Tupaia_belangeri Locus EIF4G1
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri EIF4G1
Tupaia_belangeri
EIF4G1
GeneScaffold_4613
SNORD66
8345..8420
18013
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCCCCCGCCCGCCCTG
GCCCAGCCGCCATGTCTACCCTGCCGGATCCCAAGTAATGATGATCCCTTCCCAGCTCTC
CTACACAGCCTCCCAGGGGGCCTACTACATCCCTGGACAGGTGAGGCTGGAGGCCAGAGA
ACTTGTACCCCACCCGCCCCTCCCTCCCCTCCCCTGCAGTCGTCTTTCCAGAGGTGGGAC
TTCCTTTTGGTCATTGCCCAGAGATGGCTTGTCTTGTCTTGCCTGACATTCTCTTTGGAG
TCTGATAATCGTATTCATAGCTCCCTCAACTCCTCTCCCCCGCTCCCCTCCAGGGGCGTT
CCACATATGTTGTCCCGACACAGCAGTACCCTGTGCAGCCAGGAGCCCCAAGCTTCTATC
CGGGTGCAAGCCCTACAGAGTTTGGGACCTACGGTAAGCAGGGGAGGGGGTCAGGTGAGA
GTGAGTCCCAGAGACCTTCTAAACTGACCCACTGATCTCTAAAGCATAAGGCCCTTCCCA
GGCGTGGCTTTCGGTCTGAAAAGATAGGTTTGATTAATAAGTGGTAGGGATGGTGCTTAA
TATTTAACTCGTGTTGCTGGGGGAGAAGATGTGATCCCGTTGCCGAGGGAGTTGGTGTCC
TCCCCACGTCAAGGAATGTAGGGTCAGTTGCCAGTGTGAGGGCCTGTCCGTAGGCTTTCC
CTGTGACGCTCCTGTCGTGCTTGGAGGGAGGGTTTCTTAGCTATTTTTTCATTTATGTTC
TAAGAAAGGGTTAGTCTGTTCTCTATGGCCAACATTTTTTTGATCACCTATCAGGAAAAA
TTTTGAGTGTGTACCTCTAATGTAGTTTTTCTCTGTGTGTGTACATGTGTACGTGTCTTA
CATACATGCAAACTTCAAGCAAATAATACACTCATGGCGTTGTTAAAAATGAGCAGAGAT
TATGAATGAGATGAATGAATGCACTCCACTTTGGAGACCATTTCTTTAAGGAATCATTTT
CATTCTGGGCCCAGTTCATAATGTCAGTTTTTGTTTCCTTACCCCATTGCAAAGAGCTCG
GTACCAGAACTAGGCTCAGGCCCAGTGAAAGAGTTGATAAATCACTTTTAGTCATTCCCA
GCCAAATGCCTGGTATGTTTCGAGTTCAGGGTACACGTACCTGTTGCTGGGGGTGGGGGC
CTGGGTATGCGCGCACGTGCACCGGAGTACCTTGTGGGCAGGGTAGACGTGAGTCCTGGT
GGCTGGCGTGTGCTGGGGCAGGAGTGCCTGCCTACAAGGGGTGTGCGTGTCCGTGTCCGG
AATTCTTGTAAACGCAGTTCAGACTGCTTCTCTCGCTTTGACAGACACCTAATTCCTCGG
GGAGAGGCGGGGCAGGGCAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNAAGTGAGCCGAATGTGTGCTAGGTGGGGGGTCCTGGGCCCCAGGAAATGCAG
CCACTGACTTGGGGACTGCTTGTGGGGCAAGGGTGAGGGAGGGGGGCATTGTGATGTACC
GGCTGCTCTGTGAGGTCAGGGGTCTCTCAGGGGAGCGGCTCGGGCAAGGACTACAAGAGC
AGCCAGATGGGTTGACAGTAGAACTCATGGGATTCTGGCACCCACCCACCTGCTTCCCAG
ACGGGGGTGGGGGGCTGGCCTGGAGTCTTCAAGAGTGGGGCAGGGTGGAGAGGTGGGCTC
CTCCTGCTTCCCACTCATCCTATAGCTCTCTTTCCTCAGATCCGAATTCGAGATCCAAAC
CAAGGAGGGAAAGATATCACGGAGGAGATCATGTCTGGGGCCCGCACCGCCTCCACACCC
ACCCCCCCACAGGTACTGCTGCTCTTGCGTGCTCCCTGGCCGGGTGGCTGCTCTGCCCTG
TGACTCCCAAGTCCCTTGATCTTTTCCTTCAACTAAGGGATTTGTTTCCCTGCTTTCCTG
GATTTCTAGGCAGAGCTAAAGTAGAAATGGCTCTAGTAAAGAAGGGTTGTGGGACTCTGC
AGTGCAAACTTGGTAACCCTTTGTGTCCTGCAGACGGGAGGCGGTCTGGAGCCTCAAGCT
AATGGGGAGACGCCCCAGGTTGCTGTCATTGTCCGGCCTGGTAAGTAAGGGTGGGACAGC
TTTTATGGGGAAAAGGATTATGACAATTAAAAATGCCAAGGAGGTGGAGTGACTTAAACC
AGGTGCCAGAGTAGAATGATTTAGGCTTTAGGTAGTGGGATTTTTATGGTGGACTGGGTT
TTGGATGAGAAGGGAAAATAGCTTAGGTTGGAGAAGACTGGGGGCGGGTACAAGCTGGGA
ATAGAGGGAGAAGGGGCAGTGGAGGACGTGCCTTTACTGACTCGCTCTTTATTCCCGTGC
TACATGCAGATGACCGGTCCCAGGGAGCGATCATTGGGGGCCAGCCAGGGCTGCCCGGCC
CAGAGCACAGCCCTTCAGAATCCCAGCCTTCATCACCTTCTCCGACCCCATCACCACCCC
CAATCTTGGAGCCGGGCTCTGAGCCTAACCTCACAGTCCTCTCCATTCCTGGGGACGCTA
TGACAGCGGGGATGATACAGATGTCTGTAGAAGAATCAAGCCCTGTGCCCCATGAGACCG
GGGAGCCCTATTGCCTCTCTCCAGAACCCACTCCTCTCGCAGAACCCATACTGGAAGTAG
AAGTGACACTTAGCAAACCAGTTCCAGAGGCCGAGTTCTCTTCTAGTCCTCTCCAGGTCT
CCACCCCCCTGGCATCTCACACGGTGGAAATTCACGAGCCTAATGGCGTGGTCCCATCTG
ACGACCTGGAACCAGAGGTGGAGTCAAGTCCAGAGCTTGCCCCTCTTCCTTCCCCGGCTC
GCCCCTCTGAGTCCCCTGTGCCCATTGCTCCAACTGCCCAGCCTGAGGAACTGCTCAACG
GAGCCCCCTCGCCACCAGCTTTGGACTTGAGCCCAGTCAGTGAGCCAGAGGAACAGGCCA
AGGAGGTGACGGCATCAGTGGCCCCCGCCACCGTCCCCTCTGCCACTTCAGCCGTGGCTT
CTCCAGCTACTTCCCCTGTTCAGGAGGAGGACATGGAGGAAGAGGAAGAGGAGGAGGAGG
CAGGAGAAGCAGGAGAAGCTGAGAGTGAGAAGGGAGCAGAGGAATTGCTTCCTTCAGAGA
CGGCCTCCATCCCTGCCCACTTGTCCCAGAACGTGGAGGCCGCAGCAGCCACCCAAGGTG
GGTGTGGCCTGACGGTGAAGGCAGGGCGGGCGGCAGTGTGGTTTCTTGTCTTACTGTTTC
CCCGCTGGTGCTGTTGGGTCTGTCTGGAAGTCCTGCGGTGTAGGGCCTGAGGGTGAGGAC
CGTGGAACCTAGCGAGGCTGTGATGGAAAGGGGACACCGTGGTCGCTGTTTCTTTTCCCG
GGGTTGAGGATACTCAACATTATCCCCGTCACTGCTTTTATTTCCTTTAATTAGTGGCAG
TATCTGTGCCAAAGAGGAGACGGAAAATTAAGGACCTGAATAAAAAGGAGGCTGTGGGAG
ACCTTCTGGATGCCTTCAAGGAGGTGAGGGGGCGGAACACAGGGCAGGGGCAAGGGTGGA
ATTCGGGTGTGGGACAGTGGTCATTGCAGCCCACACTGTGTGTGCTCTGGCTGCAGGTAA
GTCCAGCAGTGCCAGAGGTGGAGAACCAGCCCCCTGCAGGCAGCAGTCCAGGCCCAGAGA
CTGAGGGCAGCAGCGTGCCCCCTCGGCCCGAGGACGCAGACGAGACTTGGGACTCAAAGG
AGGACAAAATCCACAATGCAGAGAACATCCAGCCCGGGGAGCAGAAGTACGAGTATAAGT
CAGGTACGCTGAGGGAAAGGTGGAGGATGGCCGAGTGGACTCGGAGCCCTAGGCGACTTT
GATGGGTTCATTCTCTATCCCGTGCAGATCAGTGGAAGCCTCTAAACCTGGAGGAGAAGA
AGCGTTACGACCGTGAGTTCCTGCTTGGCTTTCAGTTCATCTTTGCCAGTATGCAGAAGC
CGGAGGGATTGCCCCATATCAGTGATGTGGTGCTGGACAAGGTTGGCGGCTTGAGAGGGA
GGAGAAGTCTGGGCCGGATGGGCTGGGAAGAAGCCTAGGTCCTGAAAGAAGGGTCAGGAC
CCTCGCCCGCCTCTGAGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAGCTGACACCTCAGATGTTCCAGCAGC
TGATGAAGCAGGTGACACAGCTGGCCATTGACACCGAGGAACGCCTCAAGGGAGTCATCG
ATCTCATCTTTGAGAAGGCCATTTCAGAGCCCAACTTCTCTGTGGCCTATGCCAACATGT
GCCGCTGCCTCATGGCGGTAAGTTCCACTCTTTCCCCACTCTTTCCTGAATCTCGTGGCC
TGGCTCGCCCTGCTGTTCCCCATTCCTTGAGCCCCGCGTCTTGGCCCCTCAGTCCTGTGC
TGTGGCTAGCAGGCAGGAGGAGGTAGAGCCGGGCCAGAGGTCTTTCTGGGAGTGGCAGTT
ACAGACTCTGGAGGGCCCTTCCTGCCTGGACCGGTCTGAGTGACGTTCACGTTGACTCAC
AGCTGAAAGTGCCCACTACAGAAAAGCCGACGGTGACTGTGAACTTCCGAAAGCTGCTGC
TGAATCGATGTCAGAAGGAGTTTGAGAAAGACAAAGACGACGACGAGGTTTTTGAGAAGA
AGCAAAAAGAGATGGACGAAGCTGCTACGGTGAGAGACCCCAGTGCCAGCTGCTGTCCCC
GCCCCTCGCCCAGGCACTGCTGGGCTTCTGAGTTTGGGGCCAGTGGTGTCTTCCCTAGTG
CTGCTGCTAGGTTGGATGGCCAAGTAGTAGGGAGGGAAGGGTGTTGGCTGAGTGGCTTTG
TCCTTTGACGTGCTCCCTGTCCTGACTGGCAGGCAGAGGAACGGGGACGTCTGAAGGAGG
AGCTGGAAGAAGCTCGGGACATAGCCCGGCGGCGTTCTTTAGGGAATATCAAGTTCATCG
GGGAGCTGTTCAAACTGAAGATGTTGACAGAGGCAATAATGCACGATTGCGTGGTCAAAC
TACTCAAGAACCACGATGAAGAGTCCCTGGAGTGCCTTTGCCGTCTGCTCACTACCATTG
GCAAAGACCTGGACTTTGAGAAAGCCAAGGTGGGTGCTCCTGCATGTGGAAGGGGCTGGG
CTGACATGCAGGACCCAGGAGGCTCAGCGCTCGAGCTGTGAGTCTGAGGAGGGGCGAGGG
GCAGGGCCTGCGGTTGGAGGTGTAGTGTTGGAAGGCCCTGACCTAGCCCCTGCTGCTCCT
TCCTAGCCCCGAATGGATCAGTATTTCACCCAGATGGAGAAGATCATTAAGGAGAAGAAA
ACGTCATCCCGCATCCGCTTCATGTTGCAGGACGTGCTGGATCTGCGACGGGTGCGTGTC
CTCCTCCACACAGCCCTGCTCCTGTCCCCAGGCCGTAATGCTGCCTTGTCCGCTCCTTCC
TGACAGTTACCGCGGGCCTTATATCTCCACAGAGCAACTGGGTGCCCCGCCGTGGGGATC
AGGGCCCCAAGACCATTGACCAGATCCACAAGGAGGCAGAGCTGGAGGAGCACAGGGAGC
ACATCAAAGTGCAGCAGCTCATGGCCAAGGGCAGCGACAAGCGGCGGGGTGGCCCCCCAG
GGCCCCCCATCAGTGAGTGGAGGCTAGGGTCCAGGTGGGAGTGGGGAAGGACGGGGGCTT
GTGCCTTCCACTGATGACTTCCTGTTAGTGCCACGTGTCTGGGCCACTGAGACCCCATGA
TGGAACTGAGGATCTGAGGAAGGGAGCTGGCGTGACCTGAGGGGGGCCGCGAGGACTGAC
TCACCCCAGTGTTTCCCCCTTGGTGTTCCAGGCCGTGGCCTTCCACTCGTGGATGACGGT
GGCTGGAACACAGTCCCCATCAGCAAAGGCAGCCGCCCCATTGACACCTCCAGAATCACC
AAGATCACAAAGGTAGGAGTGTGGGCGGGGCCATGCGGTGAGGGTGAGAGGACCGAGCAG
GCTCTAAGCGCAGGCTTGCACCTTAGTCCCCTCACAGGGCTAAGGCCGGGAGTTTTCGGT
GAGTTTTCCAGTAGCCTAGCTGCCCAGATTGCCAGAGAAAGGACTGCTAGCCCCAGGGTT
GTGTTCAGTGAGCCTGGGCCAGGGGTCAGCAGACTGACACATAACTGAACATCATCTTAG
ACTGAAAATGTCAATGCTGTTTTATGATGTTGAAATTACCTTATATTAAAATACAGTGTC
TGTTGGGAACAGCAGTTAGCATAATGGCTATGTCGCTGGACTCCCATGTAATCGACCGTG
GTTCGAGTCCTGGACCCGGTGACTTAAACTCACGCTGGGCATGTGTGTTTGCATGCCCAA
GATCCCGAGAGGAGAATGGAGAAGGGATCGTGGCGTAGCCATCCCCCCGGGGGGGTGATT
TCTCGCTTTCTGTCTCTTATCTCTGTCTGGTGAATGCACTTGCCCTGTAGCAAAAAACCT
CTCCAAAAAAAAAAAAAAAAATTCAATGTCTGTAAATAAAGCTTTATTGGCCGTGGCCAC
ACTCACTCTTATCAGGTATCACTGGCTTCTTTCAAGCTGCAGGGCAGAGCTGAGTAGGTG
TGATAGACCGTATGGCTGCGACTGAGCTTGCCCGGCTCCTATTGGGGCCGCTTACTTGCC
TGTGTGGCTGCACGTGGTGGTACTGGCCGAGGGTTGGCCAGGTCGGGTCTGTGACTCTCC
TGTTCCCTCCTCAGCCTGGCTCCATTGACTCTAACAACCAGCTCTTTGCACCCGGAGGGC
GGCTGAGCTGGGGCAAGGGCAGCAGCGGAGGCTCGGGAGCCAAGCCCTCAGACGCAGGTA
CGGAGGCCCCGTGAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTGAC
AGCTCCCTTCTGCACGTCTCAGGAGGCAGTGCAGTGTGTGCAGGAGCTGGCCTCACCTTC
CCTGCTCTCATCTCGTCCGGCACGGCATCGAGTCCACGCTGGAGCGCAGCGCCGTGACTC
GCGAGCACATGGGGCAGCTGCTGCACCAGCTGCTGTGCGCCGGCCACCTCTCCACTGCTC
AATACTACCAGGGGTATGCCGGGCCCGTGGGCCTCAGGTCTCCCTGTGTCCTAGCCTCAG
TGTGCTGGGCTCCTTGGCCATCCTGGTTGGTACTAATTTGGGAGGGTAAGGGTGTCAACT
GTCTGAGGACTCATAGATGGTCTTGGCTGGGCGGGCTCCACGGTTTATCCTTTATCCACG
CCATGTTGCCCCAGAGGAGGTGAGAGCCTGCCCCATCTTCCTGAGAAAACTGACTGACTT
CCCTCTGCAGACTGTATGAAATCCTGGAATTGGCTGAGGACATGGAAATTGATATCCCCC
ACGTGTGGCTGTACCTGGCAGAACTGGTAACGCCCATTCTGCAGGAAGGTGGGGTACCCA
TGGGCGAGCTGTTCAGGTAAGCCCCCCTTGCTGGGACTCAGGGAGGGTAGAGACAGGAGT
GTGGCAGGTTGGATGTATGGGTTTGCAGAGGGATGGAGTGGTGGAGAGAGGGCCGTGGAG
ACGTCAACACCGGGGATTTCTCTCCAGGGAGATCACGAAGCCTCTGAGACCCCTCGGCAA
AGCGACTTCCCTCTTGCTGGAGATCCTTGGGCTTTTGTGTAGAAGCATGGTGAGTGAGGC
ATTTGGGGGTGCGCTCAGGGCTCCTCGTGAACGGCTTGCCGGGCTGTAGCGGCCCTGGAG
CCTCGGGCGGAGCAGTAGCGAGGGCAGACTGCTGGCACCGGGAGGGAGGAGTGCCCAGGT
GGCAGGCTCCTTGCAGTTCTGCCACACGTACTGGCCCGGGCAGTGTACGAACGAGGCCTG
TGTTGGGTCCGTTCGTTGATTTACTCATTCTGCTAGCGTTTCATTGAACGTTCGTCAAAT
ACTGAGTGTACAGTAGTGAATAAAACTCAGGAAATGAGCTGGTACAGGAAAAAGCAAGAA
ATGACAGCTTAATAAAAACAACAGCGTGAAGTAAAGTGTGAAATAAAGTAGTTGAAGGGG
AGTGTCTTAGGTACTTTGAGATTGCAAAGGAATATTTGGCAATATTCATGACAGGCCTTC
TCCTGAAGGGAGTGTGGCTGCTTTGTGAGTTACTCGGAGTGTGAAGGCGGGGGGCGGGGA
AAGACAAGTGAGGTGTGCTGCTTGGTGGTGGGGTGGGGTGTGCATTCCTGGGGTTCAGCT
ACCTGGAGTCTGGAGGAATGAGACTGGGGAGCAATTGTTCTTTTAGTGTCACAGTCCTTT
TAAATGGGTGTGTGTCAGGACAGTTTCTTTTCAAAGTAAGTGTGATGGGTGGATCCCATG
TGGCTAACTGTAGTTTCAGTCCCGGTGTCAGCGGCCTGAAAACCATGCTGGGCATGTGTG
TGCGGACGAAACCTCCAAATATCCCTGAGAGGAGGATGGAAAAGGGATTGCGCTGTGGCC
ATCCCCTTGGGGGGTAATCGCTCGCTCTCTCTGGCAAGCATACCTGCCCTGCAGCAAACT
TCAGGGGAAAAGTATTGGACATTGAATCCTGTGTGCTGCTAGGAAGGAAAAGGACTTGTG
CAGTACATCAGCCAGCCCAGTTAGCTTGCTTTTCGTGACGGGGCCAGACGGTCGTGCAGA
GATGAGACGGGGCTCTGTGGGTTGACCGCGGGGAAGGTCCCGAATTGCTGTCTGCAGGCC
TCCCTCAGTACACCAGGTACTCGTGTGCCTGGATTGTGGTGCTGGGCACCTGTTGAGGGT
ATGGTAAGTTTTCTAGGGGCCGGCCCCATGCGCTGTAGCTGGGAGAGCAGGGTCTACATG
GCCGACGGGCCCACATACTGGCCACAGTGGTTTAAGCACGCAGGCGCACATGCACCCGAG
GTCCTCACAGGCTGAAGGGAGGAGGACGCAGTGCAGTTGCATCGCTGTGCATGGAGCATG
GGCGTTCTCTCGAGTGCACACGTCCTCTGGCATATAAGAAATAGAAATGTTTTGTTTTTG
GGGGGACTGGCCCTGTAGCCTAGTGGTTATGGGAACTGGATCTCACATGACTTTGTGATT
TGCATCCTATTCCTGTGACTTAAAAAACACGCCAAATGTATGTGCTTGCATGCTCCAAAT
CCTGACAGGACTGAGGAATGGAGAAGGCATTGTGGCATGACCACACCCCATTGGGGGTCC
CTTCTTTCACTGTCTCTGGTGGAGTGTATGTACTTTTTGACAAATTTAAAAAAAAAATTT
AATCACATTTATTCTTAACTATTTTTTAATTTGATCAGAGAGGGAAAGGGAGAAAAAGCT
ACCAAGTTCAGGACTCGAACTACTGTCAGTCACATGGGAATCCAGTGCACTTAACCACCA
TACCACCTGCTGTCTCCTCGATTTATTTATTTATTTATTTTATTTAGTTTAGATTTTTGC
TATAGGGTGCGTGTGCTCGCCAGAGAGATACAGAGAGACAGAAGTGAAAAATGACCCACC
AGGGCATAGCCATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGGTCTCTTGCCCCTTGCAGAAAATGGGCTCACAACTGCTCTTGTTTGTAGGGATTT
CTGATTTATGTTGGGGATGTGTCTTCTAAGATTTTCGGGATTTAGGAAATAAATCAACAG
GCTTATTAGAAGTTGTCCATTTCTGAAAACAAATGGCTATTACTTGGAATAATGAAAAAC
CAAGTTTTTTTTTTTTAAAGAATTATTTATTTGTATTATTATTATTTTTATTTCACCAGA
GAGAGAGAAAACGAAAGTGAGAAAGCAAGCCGCCAGGTCTAGGAATTGAACTGTAGTCAG
CCATGTGGGAGTCCAGTGCTTTGACCACCATGCCACTGGTTGGACCCCTTGCATTTTTTT
TTAAAGACAGTTTTTTTGCTATAGGACGTGGGAGCTTGACAGATGGGAAGTGAGAAATCA
CTGCTCCCCGCCCCAAGTAGGGATGGCCACACTGGAGTTCCTTCTCCATTCTGCTCTTGG
GATTGTGGGCATGCACGCATACCTGCTGGGCATGAGTCTAAGTTGCTGGGTCCAGGACTT
GAACTGTGGTTGTCTATGTGGGTGTCTAGCGATGCAACCATTATGCCATCTGCTGGTCTC
AAGCCAAGCTGTTTTTGAAAAATGTTAGGTGAGAGGCCTCCAGGTGGCGTTGGTAGTTAA
GGCCACTGGACTCCCACATGGCTGATTGCTGTTTGAGTCTTGGACCTGGCGGCTGGCTTT
CTCACTTTTCCCTCTCTCTCTGTCTTTCTCACTCTGTCCCTCTCTGGTCAAATTAAAATA
AATAAATAAAGTTAAGTAAAATAGTTCTTTTAAAAAGGGGAGAGATTAGAAGGCTAAGGT
GTCTGTTTACCTTTTGTTTGTTTGTTTGTTTTGGGGGTTGAGGGGATGTTTGCTTTAGGA
GGGTATGTGTGCTTGCCCGGAGGGGAGAGGGAGACAGCAACAGGAAAAGAGAGATCATTC
CCCGAGGGGTGGCCACTGCACAGTCCGTCTCCGCCATTCTCCTGGGATCTGGGCAGGCAC
GCACACCCACCTGGTGTGATTTTTAAGCTATTGGGTCCAGGACTCGAACCGTGGTGAGTC
TAGCAGTGTAACTGCTCAGCCACGTGCTGGCTCTGGTTTAGCTTTTCGAGGCGAACAGTA
ATTGAGAATCCTGTGAAAGCTGATTGATGTTTTTCTACAGGCTCCTAGCCATTCTCCCCG
CCTCAGTGTCACTGCAGTGTGGGGAGGACAGGGCCTTGTTTCTTTGGTTGTCTGACTGCT
GTGCCCTGCACTGGGCTGGGTGTGTGGAGGGTCTCTGCCTATTTGGTACTTCTGTGGCAT
CTTTAGCTCCTAGCAGGTACCTCGTGGGCTTTCAGTAAGTATTCGTTAGGTGACTGGTTG
TTGTGGGGCTGGTGGGTCCTTAGAGGGCTTGCTGAATTGGTTTTGTGTTTTCTAGGGCCC
CAAGAAGGTGGGGACGCTCTGGCGAGAGGCTGGGCTCAGCTGGAAGGAATTTCTGCCTGA
AGGCCAGGATGTTGGTGCATTCGCCGCCGAGCAGGTTTGGGACTGGAGTTGGGTTAATTC
TAGCATTTGAAGGATGACAGTCTCTTCCCTCTCCTCTCATCTAACACGTGAGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 1033..1119, 1313..1412, 2689..2801, 3459..3551, 3753..3819, 4089..4916, 5154..5242, 5336..5522, 5607..5740, 6087..6245, 6346..6531, 6779..6976, 7202..7348, 7532..7768, 7926..8030, 8132..8291, 8491..8591, 9374..9476, 10028..10130, 10231..10463, 10564..10682, 11242..11286, 11289..11291, 11294..11412, 11650..11775, 11907..11988, 16915..17013
1001..1030, 1033..1119, 1313..1412, 2689..2801, 3459..3551, 3753..3819, 4089..4916, 5154..5242, 5336..5522, 5607..5740, 6087..6245, 6346..6531, 6779..6976, 7202..7348, 7532..7768, 7926..8030, 8132..8291, 8491..8591, 9374..9476, 10028..10130, 10231..10463, 10564..10682, 11242..11286, 11289..11291, 11294..11412, 11650..11775, 11907..11988, 16915..17013
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved