Tupaia_belangeri Locus ENSTBEG00000009010
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000009010
Tupaia_belangeri
ENSTBEG00000009010
GeneScaffold_2653
SNORA74
13569..13766
24688
AATGGGTGAAGTTGCAACTGCCTCTTTCCACCTAGAGCGCCTTACTGCTTAACAAGATC
TCCTTGACGAACAAGGCAGTAGCTCAATCAAACCTGGGGAAAACGAACAAGTGGAGGAAG
TCTCCTGCCATTTTCGGTGTTTCTCACAACCGCAGCGCCGGGGAAAACGCGGCGTCCCGT
CTCCACTAAGGGCCTTGGGGGCTCTCAAGGGGACTTCAGAATAGTGCACCATACCAGAAG
GGTTGACTGGAGCCCCTGCGTCCTCAGACTGAGACCAGAGGCAAAGGACAAAGATTTTTT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGACGGCGGGACCCTGAA
CTGCACGGGAGCGTCCTTGGGGTCGAGGACGCGCCTCTGCCTGCCGGGGAAGCTTCGGGC
GTCCGAGGCAGCCGGCGGAGACGTCGCAGCGGCGCCCCAGCGGTCGCTTGGTGCAGGGCT
CACAGCCGGGGCCCGCACTCATGCTGGGACCCGCAGCTCACAGCTCCCGGGCCAGCCCGG
GCGCAGAGCCTCGTTCCCTAACCCCGAGCGGGACGGACGGCGCCTCCGCGGCGCCTCCCC
GCACCATTCCCTCTCCGCCGCGGCCCTCGGGAGGTGCGAGCCGCCGCCGCCTGCCTGCCC
TCTTCCGCAGCACCCCACCTGCCTCAGGACGCGCCGCTTTGACTCTGGCTGCCTTCACTT
TCCCACCACCGGAAAGCTACCGTCAGGCGCTTCCGGCTTCCGGGGCGTACACTGCCGCAA
AGCGGAAGTGTGGCGCTTAGCGGGAACCGGCTTCCGGAAGGTCAGCGTGTGAAGGAGGCG
GAGGCGACGCGGGGTGCCGGCTGCTCCCGTAATCCGCCGCCGCGCACACGACCCCGGCCT
GAGGCGGCGGCGGGCACAGACCCACCGATTGCTGCGACGCCATGGAGGGCGGCGGGGGGA
GCGGCAACAAGACCACAGGGGGCTTGGCCGGCTTTTTTGGAGCGGGCGGAGCGGGGTACT
CGCACGCGGATTTGGCCGGCGTCCCACGTAAGTATCGGGCCTAGCGTGCTAACAGCCGTG
ATCGGTCCCTTCCCCTGCACCAGACGTGCGGCCTTGCTCGTTACGTATTTGTTTCGGGCC
GGCGTTCACAAGCTTCGGCACCAGGGACGGGGTCGCTCTTGTAAGATGTAAGGAGATTTT
AGGGCCTTGGATCCCGGGGAGCTCTGTGATTGACCTTGACTTAGGTGATGCGGGTTTTCT
TCCGGGTATATTCAAGCTTCCGTTTGTTGGGACATGTGCTTGGCCCTGAATTAAGAAGAG
CGCCCAGCTCTACAAGAAAATGTATCCCAAATAGCAAGCCCAAGTTCATGTTTTTAAGCA
CAAAGTTACACATTCCTAAAGTAGCTTTTAGGGCAAAACATAATCGTGCGTGCGGGTCCG
AGCATAGGAGTTGAGAATAGCAGGAAACTTCTGAGAGCTGGGAAGTGAACTGAACTCTGA
AGTATGTTAGACGTGAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAACAGAAAGTTGATTCTTGTGTTCCTGGAGCTTAAATTCTACTACAGT
GAGCCGAGTAACGTAAATGAAAACACTGCAGTTAGTGATAAGTGCTTAAAGGAAACATAA
CAGGATTGGGACATAGCTGGGTAGCGGGGAACCATTTTAGAATGGGCCAGAGAATTGACA
TTTGAGAATTGACATCTGAGTACAAGGCAGGTACCTGGGAGATGAGTTTTCAGGAAAATG
GTTGATGGGAATATTCTGAACAGACTTGGCATGTTTAGGAAACAGCTGTTAGATCAGTGT
ATCTGCAGGATTGCCAGGCCATGGGATGGTAGGAGTTGATGAAATCAAAGAGGCAGGGAA
TGATAGCTAAGCTAGGATTTTGTAAGCCACATGAAAGTGTTTAAGTTTAATTACATGTGT
ACAGGTGAAACCATTAGGGCTGATCTCCTTAAGAAAATGACTAGTTGGTATTGATGTATA
GAAAGCGAACTGAGGGGCCAGTAGATGGTGTGGTAGTTAAGGCACAGGACCCTACTGGGC
TGAGTCCACTGTTCGAGTCCCAGACCCAGCAGCATGAAAACCATACTGGATGCATGTGTG
CTTGTGTGCCTGCGTGCTTGCCAAAAATTCCAAAAGGACAATGGAGGAGAGGGGATTGCT
GTGTGGCCATCCTCCTTGGGGGATGATTTCTCACTTTCCCTCTCTCTCTCTCTCCAGTGA
GCACTTATGCCCTATGGCAAAATCTAAAACAAAAATGAACTGAAAGGGAAAAAGGAAGCC
AGGAGTTAGGTATAGCATTTTTGCTGTGAGATTCGATGGTTGTGCTAGTAAGGTAGCATG
ACAGATGAGGAATACTGAAAAACCCCCTTAATGAACCCTTTCAATTGATGAGGTCAGAGT
CAGGACATCACTGAGATACAAAGAGTCAGATTATTCGAATTGGAGTGATTTTCTGTAGAT
ATTTTCCGTCTTGGAGTGATGAGTAAAGCCCTGCTCTAGGAAATTTGCATTCTTTCTCAC
TGACCTCCATCACTAGTATGACATGGATTTCTTCACCTTGCTGCAGTAAATCACCTCCTC
AGCACTGGGAGCAGAGAGAAATGTTTGTATACAACACTCAACCACTGTTTTCGTCATGGA
ATTATTCATCTCTTGTTAGTCTTACTTTGCAGTTTATTTAGTTGTCAAACATTCTTGTAA
AGTGAAAGAAATTAGCTTCATAACAATCGGGAGGCTATGTTTTCTTCTAGTTTGATCATT
CGATCCGTGTTACTGCCAGTATCTTAATAGTAGGAGAGTCTGAGCCAACTATATGAGACC
TAGTTTGGGGTTAAGGGCCTTGGGATGGGCAGCCCCCAAACTGATAGGGTAGATAAAACA
AAATGTTCGCATTCAGGGAGCCTATGAATCAAAAATACAAAATATTGTAACACTCAGGAA
CTGAATTAACTCTAAATGAAGTAACTAAAGGATTATATTGCAATATGACATTTTTTTCTC
TCTCTAGTAACTGGTATGAATCCTCTGTCTCCTTATTTAAATGTGGATCCACGATATCTC
GTGCAGGTAAGATTAAGATTTTGCTAGGTTGGTACTTACCTTACTATTAAAAACAAAACA
GACAAACAAACAAAAAAACCCAGCAGCATCTTAAGTATTTACGCTGCCTTGAACTATTAG
GTCTTTGGGAAAGTTATGACATATTTTTCTGGTTTTCTGTGCAAAAAATGTGTCATGAGT
TTCCAGATGACCCAATGTAACATGTACGTCTGGAGGCGCTAAGCCTTTTTTCCCCCTTTA
TATTCACTCCCCCCCACCCACTAGACTGGGCATGCATTGCTCCCTGAAGCCATTTAGTTT
TTTTTTATTTTTGTTAAAGTAACAAGAAATTAATAAAAATCATCCCAATAAAAGTATTAT
GATAGGTAGTTAAGTGATTTGTTTTTAAAGCTCAATTTGCATTATCAGGATACTGGACTA
CAAAACATAGTTGGCTGTCTCAGTAAGGCAAACAACTGAAAATCAATGTACTGTGCCATG
TCAGTATGTATAAACAACAAAGGAAAGAATACAGCACAGAAAACACATCTCAGCAGACTC
AGAAAAAGCATTCGGCAAAATCACATCCCTTCATGGTTGAAAAAATACTTAAACTAGGAA
TGGCATCTACAAAATATCCAAAGCTAACATCTTAATGGTGACAGACTTCACTCCTGTTCA
ACTTCTATAGCAAGGGTAGTTAGGCAAGAGAATGAAATGGCCTCCAGATTGAAAAGGAAA
ACAAAATATATTTGCAGATGTCACAGTCTTGTTCTCATGGTCAACTGTCTATGTACAGTA
TAATATTTTGAGGAAGAACATATTTACATACTTATCACAGTATATATTTATAGTTGTTCT
GTCTTGTTATTGGTGGTTGCATCTCTTGCCTAATTTATTAAATTAAACTTTATCAGAAGC
ATATATGTATAGGAAAAAACAAAGTGTATATATAGGATTCTGTACTCTCCGTGGTTTCAG
GCATCTACTGGGAGTCTTGGAATACATCCCCCGTGGATGAGGGGGGATTACCATACAAAA
ACAATCTCATAACCAGTAGCATAAGTCGCATTAAAAAAATTTAGTAATAGATTTAACAGA
GGTACAGAATTTACACTCTGAAAACAATAAGACATTATTGATTATTAAAGACATTTAAAG
AGACCTAAGTAAATGGAAAGACATTTTATGATCTTGGAAAATTTAATATCAGTAACACAG
TGATACTCCCCATATTGACCTACAGTTTGAATACAATGACTGTCAAAATCTCAGCTGGCT
TTTTTGCTGAAATTGACAAGCTGATTCTAAAATTCATAAAAAACTTAAAGAGGTGAAGAG
TAGCCAACAATCTCAGAAAAAGAATAAGTTGGAAGACATGTGTTTCCCAGTTTCAAAATT
TATTAGAAGCTACAGCAATTAAGACATTGTAAAATTAACATAAGAGTAAGACCATAGATC
ACTGAAATAGAATTCAAAGTTCAGAAATAAAACCTCACATTATTTACATTCCATTGGTTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATATACATTCAGAATGGATT
AAACTTAAATGTAAGAGCTAAAACTTTAATACAAAGTTTTAGAAGAAATCAGAGATGTAA
ATAGTTGTGATTAAATAAGATACCAAAAGCACAAGTGATGAAAAGTTAACAATTGAATTT
AATGGAAATACTAAGTATTTAATAAAGGAGTTAAATCTAGAATATTAGAAATTTTTTTTT
GGGGGGGGGAGTTGTTTTTGCTCTAGGGCGCGTGTGCTCGCCAGACAGAGACAGAAAGTG
AAAAATCAGCCCCCGGAGGATGGCAATGCCACAATCCCTTCTCCATTGTCCTCTCAGGAT
CTTGAGCACGCACGCACACACACGTGCCCGGCATGTTTTAAGTCACCCGTTCTGGGACTC
AAACTGTGGTCGACTACATGGGAGTCCAGCAACATAGCCATTATGCTAACTGCTGGTCTC
TAGAATATTAGAGTTTTTTAAAAAGCTCCTAAAACCTTAAAGGGCTAGCCAACAGCATGG
TGATTAAAGTGGCTGGATCCCACTTGACCGCTTATGCCGTTCAAGTCTTATACCTCGTGG
TTTGAAAAACATGCTGGGCATATGTGCGTGCATGCCTAAAATCCGGGAGAAAAGATCTCA
GTGTGATCATTTCCCCCAGAGCAGAGAGGAGTGCTTTCCTGCTTTCTCCCCACTCACCCT
GATTTCTCTCTGGTGAGTGCACATGCTCTACAGCAAAATGTTTTTTGAACTTTAATAAAA
AGACAGTGTAATTATAAAATGAGCAAAGTGTCTGAGTAGACATTTCTCTACAAACAAATG
TCCAGGATCACTTGAAAAGCTGTTGAGCATTATTGATTAGAGGAACATAAATCACAGAGC
CACAGTGAGATTCTGCTTCACACTCACCAGGCTGAATATAATCAAAAAGTAGTAACAGAG
TAACAAGTACTAATCCTCACCTATTGGTGAGGATATGAAGAAATTGGACCTTCCTTATTT
GCTGGTAGGAATGTAAAATGATACAGCTGCTTTGGAAACAGTCTGGCAATTTCTCAGAAT
GTTAAAAATAGTTACCTTATGACCTGGTGGTCTACTCTTCTGTGTGTATCCAAGAGAATT
GGAAACATGTTAACACCAGGTGTATATTAGTGCTCAAAATAGCCACAAAGTGGTTTGTAT
GAATATGTGGCATATTTGTACAACAAGAAACTATTTGAAAATAAAAAGAATGAATTATCA
GTATATACTACAGTGTGGAAGAACCCTGAAAACTTGCTGAATTAAAGAAGCCAGTCACAG
AAGACCACATATTAATATGATCCCATTTATATGAAACGTCCAGAGCAGGCACGTACCCAG
ACACAGTAGGTTAGTAGCTGCCTAGGAAGTAAAGGGAATAACTGCTAACAGGTGTGAGGT
TCTTTTGGAAGTGATGAAACTGCTCTAAAATTGATTGTGGTCTTCGTTGCACAACTCTAC
AAAAAAACCCACTGAGTTGTACACTTTAAATAGATAAATTATATAGTTGATGTATATCAG
GGTTTTGTTTGTTTGTTTTTTGAATGATGGAAAGCACACAGAGTCCACAAGGTCTCCTCA
CACTGTGAGTTACGTTTCCCTAGCCCTCCAGCTCCCCCAGAATCTTGGGCACCAGTGTGC
AAGCCCAGCATGTTTTTGGGCTAACCCAGTCTAAACCACAGTTGGCCATGGAGCTTCCAG
CACTGCAGTGTAGTTCCGTACAGACTACCACCTAGGCTGGGCCTGTTTAACAAATAAATA
AAAAAAATAATAAAAATGTTGTTTGAAGTAATGTTTGGAGCTTTTTGTTTCACAGCTGAA
TCATGAACAGCATCTGACAGCTGCAGCATTTCACAGTTGGGTTAAGTGTTCACATTGCAG
AAAGTTGATTAGGACTTTACTAGTTTGGAGCTTCTTTATTTTTGCAGGAAATGTTTCTCA
GATGTTACCTTTTAATACTGGGTGTTTACCGATTTGTATTTTAAAAGTATCCCTCTATCA
GGTATTTCCTTAAAATTTTAAAGCTAATCACATCTTGTTTAGATGTTGAATCCAGACATA
CTAGTACAGCTTTGTTTCATATGTTGTTCGGTGCCAGTGTGACTCTGCGTTAGTAGGTGG
GGCTTATGGTTAGATATAAAGGAAGGTTCTTAATCCAAAAAATTATGATTTCATTACAAA
CTGTAAAAAAATTTTATGATAGTGCATGTGCATATTTTGTGAGGGGTGGGGAATAGAAAG
GGACAGGGTCTCATCACCAAAATCCCCTTTCCCCAGTGCTCTAGCTTCTCCGGATCTTAG
GTGGTGAATATCCGGGCTGGTCCACCCTGTGGTGGGTCAGGCGGCTTCCTGCACTGCAGT
TTATTACTCCGTAGTCTGCCATCTAGGCTGGGCCTCGTCAAAAACAGGGATACTGGCATC
TTCCGCTGAAATGCTAAAGGGGTTTCTGATATGAAACTGTGTTTACTAAATCTCATTCTT
TCTGTTATTATAAATAACCATAGAAAACCTAAATTTAAGACAATACCCTAGTGGAAATTA
TGTTTTCTAAAACATTTTCCCATACTTATGGAGGTTAGAGACCTCATAAATACTACCCAT
CCGCTCTCGTGGTGGTTTTCGGCAACACTTTTGGCCAGAGGACACATGCACTTGCTATTG
ACAGCAGAGGAGAAAGCACTCACTCTGGGGAGTGGCAATGGCACAGTCCCTTCTCTACTT
CTCCCTCCTCTTGGGATCTTTTGGCGTGCATGCACATGTGCCCAGTGTGTTTCTCAAGCC
ACAGGGTCACCCATGTGAGATCGGCTCCCTTAACCAGCAGGCCATGGGGCTGGCCCAAGA
CAACCTTTATCTGAGGCACTCTCCGTGTTTTCTCTTGCTAACAATTGTGTTGTCACTACA
CTTACATGAAGTTTCTTTTTAAATTATGTTAAGTAGTAAATGTTTCTCTTATTAGCCCAG
ATGAACATCTGGTATAAAAACAAGGAGAGCGTACACAATGGCAACATTCAAAGTATTGGT
CACTTGTTTTTAAAGAGTTGACATAATCTCAGCTTTCCGTTTCATTAGGTTCGTGGACGC
CCACCCTCTATTCGATTCTCTTCTGTGTTAGCAAACCCTGGTACTTAGCAGCACTAGTTA
AGTCCTAAGTTTAGTGGAAACCTTTTCAACTTCTCTACATTCTCTGTGTTAACATATTTT
GATGTGCATTTGGTTTCAGCCTTCGTTTTATTACTGTTGACACTAGCTGAGAGGGGTGCT
GACAGGAACGTGTGTGCTTCCTTTTTTGTTCATCATAGCTGTCTTTTATTTCATATTGTT
CATTAGCGATCCATTTCTAGGTTGAGGGAAAATTACTGACCTTATCGGATCAAATACAGC
ATTTCTTTTTTTCTAGAGAGATTTTTGCTAGAGTACACATGCACTTGCCAGAGAAAGCGA
GAAATCACTCCCCTGGGGGCATGGCCATGCTGCAGTCCCTTCTCCATTCTTTCGAGATTT
GTGGCCCTCATGCACATGTGCCCAGCATGAGTTTTAAGCTGCTAGGTCTGGGACTTGAAC
TGCAGTGGATTACGCGGCAGTACAGCGACATAACTGGTAGGCCATCTGTCAGTCCCCAAA
TATAGCAGACTAGAAGCACAATTTAAAACAAAATCATTAGTCTGGAAGCCCTTAAAATTT
CTAAAACCATGAACACTATATCGTAACAGGATCCATTCAGGGTTGGCCCAAGAGACCATT
TTTGTGTGTGGAGAGCAGACATTGTTTGTTTATGTGCATGATTTTTGGTGAAAATGTGAA
TAGACACCTGAAATCAAAAACCAGTACAGAGCCACAGTTCTCTCCTCATCAGGAATGCCT
TTCTCAAAGTTGAGTAGACCCCAGGGAAGGGACGGTCACTACTTGCTGGCAGTCCCCTTG
GGTAGTACAGCACACTGTTTTTGCCCAGACTGCCACCCACCGGAGCTGCTGGTAACAATT
CGGTGTGGAAGGCTTGGCAAGGAGGAGGGTTCTTTATAAAGGTGTCTTGACTCTTGAAGA
TCGCTGATCGTATTTTGCCCATAGAGTAGCCTTTTCAACTTGGGATTTGGGGTAATCTTC
CAGGGTTTCATAGCAAATTTGGTGTTTGCATTTACTAGAAAGGGTCTATAGCTTTCTAAG
ATTACCAGAGGAATGGAATATACTCCCTAACAGTGACAGATTATTAAAGAGTAATTTACC
CTTAGCTAACTGATTGTTGTATTTTAATCAGTTTTGCTCATTTGTTAACAATCATTTGGT
GGTGCTCAGTCCATGATTGCTAGAGTGTGAAAGTTCTCCCTTCCGTATTGATAGCCTATC
TGTTTTTTTCTTTTAATATATTTTTAAATTGAGAGTGTATGCTCCCCAGAGTGGCAGCGG
AGAGGGTGGGAGAAAGCAGTCTCCCAACAGGACATAGTCACACCGCAGTCCCTTCTTTAT
TTCTCCATCTTGTCAGGTTTTTGGTTTTTGGCACAGTTGCACATGTGCCTAGCCCAGTTT
CCAAGCTGCCGGGTCTGGAATTCAGCTCCCTTAACCACCAAGGCACAAGGTTGGCCCAAT
CCCCTATCAGTTGTTTTCATAGCTTTTGGCATATCTTTCTCTAGAGCTGTCCTTCCTAAA
CTCTCACTATGGCTTTAAGTTTATCATTAAGTAAGGCAGCTTACATACAGTCTTGGTTAC
ACTGTGAAGGAAACAAGTTCTAAGTGAGCATCATTCCTGAGAACTGTGTGTGTGCGCACG
CGTGTGTGTGTATTTTGTTTCACTTTGATTTAGTTGTTGCTGTTTTTGCGGAAACTTTTA
TATTTGTTTGAATAAGTACAGTTGAGTTAATTTTAGGTTTTGCTTTTTAAAAAAGCACTG
TGTCATAAGGGGCACTCAGCTTTGTTTTGATTTCCCCTGTAGGATACAGACGAATTTATT
TTACCAACTGGAGCTAATAAAACCCGGGGCAGATTTGAGCTGGCCTTCTTTACCATTGGA
GGATGTTGCATGACAGGTGGGTGTAATAATTAGTAATTGTTTGCATTTAGCCTTGTCTTT
TAAAATGAAAAAAAGCAAAAGTGCTGTTCTCAGTATAAAGTTGTATCATTTTAATGAATG
TTGTGATTTACCAGGGGCTGCATTTGGAGCAATGAACGGTCTTCGGCTAGGATTGAAGGA
AACACAGAACATGGCCTGGTCCAAACCAAGAAATGTCCAGTAAGTCTCATGAAATCCTTG
ACTCCTAGCCTCTGCTCTGTTGGTTTAATGAGCATGACCTTGAGATATTCTTTTTATTTT
ACTCAAAAGGAGTCAAGGAGGGATGGCAAATGGTTTAGTGGTTGGGGTGCTGGATTCCCA
CATGGCCGACTATGGTTTGAGTCCTGGAGCTGGCAGCTTGCTTTCTCACTTCTCTATGTC
TCTCTCTGGACAAATTTAAAATAATAATAATAAAATTAACTTTTTTTTTCTTTTTAAGGT
TTTTGCCATAGGGAACTTGTGCTTGCTGGAGGGACACAAAGACCGAGAAAGAGAAAGTAA
GAATTCACCCACCATGTGGGATGGCAACACTGCAGTCCCTTCTCTTCCATTCTACTTTCT
GGATTTTGGGCACGCTTGCAGAACTGATGGGAGTTTCAGGGCACCAGATCTAGGACTTGA
CCTATGGTAGGCCATGTGAGAGCACCTTAACTACCATACCACCTGGTGGTCCCTCACAGT
TGATCATTTAGAAGGCATTTGGGGGGGCCCAACAGATGGAGTAATGGTTATATCACTGGA
CTCCCATGTTGTCGACTCTGGTTCAAGACCTGGACCCAGCAGCTTAAAGCTCATGCCAGA
CATGTGTACATGTGTGCCCAAAATCCTGAGAGAATGGAGGAGAAGGGCTTGCAGCATGGC
CATCCTCCTTGGGGGGGAGACTTCTCGCTTTCTGTCGCTTGGTCGAATGCAAGCACCCTA
TAGCAAAAATCCCTCTCTTTATAAAAAAAAAAGGGGGGGGCTTCTGAATCAGCATTGTGC
TGCCCCAGCTGCAGATATCACCTGTACCTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCCATCATTTCACTTGAACTCTTCATTGACTCCACTCCGCTTTCCGATA
TGGAGAGCCACAGAAACTTTAAGTAAAATTCTTTGAACTTAGAGGTAGTTCTAAAAGGAT
GAGACAGTTTTTTTCAAGGAACTTGATGTTTACAGAGAAGGGAAAGTTCAATTTAAAGGG
TTGGAAAGTGTGCATGACAAATGTCTTCACCCTGAATAAGAAATAAACATGACCAGTCCC
TGTTGATATTCCCTAAATAATGTGGTTTGCTTTTGCACTTGTTTGTTTAGTTTTGAGTTT
GCTGTAGGGTGATGTGCTCACCTGGGAGAGAGAAATCACCCCTGGGGTGGGGGGGAATGA
CCATGCCACATTGTCCCGTCCTCCATTCTCCTCTTTGGATTTTGGGCACACTTAGTGCAC
ATACGCATGGCATGTCTCAGGCCCTGGGCTGGGGACTCAGAGCATGGAGCTGGCCATATG
GCATCCAGCTGCCTTAACTTTCCACCACCTGCTGGCCCCAGCACATTTTTATACTTTATG
TAAGTGGAAAATATTTTTTATTGGATCATCAGTTGGTTTTAAGACACCTTCAACTTGATC
ATCTTTATGGGCTACTGAGCCAGCAGATGACAGCAGGTGTGCTAGAGTTAAACATGGGGG
ATTTAAAGGCCTGCAATTATTTCATGGTCCTGTTACTGTGTGGATCACTGCCATTGCCTT
TACAACCAGCTCCTCAATATTTTGATATTTATATTCTAAATATTCGTATTTTTCTCCAGT
AATATTTTTAACTCTGTTATAGAGAATTTAGAATCTATGCAGAAGTAGACATAATAGTCT
AATGACACTCTGAACCAAGGTCCATCCTCAGCAGTGACCCATAGTGCCCAGTCATGTTCC
ATCTCCTCTCTCATATTATTGTGAAGCAAATCCTCAACATCATTTTAATATGAACTTTAG
AAGACCTCTTATAAGAGATCATTTTTTTTTTTCTTTTGGAGAGGTTTTTGCTATAGGGCG
CATGCGCTCGCCACACAGACACAGAGAGACAGAAAGCGAGAAATCATCCCCCAAGGGGGA
CGGCCATGCCGCAATCCCTTCTCCTCCATTCTCCTCTCAGGATCTTGGGCACGAACGTAC
ACACGCCTGGCGTGAGTTTAAGCCACCAGGTCCTGGACTCGAACCGTACTCGACTACGTG
AGAGTCCAGCAACATAGCCATTATGCTAACTGCTGGTTCCATAGAGATCATTTTGTTTTT
TAAAACAGTAAGTTAACTTGTTTGAAGAGGGTTGAGTTGATTTGCATGTTTTTAATCTTA
TCTACCTGTTTTTATTACCTTTCTGATCTTTCTAGCCAGGGAGACAGCATTTAGTGATGA
AAATAAAGATAGGATTTAGAACCAGGCTGGTATACGTGGCTTCAGATCTTAGTTTCATTA
CTTTTACTTTGTGATCTTGAGTAAGCTTTTTTCTTTTAAAAGAAAAAATTACTTATTTTA
TCTTATTCATTCATTCATTTCATTTCATTTGACCAGAGACAGACACAGGGAGGAAGAGAG
GGAAAGTGATAAGGCAAGCCACCAGGTCTGGGACTCAAACCGTGGTCAGCCATGTAGGAG
CATCCAGAGCCTTAACCACCATACCACCTGCTGATGCCAAGTAAGCTTTTTTAAGGATTG
TTGAGAGATGATGTAAAGTGAGAAGTAGCTCAGGGCTCATTAAATGGAGGTCTGCTGCCA
AATTGTATACTAAAGAATTTTACCAACTTGCTACCAGTAATATAATCATGAAAATTAATA
TTTTAAAGCTTATTACAATGGAAAACTATGTGCTGAACTTGAAATATGTGACATAGAGTC
ATGTGCCCCGTGATAGTGTTCCGGTCAACACCAGACTATATGTAGTATACACTATATGTA
GTATACATGCGCAGTCCTATAATATTATACCATATAACCTAGGTGCATAGTAGACAGTAC
CATTTAGTTTTATGTAAGTACACTCCATGATGTTTGCACTGTGACAGAAATGTCTGGTGA
TACATTGCAGAACATATCCTCATTGTTAAGTGACTCATGACTTTGATTAGAAACAATATA
TTCTGTGGGACCAGCAGATGGCGTAATTGTTACATTGCTGGACTCTCACATACCTAGTTG
ACCATGGTTTGGGTCCCAGATCCAGTGGCTTCAAACTCACACCAAGCATGTGTGCATACA
TGCCCAAAATCCCAGGAGGAGAATGGAGGAGAAGGGACTGTGGTGTAGCCATCCCCCTGG
GGGTGGGGGTGGGGGGGGGGGATCATTGTGTTCTGCAGCATTGCACTTAGCAAAATCCTT
AAAAAGAGGGGGGCAAGAGAAATGAACAGTATCTCTATTGTAAACACTGCTCTTTTTTCA
AAGTCTTCAGAGTAACCAAGTCGTCTACTGTAGAGCATTGATGAGCTCTGTTGATGCACT
TCCGTGCTTTCCAGCAGTAGTCAGCTGTCCGGAGATCATTCCAGTGATGGTGTTACACTG
CTGGTAGAGCAGTGTCTGTCTCTCTCATCCGGTTGCCCTCGTCACTGTTCTGGTGGCGTC
TGGCACTGGTGCGAGGCAGGACTGCTTCCTCGAGAGTGTGCTAAGCACTCACTCTGGCTG
CTTGGTGCTAGTCTGGGAGCAGACACGCAGTGCTTTCTCCACGTGTCCTCACTGTTTCCG
TCTCTTGGGTTCTACATTGTATTCTGTGCTTGAGTATTCTTTACTTTGATTCTGTGTAAT
AGTCTTAAATGTATATGCCTCTCCTAAAAAAGAACATCAAGCTAGTTTGTTATAGTTAAA
CCAATTTCTGTAAACTAGAGTCATTGGAAAAGTCATGACGCATTTTTGCAGAAAAATATG
TTATGACTTTCCTTATGACCCAATATTCATCAAATGTATTTTAGGCTGTCATCCAAGTCC
TTTATATAGTTAATAATTTGGCATGTTTAGTAAGAATTTTCCCTGGCCATTGCCCAAAAC
GTTTGAAATCTTTAACCTAACTTTGATTTATATGGAGTAAAAACCATCCGTATTGAATCT
GAGGAAGTATTGGGATAAAACTTTTTTTCCAGAATTATTTAACTTTATTTATTTATTCAT
TTATCCATTTTTAATTTGACCAGAGGGACAGTGAGAGAGAGAAAGAAGGAAAGTCAGAAA
GCAAGCTGCCAGGAACCAGCAGTTAGCATAATGGCTATGTCGCTGGACTCCCACATNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGAATATGGTGACCAGGCAAG
GAGCACTTTGGGCTAACACTTTAGGTTCTCTGGGTAAGTAGAGCTCTCATTTGATAACAA
ATTGTTAATGTAAGAAAGAATGTTTAAGTGTCACGAACAGTTTGATCAAAAATTGTGGCC
CTGGCATGTACAATGGTTGCGTTTAAGTCTATTCTGTGTAGCATAGATGTGATAGGACTT
CAGGGACTTCAGAAAGTTTGTGGGAGATGAAATTAAAATACAAGTTTATTTTGGTAGGAA
AACTTTTTTAAATCAATGCATTGTTTTTTCATACTTTGTATTTTATAAGAGCTAATTTAT
TTATTTAAGGTTTGCCATAGGGCCCGTACACTTGCCAGAGAAGAGAGAGACACAGAGAGG
GAAAGTGAGAAATCACCCCCTGGGTGGGGGATAGCAAGGCCACAGTCCCTTCTCCTGGGG
TTTTGAGCTTATACATGCACCCCAGCATGATTTTCAGACTGCTGGGTCCAGTCTTCAAAC
TGTAGTCGGCCATGTGGTCATCCAGCGCTTTAACCATACTATTTGTTGGCCCCACCGAGA
TCTTCCTAAAGACCGTCTCATGCTTCTTAGCGACAGATCATGAACAGTATAACAAAGCAG
TCTCAAGTGTACATGTCATTCTGATCGCCATTTCTGAATGTTTGGAATTGTTTTCAACAC
TGTACACTCCCTTGTCTATCAGAATACCAAATAAAAATCATGTTTTAACTAAATGAAACC
CAGATAATTTAGTTCCAGGGCAAATGGCTTTGTATGTTAGGAAAGGTTCAAGGTCTGTAC
CCAGTCGTGGTAGATTAATCTAGTTGTCTTGCGTGTCTTCTTAATAGCCCATTAAGCAGT
CTGTTTACCTGCGATATTGAGGACCAAATTGCCCGAATTGCAATAGGTCCTTTGTAGATA
ATGAACCTTTGCAGTCTAGCCAACAGGTAATTTAGTAATGTTTAGTCATGATAAAGTGCT
TTCATACCCTATGCTTAGGGATGATTGGGTCTTTTGCTTATTGACGACTTAATGATGGAT
CTACTGTGGCACTTATGTCCTAACATTTAAGGTTTTTATAATTGATGATCTTGGTTGAAA
GTCTGAAAGTCTTTGTAATTGTGACAGATTAAGTAAGAGAAGATGTAGACAACTCATTGA
AAAGGTCGAAAAAACCTTTGTTTGGACAGAGTAAGATCCCAGCCTTGTCACAGGATGTAG
GAGCTTCTCATTTACTTACCACAGAGGCAGGTGGAGGATCCTGTGCTGGCTGCTTCCAGG
CTGCTCACCCCGCATCCCCGCTCCCTTGTTCCTTTGCAATACTCCCACACCTAGAATAGG
CAGCAGTGCGTCCTTGTGCACCTCGTAGTCCTGGACAGACTGGATGGCTAGTCCCCCTGT
GTATCGTTGTGGTGTGCTTGGTCCCAACATTCTGATCCTACAAGTACAGTTATATAAGTT
GAAATGGGAGTATGCGCTTCTATAGAAATGTATAAAAATACCACAGCAGAGGAAATGTAA
TGCTAATAAGCTTAGTGTGGTGGTATTGGGGGTCGGATGCAGCTGCTGTTTTGAAGAGGG
TAAGGAACAGTGTGTCCATGCCTGGTAGGGGTCTGCAAAGGTACAGAAGTAGGGCAGCTG
GGAGATCTTTTAAAATTCAATGGCTCAGGACCAGCAGTTAGCATAATGGCAATGTTGCTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGTCAGTTCTGTAAGAATTAT
ATAAAATGTGTTTGTGAGAGAATGTCTACTTATTTCATATGGGCTATTTCATTTACAAGT
CTCTGAAGGGCGTGGAATTTATCCTTGTTATGTAGGTAACCTGAAATTCAGACAGTTAAT
TCACTTTCACTTGCTCACCCCGCTCTTCAGTGGTGAAGTGCTCATCAAGCCCTGGTCTGA
CTCCAAAGCCCATTGTCTTTTTCATACCAAATTATGTATGGGATAGAGAAATCAAGGTAA
TCTTGAAAGAGGGAAAGGACAAAGACAGTTAACTTGGGCCTTATGGACTGATTTCAGATG
AGTCTGTGTGGTCATACTCGTGTAAGGAAGATGTGGGAGCAGAGTCTGGAAAGGTCGGTT
AAGCCTGGAGCGTGGAGGTTACAGGGAGCAGTTTAAATTTAGGTGGAAAGGCAGCATGTC
TTAAAGGTTTTTGCACAGGAAAATACTAGATCATCCTTGAGGAAAATTAAACTACAAATA
GTGGGCAGAGAGCTCAGTGTTTCTGATAAGGGGCTCAGCTCTGGTAATAGGTGATCGCCT
TCACTACTTGATGGCATGGGCGCGGTGAGGGGCGGTGGATAGGTGATCGCCCCCACCACT
GATGGCACAGGGGCGGTGGAAATCAAAAGCGATCTGGTCACTAGAAGGCTGGTTCCTGCC
TCACTGTTGGCTTTGTTCTGTTGTGGGAGCAGTACATGTGATTCCTCGCCACAGACCTTA
TTTGCAGTCTCTGCCAAGCAGAAGTAAACTCACTGAAGAATGTTTTTGACAAAGTACATA
CTGTGTCCCCGAAGTCCTTTGTCCTTTCAGAAATAGTTTTTGCCTGTGATTCTTAGTCAT
TTGGGTGATTGATTTTCTGTGGGTGATAGGGAAACTCCCAGATCCCTTTGAGGATCTTAG
GGAAGTTTTGGAGCATTTATAAAAGCTGAGTTAAGATCTCTTGGTATAAACTCTAGGGTG
AAAGTCTAACTTGGCGAGTAATGATAAATACATTCTGGCTTATGATTAAATGAAGGGTTG
TGGGATTTGGAAGGTAAGAATTAAGCAAAGTCCAGTTAGGCCAGATCGTTTACAGTGGTC
TTTGACACTCTGTCTTCTATATCATTCTCTTCCTTGCTTATTTGCATACTCCAGATTCTA
CAACTGTACCCCTTGCCATATATTTTCTTAACATTTGCTATTGTGTGTGTGCACTTCCCA
GAGAGGGTCAGAGTGGGAAAGTGAGAAAACAGCCCCCGGGTGAGTGGCCAACACCATAGT
CCCTTCTGCTCTGTTCTCCTCTCAGGGTTTTGGGAATCCACGTACGTGATGTGCCTTTCA
AGCTGCAGGGTACCAGATTCAAACCACACAGTGGCCAGCATGTTGGACCCAGCTGGCCCA
GTACCCATTGCCTTTCAGGTCCCATTTCAGGGCTTTTGTTCTTGCTGCTTCCTTTTCCTA
GAACACCTTCTAGACATCTACAGAACATGCTCCCTCATCTATCCTTGTTCAGATATTGCC
TCCTCAAGACCCCTCGTAACACCCTATTAAATACAGGTTTACACATACGCTTTAGTTGGT
GCTGGGGAAATTTGCCCAAAGTCAGATTATTTGAGCCAAAGTATCTGCCTGCATGTCTTA
AATGTTCATAACTAATACCAAATCGCCTTTACACGGTGTATACCTATTTGACATTGAGGA
TCATCTATTATTGCTATAGGGCACCTGCGCTCACCAGAGAGACAGAAAGCGGGAAATCAC
CTTCCGCAATCCCTTCTCCTCCATTCTCCTCTCAGGATCTTGGGCACACACGCACACACA
CTAGGCGTGAGTTTAAACCACCGGATCCAGGACTCAAACCATAGTCGACTACACGGGAGT
CCAGTGACATAGCCATTATGCCATCTGCTGGTCCCTACTGTTGCTTTTTTAAAGCCAGTC
AGTGGAAGTATCTTCTTAATGTTTTATTTTGCTTATCCCTAATTACAGGATTGAGCAACT
TCTATTGTTCAGTGGTCATTGGTTTTCTTCTGTCCAGTGCTTCGTCATACCCTTTATTTT
TTGTCGGGCTAGTTTAACTGATTTATTGAAATATTTTATATATTATGCCAGTTAGCCCTA
AAATGTGTTGCATGAGTTTTCACTCACTAGAAAACTGTAATAGAAATAAGGCAGTCATCA
CGAGATTGCTTTTTGGCATGTGAAGTTTAATTCTGAATGGTTGGCATTTAGTTTAGACAC
TGCTAAATTAAACCTTTTAACCATAACCATCTTAAGAGGTGATTCTTGCCCTCTGTTTCT
AGAATAATTGTGTAAGGACGCAAGGACAGAAGACACAGCGGAAACAGCCTCATTTGTTTT
GCTTGATAGACACTGACCTTTGGTGTTATTTGGTTACTCTGTGTTCAGAGCAGGTGTATT
TGCTCATCAGTCTGCTGTGCTTAGTTGGGCAGAGTTTTGATTACAGAAAACCTAAAGCAG
AGGCCTTTTAAACTTTTTAACAGATCACCCAGTTGAGAAATTCTGGGCTTGATGGAAAGA
GTTAAAATCGAAACATGCCTGGTATGTGATAGCAGCCTGACCTTGAGTCATTGTAGCTGT
GTGCTAAATAAATCAAAACTGCATGTGTGTGGTGTCTTCCTGCTGGAGATAATTTTAACC
TTTGAAGATGTCCCTTCACTTTTTAACTACTTGTTTCATTTTGGTTAGAATATAGAAAGC
TTTCTGAAGAATGTTCTTAAGGGACACTTAATGTGACATTGCTGTCTCAAAGGTCTGAAA
GCGCCAGGATCTCATTTCTATTTTACCTCTAGTGCCTGTGCATAGAGGGTTGTCAGGGAA
ACTTGTTACTTTTTTGGGGTTTTTTGGAGAGGTTTTTGCCAAAGGGTGCGTGAGCTCGCC
AGAAAGAGAGAGAAAGAGACAGCAAGAAATCATCCCCAGGGGGGATGGCCACGCCGCAAT
CCCTTCTTCTCCATTCTCCTCAGGATCTTGGGCACACATGCACATGTGCCCAGCGTGAGT
TTAAGCCACCGGGTCTGGGACTCAAAGCGCACTCGACTACATGAGAGTCCAGCAACATTG
CCATTACGCTAACTGCTGGTCCCGAAACTTGTTACTTGATGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGGAAACGTGTATAGGCTTAGGCAGTTTAAAAACAACAAC
ACCAATTGCCAGTGGTTTACATCTTTTTCCAAACCCATGGGCAGATTTCAAAGTCCTATG
CATCTGAGAGATTAGAAATCCAGAGGAGTTGGTCTAAAGTTTAATGTGTGATTTCAGGAA
ATAGTATCTGCAGAATATCATGCTTTCAGTTACCTGCCCTCATTTTCCTGACAAACACGA
AGAGCTTGGCATTTGCCGTGTTGATTCAGAGTGGAGTACAGACTATTACGTTTTTGCTAT
GTGCTTAGAAGACCCCTTACTATCTGAGTCATAGAAGTGCTGTTACAGATACCATTGGTG
TTATTCTCCTGTGCCTCAGTTTATTTTTCCCACCTTAGGAAGTTGTTCTAATTGCAGCTC
ACTTTCCGTTCTATGGCTTTGTGTTTACTTACTGGTTAAAGATAGGAGGCTCAGATTGTT
TTAAGCTAACAGGTTAAGTGTGCATTATTTTCCAATTTCCATCATTTTTCAAACATGTTA
TCTACAGGTGTAAATTCAACTGCTGCGCCTTGTGGCAGGATACATGTTAGAGACGATGTG
AACCTTGAACAGATCCCTCCCACTCACTTCATAGTAGTTTTTTAATGCTGTTTTTGATCC
CCCTACCAAATATTTGATAGCCGTTTCAGGCGACGTCTGCCGTTCCACTTGGGTCTGTCA
GAGAGAGATATTTGTAGGCCTTCACAGTGAAATCCAAGAACAACATAAGTAGGTCTGCTA
TCTGGAGTCTTCAGAGTGGGGAAGATTCCTGGAGGGAGGGGCCCTTTAAACTATCGGCTG
AAGCCACCTGGTAGGGCATCCATGCAGATGCGTTCTGGCAGCGGCATCACTAACTACACA
GAATTTCCTGGCAGAGTTCTACTCGGTAGCCATCAAGGCTTCCCTCCCTGTCTTCCTGAT
ACTCTGCAGGGATATAGTGTAGGTTCGGGAAGTTGTGAGCTTTGTGGAGTGGAGAGAGGG
CATCACACGTTCTACAAAGCTGCCTTGAGCACCCTTCCATTCCTGAGGAATTTCTTAACT
TGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGCTCAG
TGCTCACTGGCTATGGAGTGACATACCAGTCAATGGATGGGGCGGGGTGGGGGTGAGGGT
GGGCTCATCATCTTGTATGCTCAGAGCTTGATTACAGCCCTCATTAACTGCTTTTATTGT
CTTTTTTTTTTTTTCTCCTTTCATGAAAGAGACAGGCATCACCACACCTTAGCCCTCCCA
GCCTCTCAGGAAGCCAGGGTCAGAGGCAGACACGCCTGCCTGCTCACATCAGCCTGGAAC
CCAACTCCAGGCTTCCCACATGGCTCCTGTGTCTCAGCCCTGGTCTGGAGCCTGGGCTCA
TTCCTGCTCCTTGAATCAAGCTTCAGTATTAATATTTGGAGGACCCAGCCACAGTCCTAA
GACTGTTGATACTGTTTCCAAATAGGGTGTCACCTTGTGTACATTACAGCGTTAACAGTG
CTAAATGAAGTTCTAGAATATGTGACTGTCGGGAAAAAACTGATCTGATTGGACCTTCAA
TTAACAAGTGTAAGATCATGCCTCAAGCTGCAAGTTGAACTGGGAGAAATTCAGAAATCA
TTACTGCTGATGATTTGAGGTACACATTTTGAAGTAAAAAGTATGAAAATAGTAATTAAG
GGCCAGCCCATGGCATGGTGGTTAAGCCAGCCATATCCCGCAAATTCTGGACCTAGCAGC
TTGAAAAGCACTCCAGGAATGTGTACGCACAGCCAGACTCTCAAAAGGGAGAAATGGAGA
AGAGATTGCTGTATTACCATCCCCCATGGAGGGTGCTGTCTCACACTCCCTTTCTCCAGC
AAGAACATAATATGCTTCCTAGCAGTTTTTAAAACCACACATTATCTGTGTGTGTAAACA
ACACCTACAGAATTATGTATTATATGAGTGGGAATTTATCTCCAGAACTTAAATCTTGGT
TTCTTTTATATTACTTTTAAAACATTCTGGGGACCAGCAGGTGGCATAATGGTTACATCA
CTGGACTCTGACATAGTCAACCGGGAATCATGTCCTGGACCCGGTGGCTTAAACTCAGAC
CAGGAATGTGTGCAGGTGTATGTGTGTTTGCCCCAAATCCCGAGAGAAGGAATTGTGGCA
TGGTCACCCCCCTCCCAGGAGGTAATTTCTCATTTTGTTAGAAGTCTCTCCGTGGGGCCA
GCAGGTGGCATAGAGGTTAAATAGCTGGATTCCTCACAGCCAGTTGTGAGGTTCAAATGG
CAGCTTGAAATACACATCAGGTGCATATGTGCGCATGCCCCAAATCACAAGATAAAGATA
GTGGCATGGCCATTTCTCTCCTTCCCGCCACCCCCCCAGGGTGAGGGAAGACTTTCTCAC
TTCAGAAAAAAGTGTTTACATTTTGCAATACTATGTTTTAAGTAGCCCTTCCATGTTAGA
ACACTGGGCAGTACAAGGCTCCTTAATGTTTTTTTTTCCCCTCTCTTCCCCAGGTGGTCT
TCGAGGGGTAGCCCGCGGTGGTCTCGCAGGACTAACAATCACCAGCCTCTATGCTCTGTA
CAATAACTGGGAGCACATGAAAGGCTCTTTTCTTCAGCAGTCACTTTGAGGATTGTGCCA
ACTGGTGAGCAGAGGACACTTCAGTAGTAACCCAGATCCAATTACAAGTCAGTCTGGAGT
TATTCTTTATCAACAATTAGTTTGAAAAATTGGAGGTTCTGATTTGCTATGAAGATCATG
GATGGCTGACCAGGACTGGCACTCCGTCCAGCCCTTAGTGAGCTGATGCCAAAACCCTTT
GGTGGCACACTGAGTCACGTGGTTCTCTTCACTTGGAGAGGAAATCGTGTACCTAACTCT
TCTCTCTCCTACCCCCGAACTGGAAAACCACTTACTCTCAGAATTCAAGTCATGTTTGTC
ATCAATATTATGCCACCGAGATTATTAATTTAATGATTCAAAACTGTAATGTTGCTCTGT
GTTCTGAATAAAGGGTGAAAATGAACCAAAGTCATAACTCCAACAAACATAATGGGTGTC
TCCATTTAATAACATCTACTTGGGTATGGTATAAAGTGAAAGTTAATCTTGGCTTTTTAT
TCTGCCCCAACTAGGCCAAAACATGTTTTTGTGTTGGTGTTGAAATGCTACTGGTGGCAG
ACAATTGGGGTAAGAGTTTTGTCCAATAGAGGTGACACTGAACGACCCCCGATGTATGCC
AGGGTAACCATTACACCATTACTGTAATAGTCTGTTACAATAACCTGTACCATTAACTCC
TTACTGAGAAAGTGAAGAACTAGAAATTTTTAAGGAAGTCTTTGGAAGCTAAACGGATTA
AGAACAAGTTGTTTAAGAGTTTTCTCATCTGTAAAATGTAGTTAATCAAATATAAATGCA
CTGCAGGCTACATATATACAGTAAATACTAAACTGGTAGCTATATGACTAGAAAAAGAAA
ACTAGGGTCTTTTTGGATGCAGCTAGTAAAACAGAATCCAGCAAAACAGAATTTTGGCTG
AAGTCCCACAGTTTAGAAAAAAAAAAAGTTTTCAGAAAAAGGTTGGAAATGGAAATAATA
ATAAACCTACTCTTTGCCAACTTAAGATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1106, 3307..3365, 9882..9975, 10094..10178, 14434..14492, 16883..16993, 23573..23688
1001..1106, 3307..3365, 9882..9975, 10094..10178, 14434..14492, 16883..16993, 23573..23685
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved