTGCGCAGGTATTTCCCCCAGCCCCTTTGCCTTGCCCTCTTGGGTAACCTAGTTCT
GTCTCCTTGTGTTTTCCAGATTGGTCCCCGCCGCATACACACAGTCCGTGTGCGGGGAGG
TAACAAGAAATACCGTGCCCTGAGGCTGGACGTCGGGAACTTTTCTTGGGGTTCAGAGTG
TGAGTGAGGCCCTTGAGGAATGGGTGGGAAGTAAACCTTTCTAAGCTAAAATGAGTGCTT
TTAGCACAAAGTTCGCATTCCCACACCAGGATACTTGAAGTTTCTCCTTACTAAAAGATC
TTGAAGTAGCTGAAGAAGTCTTTTCTTACTAACTCCTGCAACCTTGGGGGTTGGGGGTGA
TTCTAGCAAGTGATTGCTAAGCACCTCTGAATAGATGGGTTTGGTAGATAACAAGGTGAT
GCCGTTTTGCTGGGTAAAGGCTCAGAGGTCGGTTACTGCTGCTTAAGGCCCTACTAAGGC
CAAAGACCTTGGTAGTGCAGTAAGGCCATTTTTTCTCTGGTTATGTGACCTGACTCTAAT
TTTTTCTCTGAGCAGGTTGTACACGCAAAACAAGGATCATCGATGTTGTCTACAACGCAT
CCAATAACGAGCTAGTGCGCACCAAGACCTTGGTGAAGAACTGCATCGTGCTCATTGACA
GCACACCGTACCGACAGTGGTACGAGTCCCACTATGCACTGCCCCTGGGCCGCAAGAAGG
GGGCCAAGCTGGTGCGTGTTACTCCCTGTATGGGTTTGGGGGGGTGGCCCAACTCCGGCC
TTCTCGTGATGAAAACTCTGTCCAGTTCTGCTACTGAAGGGAAAGTGATGAAAGCCTTTA
ATGCTGAGGAAGGCAGGTGTTTGGACTTGCAGGGTTTGAGAAGGCTGTAGTGGCCTGCCT
TTCTTGTGCTAACCCATTTGTGTCCCTTCCATTTAGACTCCTGAGGAGGAAGAGATTTTA
AATAAAAAGCGATCAAAGAAAATTCAGAAGAAATATGATGAAAGGAAAAAGAATGCCAAA
ATCAGCAGTCTCCTGGAGGAGCAGTTCCAGCAGGGCAAGCTGCTTGGTGAGATATGTGTG
GGTCCCGTGTTGGGCGTGGGGGGTTACATGGCTACACAGGTCCTCTGCATTTTACCCTGT
CCTGTTCATTTAACTGAAATGGGAAACACTGGGTAGAAAGAGTTCACAGGTCCACGCTTA
GAGCTTAGCCTCTTGAGTTTCAGGAATATTTGGGGAAGTCCTGCCCAGACTGAGGGGGCT
GTCTCCATGATGAAAACTTCGTCCAGTTCTGCTACTGACTTTTCAGTGATGATGAAGTGT
GTCTGAGGAGACGGTGGGCTTCATGCTTGCCTCCAGAACACCTTAATCAACATGGGCTTT
AAAGGGAACAGATAAGATTGTGTCAGGCCACTTTGTCATCTTGTTAAGGGCCACATGCTC
TCTTCCAGCCTGCATTGCATCCAGACCAGGCCAGTGCGGCCGTGCCGATGGCTACGTGTT
AGAGGGCAAGGAGCTGGAGTTCTACCTGAGGAAAATCAAAGCCCGGAAAGGCAAATAAAC
CTTCCTATCTTCGCTCTGTAATAAAGGTGTTTATTGTTCACGTCTCAATATTGACCGTTA
TTTTGCTCTTCTTTTTGGTACGCTGAACAGAACTGATGCAGTCATGTCTGGAACACTTTC
CTGGCTCCTGTCCCCACCCATGCTCACCACATTGTAGAGGCCCCATTGGCCTCAGCTCCT
TCCTGCTGAAGGCCCGGCCTCCTGTTAGGTATGCTGCAGTGGTAGAATTACTTTTCCTAC
TGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTGGGATTTGGGGC
CACGATATCCACCCTAGCTTGAGTTTGGTTTGTTATTTTGGGTTTGCTTTTTTTTTTTTT
GAAAGTTTTTGCTATAAGGCCATGTGCGCTTGCCAGAAAGAGAGAAAGCAAGAAATCACC
CCTCAGGGGGGATGGCAATACCGCAATCCCTTCTCTGTCCTCTTGGGATCTTGGGCACGC
ACGTGCGCCCAGTAAATTTAAAGCCACCGGGTCCCTGAACCACAGTTGGCTACATGGGAG
TTCAGCGACATAGCCATTATGCTAACTGCTGGTCCCAGTAGGCTTGTTTTTCAAGCTGCA
AAGGCCAAACAGCAGTTGGAACATCTTCAGTCCAGACTTCCTTGTCATTTGAGCTTGGGT
ATTATAATACGATCTAGCAGGGCCCATCCCATTGTGTTCCTCAGTTTCCCCAATTGTCTT
AATTACAATTACTTAATCAAAACCCCAAATCAACCCTTAACCCTGCATTCCACATCTGTA
TCAAAATCTGACTGGTCCAACCTCTCTATTTTATTATTTTGTTTACTACAGTACACCTGC
ATTCACCAGAGAGAGGCAGACAGAAAAAGAAGGGAAGTGAGAAAGCAAGTTGCCACGTCC
AGGACTTAAACCATGGTCAGCCATGTGGGAGTCCAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1105, 1519..1618, 1995..2170, 2376..2505, 2888..2997
1001..1105, 1519..1618, 1995..2170, 2376..2505, 2888..2994
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved