Tupaia_belangeri Locus CWF19L1
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri CWF19L1
Tupaia_belangeri
CWF19L1
GeneScaffold_2251
SNORA12
32292..32439
35939
GTTGTCCAAGTGTGAGTCCAATGCCCTAATCACCACACCATCTGCTGCCCCCCACCACA
CACTTTATTCTTAAGAAATGCGTGCTGAGCATTGGAGTCTGTCCTCCCTTCTAATGATTC
AGTGAGAATAAAAGTGCTCGGACACCTTGAAAGAAAGCCAGGGAAGCCAATTTGGCAACA
TGCTGGTACTTACTGAATCGAGGTGACTATTCGTTTACCTGTACGATAAAAACTTACAAA
GGGACCAGCAGGTGACCTGGTAGTTAAGGGTGCTGGACTTTCATGCTGACCATGGTTTGA
GTTCAGACCTGGCAGCTTGCTTTCTCACTCTCTTTCTTACTCTGTCCCTCTCTGGTCAAA
TTAAAATAAATAAAGTTAAATAAAAAAATGGGTCCAGCAGATGGTGTAATGGATACGTCG
CTGGATTCCCATGTAATCAACTGCAGGTTCGAGTCCCTGACCATGGCTTAAACTCACGCT
GGGTGCGTGTGCGTGCGTATCCAAGATCTCGAGAGGAGGAGGAGAAGGGATTGCAGCGTG
GCCACCCCCCTGGGAGGTGATTTCTCGTTTTCTGTCTCTCAGTCTCTCTCTTTCAGGCGA
GTGCACGCACCCTATAGCAAAAACCTCTCCAAAAACAAAACAAAACAAAACTTACAAAGA
GCATGGAGGGTGTGTCTTTCACATTAGACACTATCGCTAGATTAGGGCCCAACATTGCAC
CAGGAACTTTCTAGCAGCTAACTAAATTCAATTAACCCGACATTAAAAAACAAAACAAAA
AAAATTAGAATTCATTCGATCATTTCTTCCTTTGCTCCTCTCTTCTTGAGACGCAACTGT
CTGCGCGAGGCTTTGGTCCCTCGGCGCTCTCCGTAGTTGACTGAGCCCTCATTGGCTGGA
GGACGCTGACGTCTTCTCGCCGTGTGGCCGCCGTTTTCCGAGTGCTGTCTGTTCGGGTTC
CGGGTTTTCGGTGGTCTTCCTACCCCAGGCACTCGGGACCGATGGCTCAGAAACCGCTGC
GCCTGTGAGTGACTGTGAATCGGAAACCCGTGCGCTCGCGTGTGCGCGTGTGTGTACATG
TGTGCGCGTGTGTCCGCGTGTACGTACAGAGACGGGCAGGGCTGTTTCCCGTGCCTGGAA
AGGAGCAGGAGGCAGGGGCCGAGGGCGCGGGGCACCGGGGAGCTCCAGCGGGTCTGCCCG
CCGAGGGGCCGTCTCTTCTCCCGCTTTCCCCCGAGGACTCTTGGCGGCTCTGGCTGGGAC
GGGCGGAAGCTCCCGAGCCAGGTCTCCTCCACGGTGGGCAGTCGTGGCCTCGCATCTCCC
GTCCGCTTCTCCCCTCACCCCACCTACCTGTTAACTAAACCCTTGACATCGGCCCATTGC
TGGGCCCTGGGCGGTGCTGGACAGGATCCACAGCTAGGACCCCGGCTCTGCGCACTTTTG
GGGAAGGAGGACAGGGGGTAGAGAAGAGCGGGCTTCATTCATTCACTCATTCATTCATTC
ATTCATTCATTCTGCAAGTTAGTTTTTGAAGGCCCATAGTGTGCCGGGCACTGCATACAC
CGAGTTCCTGCGGTAATGGAGTTTATGTCTAGAGGAACAAAGAATCCAGATAAACGTGGC
ACTGCGATTGTGATAAATGCCAGGAACTAACGGTTCACTACTGGGAGGGTGTGTAATAGG
GGCATTCGGTTTAGTGGGAGGAATCAAGGCAGGGTTCAGAGAGAGTGCCTCACTCTGGTT
AGTATTTTTGTCTTTAACTTTAAGCCTTGAAATCTAAGAANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGCTGAAACTGCTCAGTGAAGGGGACAATGCAAGCATACCA
GCAGAGCATACTGACACACTGTAAGACTAGTTCAAGATGAGTTAACAGACATTAAAAGTG
ATGTAAGGAACGGGGGGGGGGGATGCATATAAATTAGAATGAGAAAATCTCAGAAGTGAG
ATGCTAGAACGGACGAATTCATTGCTTAGGGCCAGTTCACCTTGTCAACCTCAGCTCATG
CCATTTCCTACTTCCTGCCCCATCACACGCTACACCTCTCTCCTACTATAGCCCTTTCTG
TATAAACTGATAATGATGAAAATGTCTTCCCTTCCCTAATTTTCAATTCCTTGAGACTTG
AACTGAGTCTCCCTCCTTACTGTACTCCTAACATTTCTAGTACAGGTTTATGGAATGAGC
GACCGCAGCCTTGTACTAGATAATGCAGTAGAAACTAAAAAGGAAAAAATAAAAAAGAAA
GAAAAGAAAAAGAAAAAAGAAAAAAAATAAAGAAAAAAAGAAACACAAAGGACAGATTGA
GCGTGGAAAATGTTTGGAAAAGGGTATTGATAGGACTCAGTGACTGGATGGGGGGTTTTT
GAATGTGGGGACAAGTCAACAATAGACCCATGCACAAATTTAGGATTGAGGAGAAGTTGG
GTGACTGTGGAGGATTTGATAAGCTCAGTTTTAGATGGTGAACTAGAGGTGTGTTGAGGC
CTTTAGCCACAGCTGCCCAGTGGACAGTGCTTGGTCACAGGCGTTGAACCTCACAAAGTA
ACTGCAGAAAGTCTGAATCACATGTATCTACCTATTCCAGAAGATTAGAATATTCCCAAC
TCAGACTGTTGGTGTTTCGTATTTTCTCAGTTGCCATAACATTTATCTCTCATTCACAGC
TTGGCTTGTGGAGATGTTGAAGGAAAGTTTGATGTTTTATTCAATAGAGTTCGAGCAATT
CAGAAGAAAAGTGGAAACTTTGATGTAAGACATTTCTTTTATACTGGGTTTAATTTTACT
ATTGTCAAACATACCAAAGTAAAGGCTGGGCTCCTTTATTCATTTCTTGAGGGAAGACTT
GCTTTCCTTTTTTGTTAGACTGAGTTCCTTTGGTGAGCAGAGGAACTCAGTAGCTGTTGA
CTGCTGGGAAGGAGGTAGACTTCCTTACTGTAGATCTTTTTATACTTCTCCAATGTGAAC
CTTGTTACTCAGTTACTGTGTAGAGAACTGAAACAGACTAGCAACACCTCCCTAGGTGAT
TCTGACCCCTGGGGTTGGCATCAGTGCATGGTCTGAGTTAAGTCCGATGATATATGTGCA
AATGCTTCACAAGCTGAAGAGCCCTACACAAGCATTATGTAGAGCTGCCAGCTAGACGAT
GCATTCCTGGAATACAGAGGAATATTTTAGGTACAGGATAATTTGTTCATTGAGTTAGAG
GTTGAGTAAAAATAATAGGCCAAGTGGACTTGTATCTCTGAGCGTATCTGATATTGTAAG
TTTATATGCAACAGAGAGATTCTTTAAAGGCCTGTTTCCCTCTCACTGTGTACTCTGAGG
AAGAAGGAAGGGGGAGAGAGCCATGGGATGGCGGAGTGGGACCAGGACTATTTGAGGAGC
CCTCAAATTCGACTTCTTTTGAAAGTTCAGTTCCCTGACTCCCCCTTCTCCATCTCCAAC
TTGAATTTAACAGGCAGTGAGCAAACATTTAATAATTCATAGAATCAGTAACAGGTATAG
TTGCTTCCAAAGAACTGTGTGTTAAAGTTCAGCAAATTGGTTAAGAATAAAAACCTGATA
TGAGACCGTTAAGCAGGATAATTAGCTAAATGCTATCAATGATAATGTTGTTTGATATGT
AAAAAACTCATATATCTGTTTAAAAAACTCATTTTAGCTGCTGTTGTGTGTAGGAAATTT
CTTTGGCTCCACCCCAGATGCCGAATGGGAGGAGTATAAAACTGGCGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAG
GCCTGTTTCCCTCTCCACTGTGTACTCTGAGAGAAGGAAGGGGAGAGAGCCATGGGATGG
CGGAGTGGGACCAGGACTATTTGAGGAGCCCTCAAATTCGACTTCTTTTGAAAGTTCAGT
TCCCTGACTCCCCCTTCTCCATCTCCAACTTGAATTTAACAGGCAGTGAGCAAACATTTA
ATAATTCATAGAATCAGTAACAGGTATAGTTGCTTCCAAAGAACTGTGTGTTAAAGTTCA
GCAAATTGGTTAAGAATAAAAACCTGATATGAGACCGTTAAGCAGGATAATTAGCTAAAT
GCTATCAATGATAATGTTGTTTGATATGTAAAAAACTCATATATCTGTTTAAAAAACTCA
TTTTAGCTGCTGTTGTGTGTAGGAAATTTCTTTGGCTCCACCCCAGATGCCGAATGGGAG
GAGTATAAAACTGGCGCCAAAAAAGGTATAGAAATATTTTTATTGAATGTACAGTTTCTA
ATGATATTTTAAAGGCTACAGATCTTTCTGGGTTGTTGCCTGCTGCAGTTATTTAACCTT
TTGATTTTGCATTGATCGGGAAGGAGAGCCTATGCTTGAGGCAGGTGAGTGGCGTGATGG
TTAAGGTGCTGACTCCCACATGGCCGATCATGGGTTGAATACTGGGCCTGGTCAGATTAA
AAAAAGAACAATAATAACAAATAAAATAAATAATTCTTTTTTTTGTTGTTGTTGTAAAAT
TTTTTTTTTAACATTCTTTTTTTTTTTTTTGGAGAGGTTTTTGCTATAAGGTACGTGCAC
TTGCCAGGAAGACAGAGAGAGACAGAAAGCAAGAAATTATCCCCCGGGGGGATGGCCACA
CTGCAATCCCTTCTCCTCCATTCTCCTCTCAGGATCTTGAGCATGCATGCACACACACTG
AGTCTGGGACTCGAACTGTGGTCGACTACATGGGAGTCCAGCGACATAGCCATTACGCCA
ACTGCTGGTTCCTCCAAAATAAACAATTCTTAAAAAAAAAAAAAAGAATGCTTATGCATA
ATCTTCATGTTCACATTTTTCATTTGGTTCAGTTTGGTTCTAGAAAAATAATACTCTTCT
ACATTGGCAGGAACTGAATAAATACAACTGTATGTGTCCTTTCTTTTTCCCAATTTTAGT
ATTTTTTTGTTTTATTTTTATTTATTTATTGCCAGAGGGCATGTACACTTGCTAGAGTTA
AACAGAGAGAGGGAAGGTGAGGCAGTACCCCCATTGGGGCATGTTGACGCAATCCTTTCT
CCTCCATCCTCATCCTTCTTAAGGGATTTTGGGCATGTGTGCATATGCACCCAACATGTT
TTCCAAGCTGGCCAGGTCTGGAAGTAAACTCTAAAGGTGGCCATGTGGGATCCAGCTGCT
TTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGAAGAGAGACAGAAAGCGAGAAATCACCCTCCCGTGGGTATGGCC
ATGCCACAATCCCTTCTCCTCTATTGTCCTCTCAGGATCTTGGGCACGCATGCACATGTG
CCCAGTGTGAGTTTAAGCCACTGGGTCCGGGACTCGAACCACGGTCAACTACATGAGAGT
CCAGCAATACAGCCATTATGCCAATGGCTGGCCCCTCAACTTATTTTTCTCTAAAATGGC
TTTAGCGTCCTTCACATTTCCTCTCTGATGGTTTTATTTCTCTAGAAAGTGTGTCCATAT
TTTGGGACCAGCAGATGGCATAATAGTTACGTCACTGGACTTCCATGTAGTTGACCATGG
TTTGAGTCCTGGACCCAGCAACTTAAAACTCATGCCAGGTATATGTGCATGTATGCCCGA
AATCCCGAGGACAGAATGGAGGAGAAGGGATTGTGGCGTGGCCATGCCCCCTGGGGAGGA
GGTGATTTCTCTCTTTCTGTCTCTCCAGCGAACACATGTGGCCGAACAAGAACAAGAGAA
AGTGTCCATATTTCCGTTGCTGTGAATGTCCCTACTCTTCTTCTTGACCTGTTGTTTCTG
TGTATGGCTATGGCCCTCACGGAAACAATCTCGTCTTGCTCCAATCATGTGCGTCTCCTT
TAGGTGAGATTTTATGTGTTTGCTGTCATTGTCATTTTTTAAAATTTGCCAGAAGGTGTG
TATGCTGGCCAGAGAGAGACGAGACAGAGAGAGGGAGAAAGCACCCCATGGAGTGTGTTC
ACACTGCAGTCCCTTTGACTCCATTTCTTCAGGATTTGGGCCTTGCATGCACCCATGCCC
AGCCCGTTTTTCCAGCTGCTGGGTCCAGAATTTAAACTGCAAGGTCAAATCGATATTGAA
GAGAGTAGGTTCTGGGGAACTGGTCCTGTAAAGCTGAGAAGTAAAGCTGAGAAGAGGGTC
AGATTGTTGAGGGAAAAGCAGAGTGAGAAGGGAGGCAGGTGGACGACAGTGTCCGTGGGG
CGGCGCACCTTCATCCAAGGCGGAGGTGAAGAGGAGTAAAATCGCTGAGAAGACGGAAGG
GGTCAGGTATGGTTAGGTTCGTAGAATCTAAGTGAAGAGAACGTGGTTTCAGGAGAAGAG
ACCTGTCGTGCAAAGTAGAGAACACTTAGGTTTCCTCAAATGCCTTCTCTTCTTCCTCTC
TGTGTTACATAAAGCCATCAGTTTCACGGATTTCCCCGAAAGCACTGAAAGACTCTGTAA
GCGCCTGCAGACCCAGTGTTCCTGAGGCCCTGACCCTCTTTGCAGTGCCTTCTCCAAGTT
GCCCTGACTGAACCTTCTCGTGCTGCCATTTTGACCCCTCTCTGCCTGTCATTCCTTGGA
GTAGTTACCTCTCCTAATAGTCCCACCCTCCCCATTCCGAGTCTTAGTTTTCCCCCTCCT
TCAAGGCCTGCACGCTGCTGAAGCCTTCCTGATGATTCAGAAAGCCACTTTCTTCTAGGA
CGATTATTGGCCTTATTGGAGTGGTGAGAGAGAGAGACTAGATTACCTTGGGTTAAGGGA
TTAAGAGGCCAAGCACTTAGTGCGGGCTACTCTTGAGAAATTTTAGACTGAAGAAGAGAG
ACTTCTCAGGGTTGAGCATACTCTATTTTTTTCTAAACAAAAGAACGAGTTGAGAAGAAG
AGACGCAGTAGGTGAAGAGGAGGTGAAAATCGGTAGAGCAAGGCCTTGGAGGTAACAGCA
AAGAACGGAATCAAAGCCATAGCCAGGAGTAACTTTAGAAGAAAGTCAATTCCTCTAATT
TTCCCAGTTTCTCTTTCTTTTCTGTCCCTTGGGAGCTGCTGCCTGCCTGGTGAGCACCTG
TTTTCTAGCTGATAGCTTCCTTAAGACTGCAGGGTGGGTTTTTTTTTTTTTTTTTTTTTT
TTTGGTCTCTTCTGATGTCCAAGAATCAGGCTTCTGTTCATCCACGTAGAGTCTTCTCTA
GAGGACAAAAGGCCTTTTCTTTTCTGTCCCGGAGAGGGATAGAGCAAGAGAGAGGGAAAG
TGAGAAAGCAAGCTGCCAGATCCAGGACTCGAACCGCAGCCAGCCATGTGGAAATCCAGC
AGCCCTTACATCCATAGAAGTAAAGGCACTAGATCCAAATGACCATCTGCGTGGTTCATG
TCCTGGACCCAGTGGCTTAGAAACTATGCTGGGCGTGTGTGTGCGTGAGCCGAAAATCTC
AAGAAGAGAGTGAAGGAGAAGGGATTGCAGCATGGCCATTCCTCCTGGGAGATGATTTCT
CACTTTGTCTCTCTATCTCTTTGTTTCTCTCTGGTGAGCAGGTGTGCCCTACAGCAAAAA
CTTAAAAAAAAAAAAAAAATCAGTGCTACCTAACATTTTGCAATAGTATGTGCACGGCAT
GTGGCATAGAAACATCTGTTTATGTGAGATCCTTTCAAAAGCTTAGCAGAAATGCTGTGG
TGGCCGTCAGCCTCCATGTTCCTTCAGGCGTATGGAGTGACAGGGACATTGCAGAGCCGG
GACACAGGGAGAAAGATCCATTGCCACAATCAAGGCATTTCATGCTGCACTTTTGACTAA
AACTTGTCCTTTTCTCTTTGAACCCAGGTCGGAAAGGCGTCTTCACTGGAAGCTCGGGGC
TGCAGGTCGCGTACCTGAGCGGGACCGAGTCCTTGAGCGAGCCAGTTCCAGGTTACAGTT
TCAGTCCCAAGGACGTGTCTTCCCTGAGAACAATGCTGTGCTCAGCACCCCAGTTTAAGG
GTGTCGATATCTTGCTCACATCCCCGTGGCCCAAGTATGTGGGGAACTTTGGGAATTCTT
CTGTGAGTAATGCCTGTTCAGTTGGACTTTTCTAAAAGCAAATCTTACTGGCTTACATTG
GACTTTTTTTCCCTTCCTATATTGAGTATCTTAGCTCTTGGTACCTTTCACTGGAAGTCT
TTTGGGAAATTTTTAGGATTCTGAAAGCTATATTGATGAAAAGCAAAAGCTGATTTAATA
GAAGTGTGGCTCACTGATGCCTTTGCAGCAATCTTAATTATAAATGAATGGTTCTTTAAA
TAGACCCTTTTTTGGGAGAGATTTTTGCTATAGGGCGTGTGCATTTGCTGGAGAGACAGG
GAGACAGAAAGCAAGAAACCACCCCCTGGGAGAGATGGCCATGCCACAGTCTCTTCTCCA
TTCTCCTCTTGGGAATTTAGGCATGCATGCACACACGCCCGGTGTGAATTTTAAGTTGCC
GGGTCTGGGACTTGAACCACAGTCGACTATGTGGGAGTCCAGCAACATAACTATTATGCC
ATCTTCTGGCCCTTCAGAATTTTAAAAAAATTGAATTATGGGGGCCAGCAGTTGATGTAG
TGGTTGCATCGCTGGACTCCCACACAGTTGCCTGTAGTTGGGGTCCCAGTCCTGGTGGCT
TCAAACACTCCCTGCCAACTTCAGCACCATGTGTTCAGCACCCAGGGAGGCCAACACTGT
GAGGGAGGGTGCTGAAAGGAAAAGGCCCCAGTTATGTTTACCCTCTTGTATGTGAGGTAG
TGCTGGTGACAGTGAGGATAGAGATCAGAGCTGGGGACATTCCAGAGAGGGGCCACTGAA
GCAAGGTGGGAGGAGGAAGCATGATGCTCTGTGAGGAACGATGAGAAAACGAGACCCCTT
CCTTCTGGAGGGAGTTTAAAGGGAATGTTGATCAAAGTTTATAAATAATCATACAGGGAC
CAGCAGATGGCATAATGGTTACGTTGCTGGACTCCCACATGGTTGACCACGGTTCGAGTC
CTGGACCCGGTGGCTTAAAACTCAGGCCAGCCTCCTGTGCACGTGTCCTCAAAATCCTGA
GAGGGGAATGGAGAAGGGATTGTGGTATGGCCGTCCACTCAGGGGTGATTTCTCAATTTC
TGTCTCTTTGTCTCTCCTGTGAGCTCATGCAACCTATAGCAAAGGTCTCTCTAAAAATAA
GTAAATAAATAACCATACAAAAATTATTTTTAAAAATTTTTGCCGTAGATGTGTTCACCA
GAGAGAGACACAGAGAGGGAAAATGAGAAATCATCCCCCATGGAGACAGCCATACTACAA
TCCTTCTCTATTCTCACCTTGGGGTTTTGGGCACACACGCACATATGCCTAGCCAGAATT
TGTTAATTGCCAGAGGGCGCACTTGTCAGAGAGAGGGACAGAGAAAAAGAGAAAACACAG
AGGGAGAAAAAAGCACCCCCAAGGGAATGGTCATGCCACAAGCCCTTCTCCATTTTTTCC
ATCGTGTCGGAATTTGGGCATGCATGCACATGCACCTGGCATGTTTTCAGGCCACCAAGG
CCGGGTCTGGGACTTGAACCATGGTTAGCTTTGTGGAATTTGCTCCCTTAACCACTAAGC
TACAGGGCCAACCCACCATGCAAAATATCTATGGGGGAGAAAACAACGTAGTTCACCAGC
CCCTAAGAAACTACAGCTGACTTCAAGGCTAGTTCTCTGCTCTTTAGCAGAAAGTCAAAA
GAGGCAGGCGTAAGTCAGAAGGAAGGTCCTTGGGCCCAGCTGTGGTGGCATGCTGTCTGG
ACGGCATGGATGGCCCGGGTTTGGTTTCTGATCCAACCCAAAGGTTTGTGCCTGTAATTC
AGCCACCATGGAAGCCGGGGCAGGAGGGTAATAGTTGGAGCCTGGCCTGGCAACAAAATA
AAACTGTTTCAAAAAGAGCCAGGCATGGTGGCTGCACTTGTAGTCCCAGCTGGGTGGCTG
AGCAGGAGGACTGAGAAACAGTGACACTATGGGAAATAAACATCTAATGTCTCTATCTCC
AGCTAATATCTTACAATAGAGTTTATTAATAACGTTATAGATGAGGAATTGTGTAATTGC
TTATTAACAGAAGCTGGGGATGTTCTGAGAGAAAGCCGGTCTTTTGATAAACTTTGTAAC
GGGGTGGGGTTGTGCCCTTTCACAAACCACCACTTCCTTGACTGAAGCAAAAGAAAGGAT
TGCAGGTTTCTGTGATGAGGCCTTAAATATTCCACACCAAATATTCTGATGATCCTAGAG
ACCCTGAAAGCTAACTCTTTGTTTTTTGTTTTGTTTTGTTTTAGGTTTTTGCCACAGAGT
GTGTGCGCTCGCCAAAGAGAGACAAGAGAGACAGAAGGAAAGTGAGAAATAACCTCCCTG
GGGGATGGCCATGCTGTAATCTCTTCTCCGCCATTCTCCTCCTGGGATTTCGGGCACACA
TGCACACGTGCCCATTGTGAGTTTCAAGCTGCCAGGTCTGGAACTTGAACTGCAGTTGGC
CATGTAAGAGTCTAGCGCCATAATCACCATGCCACCTGCTGGCGCCTACTTTTCATTTTC
TGCATTGACTGTAACTGCACTGTGAGAGCTCCAGGTGCTCTGTAGAGCGCCTTACAGAAG
CAGTCTGGCCACTAGGGAGAGTGGGCTTCCCAGAAAATGTTGTAATAATCAGCTTAGGTA
TTAGTACGAAGGAGTTACTTTTAACTTCTGGTACCCAACACTTGTTCTTATTTCTGCTTT
CATGATAATCCAGTTTCCTGAAGTGTTTGACTTTTCTCTGACTACTATAAGTGTGAAATT
TGCTGTACAGTTCCCTTCTGCCCCATTCATGTCCAGGTATAAATTACGAAGATAGTCCAC
AGTGTCTTGTTACTGCTTTGCATTGTTGATAACTCTTGGGTCTGGATGGATAACTGAATT
TTATTTACTAGGGAGAAGTGGATACCAAAAAAAGTGGTTCTGTGTTGGTCTCCAGTCTCG
CCACGAGCTTGAAACACAAGATACCATTTTGCTGCTTTAGAAAAGACCTATTATGAGANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTAGCTGTTTTAATATCTTG
GTTCTTTTGGTTTGCTTCAGGCACCTAAAATGATTAACTTCTTGAGCCATTCGAGTTCTC
TGAGTTTGTTTCCTTAATATGAAATACAAGGGGTTAGACTTCAGTGTTGCTCTTTATAGC
ACATGGGGTCCTGTTTTTATCTGATCGAGCAGATTCTCTTTTTTTTTTTGGAGAGATTTT
CACTGTAGGGCACGTGCGCTCGCCAGACAGAGAGAGACATAGAGACAGAAAGCGAGAAAT
CCCCCCCCAGGGGGGATGGTCACGCCGCAATCCCTTCTCCTCCATTCTCCTCTCGGGATC
TTGGGCACGCACGCACACGCGCCCGGCGTGAGTTTTAAGCCACCGGGTCCGGGACGTGAA
CCACGGTCAACTACGTGGGAGTCCAGCGACATAGCCATTACGCTAACTGCTGGTTCCCGA
GCAGATACTCTTTGTATAGTCTTGAAAACTCAGTTCTAGGTGTAATCAGAGTATTTCAGT
TTGGGATTAAGAACTTGTATTGGGGCTGGCAGGTGGCATAGTGGTTGAGGCCCTGGACTT
CCACATGACTGACTATGAGTCTTGGATCTGACTGCTGGAAACTCCCGCTGGGTGCATATG
TGTGGGTACCCAAAATTCCAAGAGGACAATGGAGGAGAAAAGAATGCCACATGGCATTCC
CTCTGGGGGGTGATTTTTCTCTTTTTCTCTATCTATCTATTTCTCCAGTGAGCTCACATG
TCCTATTACAGAAATCTCTTAAAATAAAAAAAAATAATAACTTTAATTTTTTTTTTTTTT
TGGTTTGGATTTAGAGGTATATTTTTATTTATTTATTTTTAAGAGAGGTTTTTTTGGCTG
TAGGTTGCATGTGTTTGCTGGGGAGACAGAGAGAGGCAAAGAGACAGAAAGTAAGAAATC
ACCCCCCAAGGGGGAATGGCCACACCACAGTCCCTTCTCCTCCATTTTCCTGTTGGGATC
TTGGGCACGCATATACGTGCACCTGGCGTAAATTTTAAGCCGCTAGGCCTGGGACTCGAA
CCATGGTCGACTACCTGGGAATCCAGTGATATAACTATTATGCCATTTGCTGGTCCCACA
TTAAATAAAATAATTCTTTTTTTTTTTTTGGAGAGGTTTTTGCCATAGGGCGCGTGCACT
CGCCAGACAGACAGAGAGACAGAAAGCGAGAAATCACCCCCCAGGGGGGATGGTCATGCC
GCAATCCCTTCTCCTCCATTCTCCTCTCGGGATCTTGGGCACGCACGCACACACGCCCGG
CGTGAGTTCTAAGCCACCGGGTCCGGGACGCGAACCGCGGTCGACTACGTGGGAGTCCAG
CGACATAGCCATTACACTAACTGCTGGTTCCCTAATGCTCGTGTGTTTTGAATGGGAATG
GTGCAGCCTTTTTAGAAAACTGTTTGGCATTTTTGACCCAGCAATTCCACTCTTATTTCA
GGAGAGATAAAGACGTATGTCCATATAAAACTTCTACACAAATGATCATAACAGCATTAT
AATAGCTGAAAAGTGGATCTAACCAGTTGCCTATCACCTGATGAATAGATCAATAAAAAG
TGGTATATCAACAAGGTGGAAGTTATTTGGCAATAAGACGGGTCAGAGTACTGATACATG
CTACAGCATAGTTGGACCTTGAAAACAGTATGCTCAGTGAAAGAAGCCAGACACATAATA
CCACATATTACATGATTCCATCTATATGGAATGTCCACATAGTCAGATCTATAGAGATAG
AAAGTAGGTATCCGTGGAGATGGAGAGCTTGAGGCTAGCCCATGGCCTGATGGTGAAGGT
GGCCAGATCCTACGTGGCCAGATGTGTGGCTCAAATCCCAGACCGGGACAGCTTGAAAAG
CATACTAGCAATGTGTGTTTGTGCCCAAAATCCTGAAAGGAGAAGGGGGGATTGCAGCAT
GACCATGCCCCTTACAGAAGAGCTTTTTTGCTTTCTTTCTCTCTCTCTCTCTCTGTCTCT
GTCTCTTTGGTGAGTGTATGTGCCCTCTGACAAATTAAGGGTGGGGGGAAGAGGTTACTT
AGGGCTAGTTTGAGGTGAATAGGGGATGATTTCTCACTTTCCCTCTTTCTGTTTCTTAAG
ATGCTCACCAGAGAGAGAGCAACAGAGACAGTGAGACGGAAAGTGGGAAATCACTCCCTA
CAGGGGGATCGCCATGCTGCAATACCTTCTCCTTCATTCTCCTCTTGGGATTTTTGGGTG
CACATGCACATGTGCCCAGTGCGATATTCAAGCTGCCAGGTCTGGGACTCTCACTTTGAC
CACGTAGGAATACAGCACTTCAACTACCATGCCAAATGCTGGCCCCTAAACTTTAGGTCT
TGAGAGAGACCCACACATATATGCACACAGGGACCCCTAACAGGGTCTCATTGTGCTCTG
TACCTCACCCTAGCCTTCTAGCCAGCCATGATCATGAGTATACCTGTGGGCAGGCGTGAC
GTGTTCAGGTCAGCCTGGAGTCAGACTCGGGGTCTCCCCGTATGGCTCCAGTATCAGACA
GTGGCACCCTCCCGTCTATGCCGTCACTGCTAGGCTTCTTTCTGGTGTCATTATTTTAGT
TTTTATTACACAGAAGAAGAGGGAGTAGTGAAATGACCCTCCCATGACTTTGACAGAGCT
TCAACACTTATCAACATTTTGCACATTTTTTTTCATAAAGCTGTCTAAGGGCTTCCTTAA
TTCATTTATTTAAGTATAATTTACTGTAGGACACATATGCCTACCCTAGTGAGACACACA
CACACGGGAGGAGAGGAGTGAGAAAGCACCCCACAAGGATGGCCACACCACTAGCCCTTC
TCTTCCATTCTCCTTTTGGGATTCTGGGCATGTACAAACACTCACCCAGCATGTTTTTCC
AAGCATTTGGGTCCAGTACTCAAATCGTACTGTCAACCATGGAGAATCCAGCCACCATAA
CCACTGAGCTCCGGGCTGGCCCCATTTTGCCAATGTTACAACTTTTAAAAAAAAAATTTT
TTTTTTGAGAGGTTTTTTCACTATAGGGCACGTACACTCGCCAGACAGACAGAGACAGAG
AGACAGAAAGTGAGAAATCACCCCCCAGGGGGGATGGTCACGCCGCAATCCCTTCTCCTC
CATCCTCCTCTCGGGATCTTGGGCACGCACGCACACGCGCCCGGCGTGAGTTTTAAGCCA
CCGGGTCCGGGACACGAACCGCGGTCAATTACATGGGAGTCCAGCGACATACCCATTACG
CTAACTGCTGGTTCCCGATGCCACCTGCTTTTGAAGTGCTGGCCTACATGTGGCAAGGGA
TAAGCTATACAGCAATTAGAACCCAGCTCTGCAGAAATCACTTTGAAGGTCGATATTTGC
TTACCCAATACTGTACAGTTAGATTTGGGTGATATCCTAAGTGACGTGCAGCCTCACTAC
CCAGTAACTGCCAAGAGGCCCAGGACCTTTGTCCCGACCCAGGGGGACAGCCAAACAGGT
TTCCTGAGTGAAGGAGTGAGAGCCGGGACAAGCAGCGTAGCGTTACAACAAGGAGACGAC
AGTGTCGTCCATTTATTGTGGGCAGCACGGTACAGCACAGAGATGACGCAGTGTCACAGC
TCTTAAGGGTCACGTCGTCTACTGTTGAGCAACACGGAGACGACGCGGTGTCACAGCTCT
TCAGGGGTCGTCCGGAGACGATGTAGTGCTACAGCTCTTCAGGGTCTCCCAAGTCATCTG
GAGACGATGCAGTGTCAGCTCTTCAGGGATCTTCAGGGTCGTCTGGAGACTGCGCGGTGT
TTCAGCTCTTCAGGCTCTTCAGTTGTTATCTTCCTGGTCATTGTCGGTCGTCTGTGTCGT
CTTCTCGGTCGTCTGGGTCGTCTGGCTACTGTGGGCCAGGCATCATGGTTATTACACTCT
GGTGGGTTTAAACGGTGGGTTCGTGATTGGTTGTAAACGGAGGACTGTGATTGGTTGTAA
ACGGTGGGCCCTGATTGGTTGTTAACGGTGGGTTATGATTGGTTGCTTTTGGACCAATCA
TGAGGTGCTGGATATGCAAATTTGAGGGATTCTAGTGGCCAATCAGAGCAAGGTTTCGAA
GGTCAGGTTTTTGGAAGGGAACCAATCATGGTAATTGTTTGCCCTCTGAGAAACCTCGGC
AGACTCGCTGGTGTGCAGCTTCCCACAGTAGGGAGCTGACCTGAAGACAGCACCATGGTG
TGGATGACAAAGTACACGAGGGTGATAGGCTCAGAGGTAGAAGGAAGGGCTATAGAGGAA
GCTCTTTGGGCCGCATTGTGATGGTTGTCATTGTCCCCTTGTCTGAATGACGACCCCTGC
CTTGTGCAATGGCTGGGCTTTGCTTTGTGACTCATTACTGGTCATCTTTGGTTAGTTAAC
CCTGGAGAGGGCACTTAATTGGCATTTGTGTATTCAGTGAGCCCCAGGTGGGCTGGTTGC
TGCTCCCCTTCTTTTTTTTTTTTTTCTTCTAAAATATTTTATTTATCATCATTATTTTTA
AAAATTTGACTCGAAAGAGACAGAGAGAATGAGAGAGAGAGAGAGAGAGAGAGGGAAAGT
GAGAAAGCAAGCCACCAGGTCTGGGACTCAAACCGCTGTCGGCCATGTGGCAGTCTAATG
CCTTAACTCCTATGCCACCTTCCAGCCCCACGGTTGCTGCTCTTCTAATTTTATTCAGTT
TCAGATGTTTTGTATGACATTTTTACAATGAAATAGTTAACTACATTTGGAGTGATACTA
TTTTCTCTAATGTTGTTATTTTTTTTCCTCGAAAGTACCTTTATGCATTCAGTATTGTTC
CTATGAAACTAATGGATGCAGCGGAACTGGTCAAACAGCCTCCAGATGTCACTGAAAACC
CTTACAGAAAACTTGGGAAGGAAGCCTCCATAGGAAAGCAAGTTCCTGCCCCTGAGGTAT
GTTCTGCTCGAGGGTGGCATCTGGACGGGATTGCCCGTGACGGCTGTGCTTCTTAGAGTT
GGACTTTAGTGCATAAGTGGGGTCCTTGGGATTAAAATCTGCTCATTTTTTTACTGTGAA
GTCAGGGTAGTGTTTAGGAAGTCTTAATAGATTTCAGCTAAGCTCATTTTCTTTTCTTGT
ATTGATAGTTTGAGGCTAACAGTTTCAAATGTTCGGTCTTCTTTTATCTATGCTTAGTTC
ATATGGTGAGGTTACAGTTTCATTTATTAAGCCTTTTTCTTGTCCAAAGTTGATCATCTG
TTTGTCGCTTTTTAGGTGAAGATCCAGCTTGGTAGCAATGTAATTTAGATTTTATAATGA
TTACTGATACACAAATAAGATTCATCCTGAAGAATTTTTATTTTCTAGAGGGCCGTGTGT
TTGCCAGGGAACAGAGAGAGGGAGGGAAAGTGAGAGCGACCTTTCCCTGGGGCATGGTCG
TGCTGCAGTCTCTGCCTCTCCTTTCAGGATACTGGGCACAGATGCACGTGCACCCAGTGT
GTTTCTCAGTCTGCCGGGACCAGGGCTCCAACTGTGCTGTCAGCCATGGGGCATCTAGCT
GCCCAACCTCTATGCCGCTGGCTGGCCCAAGAAATTTTCTTATTAGCAGACTCTTATGCA
GTTAATTCTTTCCCCACAAGGAGTACCCAGTTCCCTCATGGTCTGCTTTTTCAGACTTCT
TTCTTTCTTCACAAACAGACTTTTTTTTTTTTTAATAATTATTTACATAATTTTATTTAT
TATTATTATTATTTTAATTTGCTGTAGGGCACATGCATTCACCAGAGAGACGGAGAGAGA
GGGAAATTGAGAAAGCAAGCTGCCAGGTCTGGGACTTGAACCTTGGTTGACCCTGCGGGG
ATCCAGCAACTTAATCACCATGCTACATGCTGGCACAAGAGCAGACTTTTACCTCTTTAA
TTAAAGCTGAATTAGAATTGTTTGACCTCTGACATTGTAGGATTATATTCTGTCCCTATT
GAGAGAGAAAGGAAAAGGAATTTAGGGAGCTCACATTGTTCTAAGAAGAATTGCTGTATA
ATTTGCATTTTAAGTTGTTTTTCCAAAGAGATGAATTTGGCAGTAGCTGGGTATGTGTGG
AGGTGTGTGACAGAGTTCTGCCATCAGGGTTGGGAAGGTCCTTTTGTTTCCCAGAATATG
CAAAGAAGGCTGAGGGGAAAGGTAGGCATGGCAGAAATGTTCCCTTGGGTGTCAGTGGTT
GGCTACAGGTCGAAAGGTTAGTGGAATGATAGTTACTCTTCTGCCTTTGCCATTCCAGGA
AGAATCAGCCTGTCAATTTTTCTTTGATTTAAATGAGAAGCCAGGAAGGAAGCGATCTTC
CACAGGCCGAGATAGTAAATCTTCTCCTCACCCAAAGCAGCCTCGCAAACCTCGTAAGTA
CCTTGAGCAACCACTGTTATTTGAGGTTTTACTTGGAAAACGGCATTGCTAAGAGAGTCT
CTTCTAGGAGAGGAAGATTGTACAATGAGTCATTAGGGCCAATAGAAAAATAAAATAATA
TAAAGATGGCCTAAAAAAAAGGCCTGACTTTGAGGCTCTTCCTTTAAAATCTCCTTTCTT
TTTTTTTTTTTAAAGAATTATTTTATTTAACTTTACTTGTTTATTTATTTTAATTTGATC
AGTGAGGGACAGAGTGAGAGTGAGAGAGAGAGTGAGAAAGCAAGCCACCAGGTCTGGGAC
TTGAACCATAATCAGCCATGTGGGAGTCCAGTGCCCTTAACTACCATGCCACCTGCCGGC
CCCTCTTTCCTTTGTATCTGTAAAACTCCTTCCTTGGGCTGGCCCTGTAGCGTAGTGGTT
AAGGGAGTGAGATTCCACATAGCCAACTGCCCTATCAGTTTTCAAATCCTGGACCCAGAG
GCTTTTAAAACAGGCTGCACCTGTGTTTACGTGTGTTCCAATTCCCAACAGTATGGAGGA
ATGCAGAAGAGATTCTTGCGTGACCATGCATGCCCCTTTGGGGGTGCTTTCTCCTCTCCT
CTCCTCTCCTTCCCAGCCACCATCTCTCTCTTCCTCTTTCCTCTCTATTGACCATATGCA
CACTCTTGACCAAAAAAAAAAAAAGGGAGAAATCTTGCATTTATTTGATTGAACTTTATT
TATTTATTTAAATTCGACCAGAGAGGGACAGAGTGAGAGAGAAAGTGAGAAAGCAAGCCA
CCAGGTCCAGGATTCTTTCTGCCGTGTGGAAGTCCGAATCCCTTAACCACCATGCCACCT
GCTGGTCCCTTAGTATATGTACATAAAACAATAGGCTAATCAGACTGGGAGGAAGGACTT
CAAGACTGTTTCATTGATACCTTCTTTCTCCACTCCATTTTTTTGGTAGAGGTTTTGCCA
TAGGGCGCGGGCTCTCACCAGGAGACGACAGAGAGAAGAGCGAGAATCACGCCTGGGGGG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTTAGC
ATAATCTGAGCTGTTCCAATACTACATGGTGTAGCACGTAGTATTTTACCCTCTACTGCC
AAATAGCATTCCATTATGAGCACATTTGTCTGCCTGTCTATCCGCTCATCAGCTGATGGA
TGGATGTTGGGTCGTTTCTACTTTATGCCTGTTAGGAATATTGCTGCTGTGAAACATTCT
CATTCGAGTTGTGTGACATATATTTTCATTTCTTTTGGCTAGACCCCTAACCAAAAATGG
AATGAATTGCTGAGTTATGAGGCAAATTTACCTTTAACTTTTTAGGAAACTATTAAACTA
TTTTCTTTATTTTTAGTTTGCTATAGTATGTCTGCAGTTCTAGGGAGAGAATGAGAGAGA
GAGCAGAAGGGAGAGAAAGAAATCACCCCCACCCCCCACCCCAAGGGGATGGCAATGCTG
TAGTCCCTTCTCTTCCATTCTCCTTCTGGGATTTTGGGTGCACATGCACATGTGCCCAGT
GTGATTTTTGAACTACTGGGTCTGGGACTTGAACCATGAAATCAGCCATGTGGGATCCAG
CTGCTTTAACTTCCATGCCACCTGCTGGCCCTAAACTGTTTTCTGTAATGATGGCGCCAT
CTTACATTCTCACCACAGTGTGAGAGTGTCTGTTTTTCTACATCCTTGCTAACATTTATT
GTCTTTTTGATTATACCAATCGCCTGTTTTGTAAGATAGCTCCCTCTTCACTCTCTCACA
AATAGGAATGGTTTTTCTAGGGTGATGTTTTTATGTACTTCTTGAACCCCCTATGTTTTT
AGTTCATAATACTTGGGAGCAATGTGTTGCTTTTGTTAATTCCTGAGTATCTGAAATAAG
GACCAGGGTCAGTAGGTGGTGTGGTGGTTGAGGCACTGGACTCTCACGTGGCCAACCACA
GTTCGAGTCCCAGACCTGGTGGCCTGCTTTTGTACTTTTGCTCTCTCCTCTCTGTCTCTC
TCTGGTGAGCCCACATACCCTATATCAAATTATTATTACTATTTTTTTTTTTGGTAGAGG
TCTTCACATTAGGATATGTGTGCTTGCCCGAGAGAGAGAGAGAGAGAGAGAGATAGAGAG
ATAGAGACAGAGACAGAGACAGAGATGAGACAGTAAGAGGGAAAGTGAAAAATCAACCCC
CCCATGGGGGATGGCCACGCTGCAATCCCTTCTCCTCCTTTTTCCTCCTGGGATCTGTGG
TATGCACACATACCCTACCAGTGTGAGTTTCAAGCCACCACATCTTGGACTTGACCCAAG
ATCGGCCATGTGGGAGTCCAGCAATATAATTGCTACGCCATCTGCTGGCCCCATAATAAT
AATAATAATAATAATAATAATAATAATAATAATAATAATAATAAATAGAGTTAAATAAAT
AATTTAAAAGAAAAAGAAATAAGGACTTCGTTCCAAAAGGAGAGTCTTCTGTTGCTTATT
CACCTATATTGTATTAAAAATGTTGATACTCTTTTTTTTTCTTCTAAAGTTTATCTCTCC
AGTTCCTCAGTGAGTGAGAAATTCAGAGAGACAGAGCCTCCAACAGGGTTTGCTGTTGCA
GTTGCCCCCGGCCCCCTCTTCAGCCAGCTCTGGGTCATGGGCATGACTGTGCCCAGCATA
CTCAGGGTGGCCTCTGGACTTGAACCAGAAACGTTTCCTCGTGGGATTGCCTTGCAGAGT
GTCACGTTTGACCACTGTGCCACTGTGTGGGCCCAATATTTTTATAGCTTTAGATTCAGA
AATTGAGCTTATCCTTTTTGCCAAGCCAGTCAAGAATGATCATGCTGTAATTTGTTTCCA
GTGTGTATCCTAGCATTATTTTAGACTTTGTCATAGTAAATGAGGAATAAATGACTTCTT
CCTCCAGCCTTAACTTTGAGCCTAGCATACTAAAACTGTATTTTGGATTGTTTTTTTCTA
AAGGACCTGTTGACCTCTTGTCTGCTCACTCACGGTGTCTTTCCTTCAAAAAATGCCCGA
GCAGGACCAGCAGTTAGTGTAATGGCTATGTCGCTGGACTCTCATGTAGTCGAACGTGGT
TTGAGTCCCGGATCCGGTGGCTTAAACTCAGGCCAAGCGCGTGTGCGTGCGTGCCCGAAA
TCCTGAGAGAGGAAAATGGAGGAGAAGGGATTGTGGCATGGCCATCCCTCCTGGGGGGTA
ATTTCTTGCTTTCTGTCTCTCTGTCTCTCTGTCTTTTTGGCAAACGCATGTGCCCTATAG
CAAAAACCTCTCCAAAAGAAAAAAAAAAATGGCAGAGCAGTAGAATAGTCCTGTATGTTT
TGGTTTTGGCAGAAATGTTTTTAGGTGCTGTTAAAGGCTGGCATCCATTATTGGGAATCA
TAGTCTTCATCTTGTTGGATGTATCTAAGTTTGAGCTGTCCCCTTCTTCCTTTTGCCCTA
CTAGGTTGTTTGTTTGCTTTTATTTTGTAAAGTTTAACCAGCTTCATAAGGCTATGGGAA
TACTGGATGCGGATCATGTTATTTTGGCCTTTTCCTATGAGCCTGTAGGGGATGTAGTGG
TGGTGAGAATGTAATTGGGGATGGGGCCGGCAGGTGGCGTGGTGGTTAAGGGTGCTGGAC
TCCCATATGGCTGACTGTGGTTTGAGTCCCAGACCTAGTGGCTTGCCTTTGCTTTCTTGC
TCTCTCACTTTGTCTCTCTCTGGTCAAATTAAAAAATAATAATAATAAAATAAATTAAAA
AAAAATTAGAATTGGGGGCCGGCCCATGTAGCTTAGTGGTTAAGAGAAGTTGGATCCCAT
ATGGGCAACTGTGGTTTGAGTCCTGGCTCTGGTGGCTTGAAACACACCAGACATGTGTGT
GCGTGTGCTCAAAAGGATACTTATGTGCTGTCCAGTTGAGTTGCTCCCACTTCATTTAAT
ACTTGCATCGAAATGTGTTAACATCTAACGGCACTCTTCAGCAGACACTGTTGCTGTAAC
CTCTACAATGAGAGTTCATTGTGGCAGCAGCTGAGTGGCACAGGAATGACCAAGAATAGA
AATTGGAGACTTGGGGACCAGCAGGTGGCGTGGTGGTTAAGGCGCTGGACACTCCCACAT
GGCCAACTGGGGTTCGAGTCCTGAATCTGGTGGCTTGCTTTCTCACTTCCTCTCTCTCTC
ACTCTCACCTTCTGTCTCTCTCTGGTCAAATTAAAAAAAGAATGAATGAATAAATAAAAA
ATAAAATAAAATAATTATTAAAAAAAAAAAAAAAAGAAATTGGAGGCTTTATATTAGTTT
CCTTTTGAGGGCTAGTCCCTTAGCCATAACTAAGTGCCACACAGGGGAAGCCAGATCCCA
CATGGCCAACAACAGTTTGAGTCTCGGCCACAGTGACTGGAAAATCACCTAGGTGCCCAC
ACATGCTCAGGATCCGAACGGGATGTAGAACTGGACAAGAGGGGATCTCAGCAAGACCAG
GCCCGTGGGGGACGCTCCTCCCTGCGTGTACACACATACCTTCTGACTTAAAAAAGTCTC
TGGAACATTACATTTACGTTTGTATGTATCTCTTCCGTAAGCGGGAGAGAGATAGGCACC
CCTGAAATGTTTTGATGCTGCAGTCTACCTCCAGCCTCAGCCAGCCCCAGATTACGGGCA
CATGTGTGGCCAGCGTGTCCAGGGATGTCTCCAGAAGCAAACCTGGACCCTTCCAATGTG
GGTTCCCTTGCAGAGTGTCATGCTACCGCGGCCCACCATCCGTCCCCTCTGCTGAGCGCT
TTCGTGGCTTCGGCTTGGGCTCCAGGCTTTGCCCCTAGAGACCCGAGGTGACGCCTCCAT
GCCTCGGCTCTCTGTGCCTCTCCTTCAGTGCTACCTTGCCTTGGCCAAAGGCGGCTTATC
TGATGACCACGTCCTCATCCTGCCCATCGGACACTACCAGTCGGTGGTGGAGCTTTCAAC
AGAGGTGGTGGAGGAGGTGGAGAAGTACAAGGCTACGTTGAGACGGTTCTTTAAGAGTCG
AGGGAAACGATGTGTTCTGTTCGAGAGAAATTATAAGAGCCATCACCTCCAGCTCCAGGT
AGGTGGTCTTTGCCCAGGAATGTGGAAGGACACCATCGGGACCCTGATATCAGTAAACCA
ATATTTGAATAACAGTTCACTTCATTTTTAACATTTAAATGATTTACTATGAATTCTCAT
GTTACTGTTTAAATAATGTTCATCTAAGAGGCGATAACCCCAGAGATTTTACAGGGAAGT
GCCTGATTTGTACCAGTGAACAGTCCAGACCCTAAGAGAGTGGTTTAGGACGGGAATGGG
TCACTGAGAAAAGCTCAGGAAACCACGGCCGTGGCTAGATCAGTTTGGAAGGGTAGTATT
TTGTGTGGAGGCCCAGCCTGAGGGAGGGCTCACAGCTCGACATTTGAGAATGTGTGTGGA
TAATTTGCTTGCAGTTGTGGTGGTTTTCTTTCTGGCGCATTTGTGAAGTTTTCAGATGGG
CCTAACTCTACCACATATACGACGTCGGAGCTGGGAAGGGCTGGGTGGCAAACAGGACTC
CCTGAAGCCTTTCCTGTAGCAGAGCTCGGCTCCCACAGGTGTCTCATAAGTTTAAGTCCT
TACAGACAGGCTGACACCGGCCCGTCTGGCCTGAGGAGAGTCTGTGCTGAGGGGTGTTTC
TCTGCCCCCGTGATGGATTTGCTGCTTCTCAGAGACGGTGGGCACAGCCTCTCTGGGACC
TGTGCAGAGAACTTCTCTCCCCCCACCCCCCAGGTCATTCCTGTGCCACTCAGCTGCTGC
GCCACTGGTGACATTAAAGATGCCTTCATCACCCAGGCACAGGAACAGCAGATAGAGCTG
CTGGAGATCCCGGAGCACTCTGACATCAAGCAGGTGAGACAGGAGGGGCCGCAGATGGTC
AGGGAGCAGGGCTTTTCGACACTTGAGTCTGAGGTACTGTCAAGGCATGCCAAAAATGTT
AAAGCAACAGTGGACAGTTTGGAACTAGAACACAGGATAATGATTACCCCGGAGATGACA
GTGGCATTACAGCCAAGTCTTAGTGCTTTCCAGGGAAGATTAGACATTTCCTAAGGTGGG
AACGTGAAAGGAGGTTACTGATAGTGTTCTGCAGTTTGACTCCTGGTTGCTAGAGGGTGT
GTGCACCCACCAGAGAGAAAGCACCCCGCCATCCAGGGGGATGGTCACGCTGCATTTCTT
TCTCTATTCTCCTCTTGGGATTTTTGGGACACGTGCACATGTGTCTGGTGTGTTTTTGAA
GCTACCGGGTGTGGGACTCAAACTGCTCAGTTAGCCACGTGGGATCCAGTCACCTTAACC
ACCATGCCACTGATGGGCGCATTTTGACCGTTTAATTCTATTACCTCTGAGCAACGTAGG
ATCTAGCTACATATATATTGTTTTTCTTTACTTGTGACTGCGTTATTTGCCGAAGTAGAG
CGTGAGGGAGGCGAGCTAGAGTGAGACGTTTACTGAATGTTCTCTAACTCTGTAGATTGC
GCAGCCAGGAGCAGCATATTTTTATGTGGAGCTCGACACAGGAGAGAAGCTTTTCCACAG
AATTAAAAAGAATTTTCCTTTGCAGTTTGGAAGGTTTGTATTCTTTCTTTTCAATGTATT
TTCACTAGACCTTGGTGGACAGTTGGTGAAAAGTCAAAGAGGAGACAGTGCTTGCCCCAA
GGGACTTGTAGTTGTGGGCAGGTGAGATTTTTATACGTGTTCCAGCGATGTGGTTCAGAA
TGTGAAGGGTATTATGACAGAGTTTGGGGAACAGTGAGCTTTAGACATTCAGTGACGGGA
GCACTCATTTCTGCTTGGTGAAGTGCTTCACGTGAAGATTGAAGTTGAGGGCTAGCAGGT
GGCATGATGGGTAGGGCTCTGAATTCCCACGTGACCGACTGAGGTTCAAGTACTGGACCT
GGTAGCTTGATCAATCACAACAAATAAATAGATAAATAACCATTTTAAAAAAAAGTTGAA
GTTGACCTTGAGTGAGAGATTAGAAAACGGATTGGAGTGAGGGAATTCCAGCCACAGGGC
CTGAAGTGCGTCCCACTGACTGAGCCTGTACCGTGTGCTGTCACTGCACACATTGCCTCA
TTTACCCTTCCCGCTATACGCGAGGCGTCATCCCGAGGTACCAACGTGGAGGAGGAGGCT
CAAGAGCAGTGCCTTTTAGCACTTCTCCCCGTGGTGGAAATGCCTTATACCTCAACACTG
TCCAATACAGTGCTTGAGGAGTATGGCTAATGTGATTTGGGAACTAAATTTTTAATTTCA
TATAGTTGTTTTTTTTTTTTAAGAGTTTTTCTTTTTTTTGCCTTAGGGCATATGCGCTTG
CTGGAGAGACAGACACATACAGTGAGAGGGAATGTGAGAAATACTCCCCAAGGAGAATGG
TCATGCTGCAATCCCTTCTCCTCCTGGGACCTTGGGCATGCATGCACATATGCCTGGTGT
GATTTTCAAACCACTGGGTCTGGGACTTGAACTATAGTTGGCCATGTGTGAGTCCAGTGC
TGTAACTGCTATGCTATCCGTTGGTCCCAATTTCATATAGGTTTTTTTTTTTTTCTTTGA
GAGGTTTATTTTGCTATAGGGCATGTGCACTGGCCAGAAAGACAGAGACAGACAGAGAGA
CAGAAAACGAGAAATCACCCCAAGTGGGGGATGGCCACGCTGCAACCCCTTCTCCTCTAT
TCTCCTCTTGGGATCTTGGACATACACGCACACATACCCAGTGTGAGTTTAAGCCACCGG
GTCTGGGACTCAAACCTCGGTCGATTACATGGGAGTCCAGCAACATAGTCATTACGTCAA
CTGCTGGTCCCAATTTCATACAGTTTCAGTTGATTAGAATTTGAAATTAAATACCTGCCT
GGCTCTACCACCTGGTCCTGAGACTGTACGTTTTGACTTCTTCATGTTCTTCATGCAGGG
AGGTCCTGGCCAGTGAAGCCATTCTTAATATTCCTGACAAGTCTGACTGGAGGCAGTGTC
ACATCAGCAAGGAAGAGGAGGAGATCTTGGCTCGCCGCTTCCGGAAAGACTTTGAGCCTT
TTGACTTCACTGGAGATGACTAAGCAAAGGGAATGACACTGGATGAACTTCACAGGAAGC
AGTAGCAGCCTGTTTTTAAAGAAACGACGGTCTAGCACAGTTTTCCTGCCTCTTTTTTTG
GGGTGTGCATTCCCGTGGAACTTGCCTACAGAAGGAGGCCTAGGATTGATTATTTTTTGG
GAAAGTCATTCTAGGGTAAAAATCCTATGTTAGAAGCATGTCTGTCATCCAATTCCTAGA
ACAGCTTGTGTTTATCAACATTTTCAAAATATCAAATAAAACACAATTGCTTTTTCATGG
TTCAAAAGTGTCGTATGTTCATGCTGCCTATGACCACTGAAAAGAGACAGCGTGTGTAGT
TGGAGAAGCCAGAGCTTTAGGCCCATCCGTTATCCCAGAATCACAGAGTGGTTTCTCCCT
GAGATGGAGAAGGGCTCAAGGCCTTTGTAATTTTTCTAGTAGATTCACCTTATTTTTATG
TAAGAGCCCATTTCAGTCCAGATATTCTACTCCTGTGTACCAGATGCTGGTTTAGGTTCC
AGGAATATAGTCATGTCCCAGCATGGTCTCTGCTATCCCAGAGTTTACCATCTAAATGGG
AAGAGGAGAGGCAGATTTAAGAAAAGATGAGTTTTACTTTGGACGCGTTTTAGATGCTTG
CGGGATGTAATAGATGTGTCCAATGTACTGTTGGATAATTCTAAGGGTATAGGTCATAGA
GGAAATTATGAGAATAGATGAAAATAAAATAGCATGAATGCAGTCCTGAGCTGAAGATCT
CCTGAGAAATACCAGTATTTAAGGAGTGGTCGGAAATAGAGACCTAGTAAGTACACAGAG
GAGCAGAGAGGTTCCTAGTAGAATGTTGTACCTTAGGAGCTAAAAGAAAAAGAATTACTC
CTAGATTTTGAACATTTAGGAGATACCATTTAACTTAATCCTCATAAATCTCTATGTGGT
ATTATGTCTACTTTACACTTGAAAAACAGACTTGCGAACCTGGAGTTTGCAAAGCCTTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 3479..3563, 11646..11724, 13278..13379, 16587..16801, 19691..19754, 19756..19808, 24695..24835, 26158..26271, 31708..31917, 32613..32732, 33355..33452, 34798..34939
1001..1023, 3479..3563, 11646..11724, 13278..13379, 16587..16801, 19691..19754, 19756..19808, 24695..24835, 26158..26271, 31708..31917, 32613..32732, 33355..33452, 34798..34939
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved