Tupaia_belangeri Locus ENSTBEG00000002721
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ENSTBEG00000002721
Tupaia_belangeri
ENSTBEG00000002721
GeneScaffold_2213
SNORD105
2359..2439
6392
AGCTGGGAGAGAGTTAAGATGACAAAAATAGGGACAGAGACAGGAGAAAGATGGAAATT
TACAGACGAAAATGACAGCTGATGAATTGACAGAGACAGACTGGGGAGAGAGGGAGACAG
AGACAGGAAAGAGAAGACCGGACCTGGGGGAGAGAGGATGAAGACTTGGGGAGGGAAAAA
AGGTAGGTGGAAGAGAGACAGATGGGAGGAGGAGAGAGGGGGTGTCCCCTGCCCCGACCA
CAAGATTGTGGGGAAGCAGCCAGGGGCCTGAGGCCAAGATTGGGGCTTGGAGCGGAAAGG
AGAGGGGGTGAGTTATTCACCAAGCGCCGGCATGGCTCTGAGTTTCCAGAAGGTGAGGTG
GAGTTTCCATCCTCCAGTCTGTCCACAGACAGGGTCTCCGAGGAGGACAGCTGGCCTCGG
GAACTCTGGGATGAAAACGAGGAACTGCCGCCGCCCCTGCTCCCTTCTCTGGCTGCTCCC
CAAGTGCCCAGATCCGGCGTGCCCAGCCTTCTGTATACATGATCGCTCTGAATTCACTGT
GCAGGGAGGCACTCTTAGCCTTTTTTAAAGATATTTTAGGAGCCTTCGAGTGAAGAAAGT
GGGTATCCAAATCGCACGGCTGGAAGAAGTAGACGAGATGGGATTCGAACCCTCAAATCT
CTTTCTGCTCCACCCGGCACAGCGCAGCCCCGCTCCAGTTTCCGTAGAAACAGGCACCCG
GAGTCTCCATAGCAACCACTCTGGTGCTTTCTCCCTCCCGCAACACACACACACACACAC
ACACACACACACACACACACACACACACACACACGCGCGCGCGCGCACACGCACACGCGC
GCGCGCACACGCACACACACATACAGACCAACCAGCGCGCAGACAGATTTGGTGACGTCA
CCAGTCAGTGCCGCCTCACGTGACGTCTCTCAAGCGCCGGAAGTGAGCCGCGCAGCGCCG
GAAGGGGCCCGCAGAAGTGGCCTCGTGCAGGAGGCGGCAGCATGGGGCAATCGGGGCGGG
TGAGACCAGGCGGCCGGGGGTTCTTGGGGCGCGGGCGGGGTCGCGGCCGAGGCCGGGGTC
GCGGCGCTCACCGCCTGCCTCCTGCCCCCGCAGTCCCGCCACCAGAAGCGCGCGCGCGCC
CAGGCGCAGCTCCGCAACCTCGAGGCCTACGCCGCGCAGCCGCACTCGTTCGTGTTCACG
CGGGGCCGCGCGGGCCGCAACGTCAAGCAGCTCAGCCTGGACCTGCGGCGGGTCATGGAG
CCGCTCACCGCCACCCGCCTGCAGGTCTGCACCCCCCCCCCCACCCCGGATTGCCTCCGT
CCGCCCTGGGCTCGGTCTGCGCAGCTGCAGGCCTGGCTAACGGCCGTGTAGACGCGGGAG
GCCTCCGTCACCCCGCCTGGAGGAAGGGATCCTGTTGGGGATCATCGTCTCTGCCTCTTG
GGGAGTTTGCGGGGTGCAGAGCATAGAGTCAGCTTGGGGCTTAGTTGCACCCCTGAGCCT
GATGATGGTTAAGACTGGACTCTGGCGTTGTGGTTGATGCGCTGGACTCCCATGTGGTTG
GTTAGTTGACCACGGTTCAAATCGCGGACTGGTGGCTTGAAACTCTCGCCTGGCGCATGT
GCTTGCGGGCTCAAAATCAAAGTGAGAATGGAGAAGCAGGGGCTGTGGAATAGCTATTTT
TCGCTTTCTCTCTCAGGCGAGCACCCGGGCCCTATAGCAAAAGTCTTTAAAAAAATAAAG
ACTGCAAAGCTGAGTTGAAACTTGGCTTCTCTCAAAGGCCTGGACCAAGATGGTTAACAT
CCCCTGGCCTCAGTTTCCTCTGCTGTCAATTGGGCAGATACACAACGAACAAGGTGCGAG
GCAGTGCTGGAAATCATGCCTGATTGACCTTAAAGGGCGGAGTCATTCTGTCCTGGGCCC
CTTGGAAGGAAGTGCAAAGCGCGATCTTCCCGCCTTTCTGCTTAATCTTTTTATTATTAT
TATTATTATTATTTTAACTTTGTTATTATTTTTCAATTTGACCAGAAAGAGACAGAGAAA
CAGAGAGAGTGAGAAAGCAAGCCGCCATGTCCAGGACTTGAACCACGGTCAGCCATGGGG
CGGTCCAATGTCTTTAACCACCCCGCCACCTGCTGCCCCTCCACTTCATCTTCCAGTTTC
TGCTCAGTAGGGGCGGTCCGTGTTCATTCCCTTTGGTTCTGGGATTTTCAGGTCCGCAAG
AAGAACTCGCTGAAGGACTGTGTGGCGGTGGCTGGGCCCCTGGGAGTCACGCACTTCCTG
ATCCTGAGCAGGACGGAGACCAGTGTCTATTTCGTGAGTGCTGCCCGTGTCCCGCCCATG
TCCTCCTCTCCCCCAGGCGCCCCCATCTCTCAGGATGAGCCCCTCTGCCTCTGAGCTGCC
ATGATTCTGGCTTCAAAGTAAACGCTCTGAAGAGAGGGGGCACAAGTTTCTGCGCCCCAG
CTCCCACACCAGGCACCTCCACCTCACCCATCCTTCCTTCTCCCGCAGAAGCTGGTGCGT
CTCCCAGGAGGCCCCACTCAGATCTTCTAGGTCAACAAGGCGAGGGTCAGAGGGCATGTA
AAGGAACCCTGGAGGGAGGGCAGGGACTGAGCCCAGCGAAATTGCACATCAGATCTACCC
ACAGTACACGCTGGTGCGGGACGTGTCTCCTCGCTGCGCCGCCACCGCATGCACGAGCAG
CAGTTCACCCACCCGCCCCTCCTGGTGCTCAACAGCTTCGGCCCCCCACGGCATGCACGT
GAAGCTCATGGCCACCATGTTCCAGAACCTGTTTCCCTCCATCAATGTGCACAAGGTGGG
CCGGGCGGGCCTGGGGGCAGGTCCGGGGGGCGGGGCAGGGCCGGCTGCAGGTACCATGGG
CCCCGGGGTCAGTTGCTGAGGCCTCACTGCAGCGCCGAAGCGGAGTTCCGAGGTCACACC
TCCATCGTGTGTTGTGTGACACAGGCTCCTGCCGTGTAGACGCGGGAGGGAGCCTTAAGG
GTGTTGGGGACCCTGCTGTCCCCTACCCTGGGAGCTGCTGTCTCGCCTGGCAGGTGGAAA
ACGGCGATGGGACCACATTGCCACCGGGCCCGTCAAGCATCTGTGGTCACCATCCCTGGT
AGAAGTAAAGTCACTGGCCTGAGGTTCGGTTCCAGAGGGCAGGGCTGGATTTTCATTCAT
GCATTTCCCACTTGCCAGAGGGTAGGTGTGCTTGCCAGAGACAGGGAGAAGGTACCGCTC
CCCCACCCCCGTGGGCCGCGGTCCCACTTCAGCCCTGTTTCCCCATCTTGTCAGGATTTG
GGGCACACGCACGCCGTGCCTGGCCTGCTTGTCAAGCAGTAAAGGGCGGATTCGATCATG
ACGTCATGTGTGACCCGGCGTCCCGGGCTGGCCAGGGCTTGGTTTAAACCTGTCTGGTTT
TAGAGCCTTGGCCTCTCTCATCCTTGGCACCCGCTGTGTTCATAATGGGGTTAGTAAACC
CGAGGTGCCCACCTTCGGGGTGTGTGAGGGACAGCCTCAGGGGTCCTGGCCCTGACAGTC
TGGACGCTTTATACCCTACCAGCCTGTGTGGTATCAGCACCAAGCACTCCCCACCCCCCA
ACCGTCCCTGAGTCCACCCGAGTGGGGTGAGGTCAGGCCGGCTGGGGCTCCTGCAGCCTT
AGCCCTGGCAAGGCCTGCGGCTCAGGGGCCCCGCTCACCCTCCCTCCAGGTGAACCTGAA
CACCATCAAGCGCTGCCTGCTGGTCAGCTACAACCCCGACTCCCAGGAGCTGGATTTCCG
CCATTAGTGAGTGCGCCCCTGGGTGGAGGGGATTCAGGGGGTCTTACCGTGCGGTGATGA
CAGTGCAGCTGCTGAGACGCTGTGATTTCTCAGTCTCAAAGTAAACGCCCTGAGGCACGT
GGGAGGCCGGCAGGGGCCTGGGCTACGGGGGATCCCGCCCTGCCTCACTGCTGTCTGTCC
CCCGCCCTGCCCCTGCAGTAGCATCAAGGTGGTCCCCGTGGGTGCCAGTCGGGGCATGAA
GAAGCTTCTGCAGGAGAAGGTCCCGAACATGAGCCGCCTGCAGGACATCAGCGAGCTGCT
GGCCACGTAAGGAGGGCACAGAGCAGCCCAGGTGGGGTCGTCCCGAGCCCGGCCCACTGA
GCCCGCGTGTCCTCCACAGCGGCGCGGGGCTGTCTGAGAGCGAGGCGGANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGGCGGTGGGCGCCCCGCTGTCCAGCGCTGCCCTGACTGGCCTCTCCCCGCAGACATG
TTCCCGGGCGCGTCCAAGCGCAGACGGCCCGCAGGGCCTCCACGCAAGAAGCCGCGGGGA
AAGGAGCGGAGGCCGGACCGAGGCCAGGACGCCGGGCTCCGGGTGGCCAAGGGAGGCCCC
CAAAGCCCAAGGGCAGGCCCTGGGGAGCCCAGGCCAAGCCCGGGCCCAGGGGGTCTGCAC
AGGACCGTGGGCGAGGCCGGGCACGGCCACGGCCACCCAAGAGAGTGGCCTGAGTTGGAA
CGAGTGGTGGACATCGCCCCAGATTGGGGCCCGAGAGCCGCCGCCCTGGGGCTCCCCCTG
CGGCCCTCGGTTTCCTTTCATAAAGGAGCTGTCTCCCCAGCCCTCCTCCCCAATAAAGGA
CGGAACTTGAGTGTGTGTCTGCTTCCGGTGTGGCGCGGGTTCGCGGGGGCACTGACCCAG
CTCTTCCCAACCCCTGCTCTGGGGTCGGGGTCCCGGGCCCCTTCCCGCCTCTCAAACATC
GCCCCCACCCCACCCCCGGGAGGGAGTGGGCAGGCCCGCCCCTGCCAAGCATCGGTGCAA
TGCGGAAGGAAACGGATGGCGGCTTCCCCAACCGACCCGCTCTGCAGGCCGAGGTTGGAG
CTGCAGCTGGTGAGGGGCGGGCGGTGCTGCCCGGGCCGCGGGGAGGGGCCTGCGCCGCCC
GGGACTGCAGACTTGGAGCCAGCGTGCGGGCCATGGCCACCACCGCAGGTGAGCAGCGCG
GGGCGGCCGAGGGGACACGTCCGGGGAGCTGGCCGCTGAGGCTCGGCCGGTTCTCGAGAG
GGGAGGGCGCTGAGCGGGAACGCGTGGTGCACCCAGACTTCCTCGGCTGGCAGCCGGGGC
AGGTGCACCTCGTAGCCGGTCTGCCCGCGGGAGGGGAGCGGGCCATTTTCCGGATTGGAA
AGCTGAGGCTGGGAGGCATATGACCAGGGCACCACTCCGGGGCTCGAGCTCCCCCACGCC
GTGTCCCGGGCACTGGTGCACGTCCTCACAGTGACCACATGGAGGTAGAACTGAGCAGGA
AAGGGGCTGGGGGCGCGTAGTGGGCAGGGGCCTCTCCCAGGCAGGACCACAGGCCAGGAG
AAGTGAGGGAGGGAGCTTTAGGAATCTGGTCCCGGGGGACCAGACAGGGTGTGATGGTCA
CGCCGCTGGGCTCCCAGTCAACAGTTCGAGTCCCAGACTGCAGCTTAGAACTTCGGGCAC
TGGGCGTGCGTGCCCAAAACCCCGAGAGGAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 1113..1283, 2211..2312, 2508..2546, 2550..2558, 2644..2661, 2664..2740, 2742..2814, 3709..3785, 3978..4085, 4159..4282, 4403..4481, 4582..4711, 4812..4981, 5155..5247, 5250..5359, 5364..5375, 5378..5392
1001..1018, 1113..1283, 2211..2312, 2508..2546, 2550..2558, 2644..2661, 2664..2740, 2742..2814, 3709..3785, 3978..4085, 4159..4282, 4403..4481, 4582..4711, 4812..4981, 5155..5247, 5250..5359, 5364..5375, 5378..5389
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved