Tupaia_belangeri Locus ENSTBEG00000006170
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000006170
Tupaia_belangeri
ENSTBEG00000006170
GeneScaffold_1949
SNORD12
1257..1348
4992
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCCGGTGCCCACTGTGTACGGGTGAGGGCGGGGCTCGGCGCGGCCTTGACAACG
GGCCGGGCGCCTCGGCCGGAGGCTCGGAGACTACAGTTCCCAGCGGCTCCGCGCGGCCTG
GGCGGGGAGAAGCGCCTCGGCCCAGTGCGCAGGCGCGAGAGCTCCTCGGGTTTATAAGGG
AGGTCCCCGGTCCTTCTCGTCCTTTCGCGTCTGCGATGCTGCGCTGGTCGGTCCTTGCTT
TCCTGTCTCGTACAGTGGTTTCCTGCGTCCGGAACTCCGCGCTCTTTGTGGTAAGTGGAC
CTCACAGTTTTTATTCGTGAGCTCTGATCCTTTTTTGCGCTGTTTGTGCGTCGTTTCTGC
GGCTAGTTCTAGTCTTCCCTGTGGCTTCTCCAGATCGGATCCCGTAGGCCATAGGCCCAT
AGGGGAGATAAGTTAGTCGAAAGAAACTCGTGCCTTCGTGGGCCAGAGGAGCCCTTGGCT
GGTGTAAATGATGACTTCACCTTTTTTCCCCATCAGATCGGCAATGCTGATGTCTTAGAA
CACTTGCCAGTTAGTCCTGACACACCGGCCTCAAGTGACCGGCCGCCCTTGTTTTCCGGC
CGTGAGAAGAGAGCCACTGATCCCCTCTTGTTTGGCAGGTTAACATGGCCAGAAGGTACA
CAGCGACTGTTGGAGGAGGAAGTCACTTCTGGGCGTGTAGGGGAGCCCCGTGTAGACATC
TGCAGCCTTGGATCTCCTGACCACGGGGATGAGCATCTGTCTCCTGGATTGTTGTAGAAA
ACCTTGCTTTGAGGAGCCTCTTGGTTGGCGATGCAGATGGGAAAAGGTGAGGACATAGGA
TCCTTTAAAAAAACTTTCTCTAGGGCAAGTCCCGGGTTCAGAACTCACAGTGCTGTGGGC
CATGTGGGACCTGGCCACTCCGTCAGCTGGCTCTGGATGTCTTTTATGCCACGTACAAGC
ATCCATCCTTTTACATGCAATTTCATTTCTTTGAGAGGTCCCCATGCCACAGTGCACATT
CAGCCTCAGATTACAGGCATTTACCCACGTGCAGGCACGTTCTCGGGTGTCTAAGAGCAA
ACCGGGAACTTTGCCGTGTGGGCCAGCTGCTGCACCAACTGGAAAATCAAGCTACCCTCT
TACAAGATTGCCACTGCTTAACCAGTTTTTTTTCCGAAAGACTAATGTCTGCTCTTTCAT
GTTTTCCATGGTAATCATGGTAATGTCTTGTTGAAGTCCGATCTCTGCACACTTTGTTGA
AAGCTGCCGCCATCTTCTCACTGCAAGGAAAGCCAAATTTTTCTTTAAAAGCCTTGGAGT
TACACTACCCTCGTGTAAGTTTCTACTTAGCATAAGCTCTGACGGGGAGCTTGTCTTTAC
TGCCGTCTCTACTGGTGTGCTACCCAACAAGAAACACAGCACNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCATGGTCGACTGCGTG
GGAGTCCAGCAGTTTAACATGCCATCTGCCGGTCCCAAGCAGAGTTACTTTGCCACAACA
GAAACTTTCTTTTGACCAGAGAGATAGGGAAAGCAAGTAACGAAGCGGCCAGGCCTGGGA
CTCAAGTCAGACATGTGAGTCCAGTGCCCTTAACCACCATGCCACCTGCCAGTCCGATTA
TACTTACGTTTGTGAGTTTCTATTTTTAGATTGACCAGATACTATCTAGAGGCTACCTTT
TGTGCATATGTGATAGACAAAGCACTCACCAGAGAGGGAAAGTGAGAAATCACCCCCAAG
ACTTTGGGCAGGTACACACACAGGTTCCTGGTGTGTTTCTCAAACCGGTTCAGGACTCAA
CTAGAATCCAGCTGCCTTAACCACTGAGCCACTGACTGGCCCCAGAAATTTCTCTCAAGG
AATGCTTATTATAACTAAGAACATGAACATTATGTCTTTCCATGGCCAGTCATCCTGCCC
AGCCTCCTGGCTAGCTAGAACATGGTCACCACTGTACGGCCTGGCACAGGTCAGGGATCA
TACACAGGCTTCTCATACAGTCTTGGCCTGTACTCTTGCACATGGGTTGCAGTTGTGTTC
TTCAGAAGCAACCTGTCTCCCAACTGGGTAACTTAAAATTTAGTTAAGTTTACTGTGTGG
TCCTCTTTCAGGACTCGTCTCTATCCCCATTTGCTGGAAGGACAATTTCACATAAAGGTT
AAGTGTTTTTACACCACAAGTACAATGCACAGTTTAAGGTGAAAGAGCCAGATTGTCTAG
GTCAAAGTATTTTAACTGCTTGGTCTGGCACTTGATTTTACATCCACCTAGTGGTGGACT
TGGGATGACCATCTCAACCAGTTCCCATTCTCTGAACAAGTGGTACTTGGCCAAAATCGA
ATTGCTGATAGTCTATCTTGTTTTCTTTTTAGGAAGTTTCTCAGCTGTGGAGTCTCTACT
GGGCCCCTTGAAAAACTGACCACTTGTTCTCCTGGAAGTGAAGCTCTTCTGGCTGAACCT
AGTACCTCAGTGCTATTGTGTTTACCGCCTTAAGTTTGGGAGACTGCCTTATTGCTTTGT
TAGACCTTGGTAAAATTTCTAACTACATTGCCTTTAACCATGTAGCCTTTACCTGGGAAA
GAATAAAGTTCTTTAAATCAGACTGCTCACATACTTGGCTGTTGGAGATTAGCAGCTTAG
TAGCTACCAGGTGTCTAGAAGTTTCTTTTGGGTTGCTTGATGGTGGGGGAAATTGAATAG
TGGGCAGTTTCTGTGGCTAGGGCATGCATTCCACTTGTATTAGGTGCCGGTAGTTGGATT
CTGTTAGAAATGGGCAGACAGGCAGACAAAGTATGGATTCAGAGGGTCAGTAGAAAGATC
CCTGGCATAGTTGTAAAGTTTTTGATGATTAATCACATAATGTACCAGAATACATCAGTT
GCCAAGACAAACATTTCTGGCTTTACCTTCCTAAACACTCCTGATCATTTTAATATACAG
TATTTTTTTAAAATTTTTTAACTCGGAAAAGATGGGATTTCTATCTATAATGGCTTCTGA
TACTAACTCATAACTGCTGGACCTCTTGTAACTTGTCATAGGAAGTCATGTGACTTGGAA
ACATTGTCCCTGCTTGCTCACTTTGAAACAAACTGCTGTTAGAGGCCGGCCGGTCTGGCA
AGGCTCGGAGCAGCCTCCAGGAACAACCCCGTTAGCACGATTCCTGGTGCAGGCTTGGAG
TAACTGCAGCCACAGCTGATTCCTGAAACCCTTAAATGGGACTGGCTTAAGCTGGCAGGA
TTTTTGACATAAAAATAAATGATGGGTATTTCAAACCACTAAACTGGGATTGTTACCAAG
AGTTTATAATCAGACCCCTCTGCAGTGTGAAGAGCATTGACTATCAGCTGGTTTCTTGCC
CTTCTGTTCAAGGCTGTCAGGCCCCCACTAACAGGCTCATTCAACTTGCCATACCCAAAC
TGACCCATCTCCCTTAGACTCTGCTACAGCCTACCTCCCATAATCTCCATCTCTATGCCC
CATGTGAAACCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 1048..1049, 1418..1520, 1526..1527, 3872..3875, 3884..3907, 3911..3913, 3919..3958, 3960..3989, 3991..3992
1001..1045, 1048..1049, 1418..1520, 1526..1527, 3872..3875, 3884..3907, 3911..3913, 3919..3958, 3960..3988
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved