Tupaia_belangeri Locus ENSTBEG00000016579
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000016579
Tupaia_belangeri
ENSTBEG00000016579
GeneScaffold_2860
SNORD34, SNORD35
3908..3973, 4167..4251
5661
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTAGGAGAAACGGGGACTCAGAACTCCGCAAAATATATCTGCTCTACCGGGAGGCCT
GAGGAGGCACCTGACCCGACTGAGATATCAGGGAGGCTTTCTGGAGGAAGCAACTCTGGA
CACAGGGTACTGGGATCGAGACAACCCAGGTTTTGGAGGGGCGCGGAGAACATCCCAGGC
AAAGGACACGGCGGAAGCCAGGGTCGGAAAGTGGGAAGTTCCTTGAAGGAACTAGGAAGG
TTGGTGCAGCCCAGGAACCCGAAGCTCCACCTCCACCTCTTTTAACGGCGGGGACGCGGA
GGCGCAGGTAAGACCTGAGGTTAGTCCGGGTCACGCCGAGCCTCACCTCCCCCCCCAGCG
CGAAACCAGATCTCTAAGCCTGGCGTGAGCGGCCTAGGGCGGGCCTGGACGCCCCCTGCA
GGCACCACGGGCCCTGCCACCTTCAGCCGGGGGAGGAGCGAGGGTAAGAACGCTTCCTCA
TACAAAAGCGGCGGACAGAACGAGGGACAACTCGCAGCCCCTCAAACACATGGCGCCAAG
GCGGGACAGCCCCGCCCCAGCAGACCCGCTTCCACGCCCACGTGATCGCCAGCCCGCACA
GCGATGGCGGCTGAGGTCCGTTCGGAACGGTGCCGGGATTGGACAGTCAGAGGACGGCCC
GCCTTCGGTGGAGTGTCATTGCGCATGCGCCTAGCAGTTTGGCCAATGACAAGTCGGAAA
GCGGCTCGCGCAGCTCGTGTTGCGTCACTTCCTCCGCCCCTGTTTCAAGGGATAAGAAAC
CCTGCGCCAAGACCTCCTTCTTTCCCAGGCGGCTGCCGAAGATGGCGGAGGGGCAGGTTC
GAGCTCCACGCGGGCCGGGGCGGCGTGGGGCCGGTGGGATTCAGGGAGGAACCGGCTTGA
GCTCTGTACTCTACCCCCGTGTGTTGTGGGACTTAGGCCGCTAACTGTCCGAAATGGGAG
CAGTTTTCTCGTGAGGGAAACCCATTGGGATGCAGTAGACTCCGCAGCCGTCTTTAGTTC
TTGGGGCGGCTAACTGCCGGCCTTCGTTCCTGCCCAGGGCCTCGCCAGCCTCGATGGTGG
GGAGTTCTCAGCTCAGGATGGGGTCTTCTACGACTGGTCTTAGCTTATCTTGACCTCGGG
GTCAGGTCCCCTGTTGGGCCATTGTGCGCCCCTAGCAGTGGGGTGGGGGGGGGCATACGG
AAGTCGACCGGGCAGTTCGGGGGCGATGAGAGGCTGAGGGTCGGCCTAGGCGAGGGCTGC
TCGGTTTCCCTGCAGGAGTGATAAGAGTTCCTGAAGCTGTAGGCGTCTCAGTACGCATCC
TGCAGTGCGTGAAAAGTTTTCCCTTGCAGGCGTTCCGTGGCGAACTGCCGTTTTTCATTG
TTTTTGGATTGGGGGTGCCTTGAAGGCTGTGCTGTGAGTTTTAAGGCCACAGCTGTGCCT
TTACCCACCTGGGAGCCTTGGGGCACACAGGGTTATTTGGAGCTTCCTTGGCTCCATTTG
TGACTAATTTACGTGGTAAGAGGAAAGGATGGGTGGTAGTTAGGCTTTTCTTATGAGCTT
TCTGTTAGGTGTGCGTGGGTGAAAGAAGGTAGAAGAAGGGAAGTGTAGTTACCAGANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGACCGCCTCAAGGTGTTC
GACGGGATCCCGCCACCCTATGATAAGGTGAGCTGCGCCCGGCCCCCGTGCAGCGCCCCA
GCGTCCTGCGTCCGTGATGTTCCACAATTACCTACATTGTTTGACTCTCATGAAAACAGC
ACTGGCTGAGACGCCTGCCCCAGCCAGGCTTCTTCCCTTCTGTCCCTCACTCTAGGTTTC
TAAGCTCCTCTCCTTCCCTAACAGAAAAAGCGGATGGTGGTGCCTGCTGCTCTCAAGGTT
GTGCGGCTGAAGCCTACAAGGAAGGTGAGTTCTGGGTGGTTGCTTTGGGGATTTCAGGCC
TGCTGGGAGTGCCGAGGACTCCAAGATGGCAGATGATGTCTTCTTCTCACGATGGTCTGC
GGATGCCGCTGGGCGGTGCCGAGAATGCCGATGGCTCAGCTGATGCCAGGGGGAGCAGGG
AAACCACACACTGGATAGGTGTGGGCTTCAGAAGCAAGGCAGGGTCTCCTGCCCCCAGGC
CAGGCTTGTGGGTGTGGGGCTTAATGTCCTTACAACTTTGGCTCCCCCCTTCCAGTTTGC
CTACCTGGGGCGCCTGGCTCATGAGGTCGGCTGGAAGTACCAGGCAGTGACGGCCACCCT
GGAGGAGAAGAGGAAGGAGAAAGCCAAGATGCACTACCGGAAGAAGAAACAGCTCATGGT
GAGAATAGGGCTGGCAAGCGGGGGAGGGGTGCCTCCAGGCAGCAGGCACTAACCCTGGTC
TCCTCGTCCTCACAGAGGCTACGGAAACAGGCCGAAAAGAATGTGGAGAAGAAAATTGGC
AAATACACAGAGGTCCTCAAGACCCATGGACTCCTGGTCTGAGCCCAATAAAGACTGTTT
ATGCTTCATGCTTGGCCTGGACTGCCCTTCCTCCATTGCCTGGGATGTGGGGGCTGTCTA
AGGTGCCCCGGGGGCAGCCTGGGACTTAGAAAGTTAGGGACAGGGAAAATTCCCTTAGTC
ACAGTCTGTCTGTGGGTTAAATAGCTCTAGGAGGTGACCCAGCGGCCTGCGTTCCTGCGA
GAGTTCTGGAGAATTGACGGGGCAGTGAGCTGGACACTGGCCGGAACCCACCAGTGTGAG
TGGGGCCTCTGGCCAGGCGTCCAGGGCAGGCCTGTGCTGTGAGGATGTGCCTGGGGTGGC
GTGGAAGGTGTACAGCTGGGGTGACAGGAGTTGCCTTCAGTCCTTCCTGTATGTTGTGAT
GAGAAACAAGAATAAATTATTTTTAAAGAAATTTGGAGTCCTTGCAGTGCATATCTGCTG
TTGAGGCAGCCCAGGAAGCTTAGCCCCTGGCGAGGAAAGGGTCTTGAAGAGGTCTAAAAC
TGCCTCTGCTTCAGGCTTCCTGCAAATGCTAGTTGATAATCTGAGCCTTTAAAGAGCTCA
TTACACCCCAGAGATTGGGATCAGGTGCCGCTGCACTATTCAAGTTGCAGGAAGCAGTCT
CAGTCATTCACTGCAAGGGGGAACTGTTGGTTTCACCAGTCCCCCAATGGCTGACACCTG
TGTGCCACCCTGGGGTGGGGGTAGGGTTCTGCCTTCTGGCTGGCCTGGGTAACAGTCTCC
AGTCACAAGTCAAACTGGATGGGCCCCATCCCTTTTACTAAGGTGATTGAAAACCCTGGG
TGTCAGGGCTACAATGGGACCAGCCGATGGCATGGAGGAAGTCAAGTCCCTGGATCCTAT
GTAGCCAGGTGAGTGCTTGCCCCAAATCCTGAGAGTGGATTGTGGTGTGGCCATTCTCCC
AGGGGGTGATTTCTCACTTTCCCTCTCTGTGAAGGGCAGGAGCACTACAGTAAAACTTTT
GAAAAAAAATTTTGAAGGGATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 2568..2640, 2741..2806, 2907..3008, 3781..3866, 4044..4103, 4375..4497, 4575..4661
1001..1015, 2568..2640, 2741..2806, 2907..3008, 3781..3866, 4044..4103, 4375..4497, 4575..4658
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved