Tupaia_belangeri Locus ZADH1
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri ZADH1
Tupaia_belangeri
ZADH1
GeneScaffold_5234
SNORA42
1741..1871
20962
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAAAAAAAAAAAAAAAAAGACTGTCAGGTTATATGGGATTAAGGTGTTGAACTGC
CACATTGGCTGACTGCAGTTTAAGTCCCAAACCTGGCAGCTTGCTTTCTCACTTTTTCTC
TCTGCTCAAATTGAATAATACTAATAATGAATAAAATTAAATAAATAATTACTAAAAATA
ATCATCGTAATGATAAATAAAATCAAATAATTCTTTTCTGTTTTTTTTTTTTGAGAGGTT
TTTGCTATAGGGCACGTGCGCTTGCCAGACAGACAGAGAGAGACAGAGAGATAGCGAGAA
ATCACATGCCACAATCCCTTCCCCTCCATTCTCCTTCGGGATCTTGGGCACGCATGCACA
TGCGCCCGGCGTGAGTTTTAAGCCACCGGGTCCAGGACGTGAACTGTGGTCTACTACGTG
GGAGTCCAGTGACATAGCCATTACACTAACTGCTGGTTCCCAAATAATTCTTTTCTTAAT
AAAAGAATAATATCAATAGTTGTATAAGAAAGTTACCTTTTTTCTTTTTAATTTGGATGA
GGGCATATACACTCACCAGAGAGAGAGAAAATGAGAAAACACTACCCTGTGATGGATGGT
CATGCTACAATCCCTTCTCCTACAACTCTTACCCCCTTGGGGATCCTGGGCTCACACATC
AGGTCTGAGATGTGAACCACACAGTTGGCTATGTGGGATCTAGTCGTAACCACCATGCCA
AAAAATGACTTTTTAAAATGTTTTTGCCTAATATTTTAGGAAAAAATGGTAATCCAGTGG
CAGAGAACTTCCGAATGGAAGAAGTCACTGTACCAGATACTATCAATGAAGGACAAGTAC
GAGTTAGAACTCTTTATCTTTCTGTGGATCCCTACATGGTAAGAATTGGGGTGTTGTCAC
TTGGTGAAAAATTACATTTTTCATGTTGTTGTATCTGAATTTTATTGTGCAATCCTATTA
TCGATAAACACTTGAGCAATTATCTTTCTCCCTTTTTAAGGTTTTTGTCATAGGTTGAAA
GTGCTTACTGGAGACAGAGACAGTGAGAGGGAACCCTCTCCAACAGTCACCCCCCAAGGG
AGATGGCCATGCCACAGTCCCTTCTCCATTAGTGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAAAAAAAAAAAAAAAAATCACCCTATGGGGGCATGGTCACCTGCAG
TCTCTTTTTCCTCCAATTTCTCCCTTCTTTTGAGATTTTTGGGCAAGTGTGCACATGCAC
CAGTTGTTGCTTCTCAAGCCCGCTGAGTCCAGGACTTACACTGCACAATTGCCCATGTGG
GATCTAGCTATCTTAACCATCAAGGCTATGGACTGGCCCTAAATGTCTCTTTAATTGAAG
TTCTTTACTTGTTAGAGAAGAGGTACATTTTCTTTTTTAGAAAAAAAAAATAAAGGAAGA
TGTGAGGGTTTGGATTTATGGCAGGTCCATCCCTCTGGGCCTCTCATCGTGTCCCATGCT
AGAGCACACTGGCCCCAAACCATTGCCCAGTCTCTGCCTGTGGGCTGCTGGCACTGAAGG
GGTTGCACAGGGAAATGGGGAGATAAATAAATAAACAAGCAAGTGAAAGAAAGATAAAAC
TTAATGTATTTGACCAACACTTCACTTAACGTCAGTTATTATGTACTTTCAGTCATTTTG
TAAATTAGTAAACTGGTTAAATATTTGATAAAATTATTGTAATTAATTTTTCTTCTTTCT
TTTTTTTTTTCTTTAGCGTTGTAGAATGAATGAAGACACTGGTAGTGATTATATAACACC
TTGGCAACTGTCTCAAGTGGTTGATGGTGGAGGTGTTGGAATTATAGAAGAAAGTAAGCA
CACAAATTTGACTAAAGGTGATTTTGTGACTTCATTCTATTGGCCCTGGCAGACAAAAGT
CATTCTGGATGGAAATAACCTTGAAAAGGTGATGTACATATAATATAAAAGTGCCTGTTT
TTGTGTCCCCCTGTGTCATTCTCACATTGTGCATTTGGTATTCAGTTCTGTTTGTTACCT
GGGAAAAAATAAAGCATGCATTTTCTTTTAGCTAGTGGCCAAACAGTGTAATGCCTTTGT
TCCTTTTCCATTGTTGGCTGTAACTAAATATGCTGATTCAGGACCAGCAGAGGGCGTAAT
GGCTAAATCGCTGGACTCCCATATAGTCGACTGCGGTTTGAGTCCCGGACCCAGTGGCTT
AACTCATGCCGGGCACATGTGCGTGCATGCCCAAGATCCCGAGAGAGAATGAGAAGGGAT
TGTGGTGTGGCCATCCCCCCTGGGGTGATTTCTCACTTTCTGGCTCTCTGTCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAAAAGTTTTTTCTCATGTTCTGGACACTGGAAGCTAAGATTAAGTGTGTGTGTGT
GTGCACAGCTGATGTAGTGGTTAAGGTACTGGACTTTCACGTGCCGATAACGGTTTAAGT
CCCAGATGTGGTGGCATTGCTTTCTTGCTTTCCCTCTCTGGTCAAATTTATAAAAATTAT
AATAATAAATAATTATATTTTTTAAAAAAGATCAAGGTGGTGGACAAGTTGGTTTCTAGT
GAGATCCATCTTTCTGGCTTTTATTACAAATGGCTACATACTTGCTTTGTCTTCATGTGG
TCTTTCCTCTTAAGCTTACAGAGAGGGAGATATCTTTTGTGTCTCTTCTAAGGACACAAA
TCCTATGGGATTAGGGCCCTGCCCATATGACATAATTTAACCTTAAATACCTCCTTTAAG
GCACTAAATCCACATTGGACGTGGGGCTTTAACATGTGAATTTGGGGGGCCAAGAGATGG
CATGGTGGTTAAAGTGCTGGACACTCCCATATGGCTGACCACGGTTCGAGTTCTGGACCT
GGTGGCTTGCTTTCTCACTTTCTTTCTCTGTCTCTGTCTCTCTTGGGTCCAATTAAAATA
AATGAATGAATAAATAAAATGAAAATAAAAAATTCTTTAAAAAATATGAATTTGAGCAGA
TGGGGGAGATAATTCAGTCTGTAACAGGCTATCTCTACCTGTAGTCTTAAAGCAGCAGTC
CTACTATTATTTTAAAAACTGATACTTGTTTTATTTCAGGTAGACCCACAGCTTGTGGAT
GGACACCTTTCATATTTTCTCGGAGCTATAGGTATGCCTGGTTTGACTTCCTTGATTGGG
ATACAGGAAAAAGGTCATATAACTGCTGGATCCAATCAGACGATGGTTGTCAGTGGGGCT
GCAGGTGCCTGTGGATCCTTGGCTGGGCAGGTAAACATTCTGAGAATTCATTTGATTTTC
GAAAAAAGTTGTCATAATTAAATCTCTGCGTATGTGTATATAATTTAACATATAAAAGAG
AACAAATTTATAATATAATTTCATATATTTCTGTAGAAATGGTATTATTCCCTATTTATA
CACTCTTATTCACAACACAAAAACTATTTTAAATTTTTCATCTTGTTCTTTTTTTTTCGA
GAGGTTTTTTGTTATAGAACATGTGCATTCATTGGCAAGACAGAGACAGAAAGCAAGAAA
TCACCCTCTAAGGGGGATGATCCTGCCATTTTAGACACGCTTACACATGTGCTCAGCATG
AGTTTCAAGCTGGAATTCGAACTACAGACGGCCATGTGGGAGTCTAGCACCTTAATCACT
ACACAACTTGCTGGCCCCTTCATTTTGTTCTTTATTAACCAAAATATGTGCGGTGAATGC
TGGAGCATTGTTTTTCTTCATCAGTATAAAGAAGAGGATCTTTATATAACTTGTCTGGAA
TTTCATGAATTAAAATTCAAAACACACTCATATTTTAAAGATGTATTCTCGGGAACCAGC
AGTTAGCGTAATGGCTATGTCGCTGGACTCCCACGTAGTCGACTGCGGTTCACATCCCAG
ACCCGGTGGCTTAAAACTCACGCCGGGCACGTGTGCGTGCGTGCTCAGATCCTGATAGCG
AAAACCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTACAAATTTGTATACTGCATTTCATTTGTCGTATATCT
TTTTACCTGATACTGGTAACAAAAAGCTTTATAAAACTTTAGAGTCCATTGGGACAAACA
ATGTATGATGAGTCTTGTATTGAAGTGTTATAAATAGGAGCTTGCAAATCCATGAAAACC
ACTGCATAAATGGATAAAAGGACAAAGTGCCTGTCCCATGGACTGGCGTCTTAGATGCCC
TTGTGGAATATGAAGCTTCACAGAGCTCCAGTTATAGTCTTGGAAAAGGCATTAAATTAT
TTCTGTATATTATGTAGCAGGTCCCTTCACTTTTTGCAGAGTAGAAAATCTAGCTTCTTT
GTATAGACTGAGAACTTATCCAGACTTCATCTTTTTACCTGTACTTCCATGTGCTTGCAA
ATTTGCACTGTGAACTTCATTTTTAGTTCTTTGCCCACACTATGTTTTTTCACCTATAGT
TTAGTGCTGTGAAAAATTACAGTTGCATTGTTGAAATGGCATTCACCATCAACCAACTTA
AAGTCACAGCCCCTGACTTTGGGTAGAGACAAAGTTTTCACAGGTTGCAGGTATTTACCT
ATTTTTATTAATGATATTATAAAATATCTACATGAGCTATGAACATTATATACTATATGA
GAAATTATTTATAATTGAGGTTAAGTTATTTAAATCCAAAGAAATATACTCCTACTAGTC
AGCAAAGAAGCAGCAACAACAATTAATACAGTTCTATTGATTACCAAAGTTTCATTTGCC
ACTGTGTTCTTTTGGAGTAGACTTACTCCTGGCTAATTATAAGTCTTAAATACATAAAAT
GCATAAATCTTCTAAATAAACTCAGGTAGGGCTGCAGTCACTGTGCACAGGTGCAGATTG
TGGGCTCTGGGGTCAGCTGACCCAAAGGGCCCTCTAGCTGGTTAAGGTTACTCCTCTGGG
CCTCAGATTCCCCTTGCCATGGCCAGCCAGTCGCAGGGGAGCCAGCAGTTGCTGCAAGCC
CAGAAGTGGGCCTCCAAGAAAGCAAAAGAACGGGAGTCTGAAGCAGGCTGAAGAAGCTCG
GGCTGAAATGGAACAGCACCACCTGCAAAGGGAGAAAGAGTTTAAGGCCAAGGAAGCCGT
GGGTCTGGAATGGCAGTGGCAGCCCTGAAGCGAAGGAGACCCAGGAGAAGATGACTGTCC
TCCAGAACTACTTCCTACAGAACAGGGATGAAGTCTTGGATAAGTTCTTGGCCTCTGTCT
GTGACATCTGGCCAGAAATCCATGAAAACCACCACATAAAGGGATAGAAGGACTAAGTGC
CTGTTCTATGGATTGGCGTCTTGTGAAGTTTGAAGCGTTACAGAGCTCCAGTTATATTCT
TGGAAAAGGCATTAAATTATTTCTGTATATTACGTAGTAGGTCCCTTCACTTTTTGCAGA
GTAGCAAATCTACCTTCTTTATGTAGACTTAGAACTTATGCAGATTTCATCTTTTACCTC
ATATTTCTTAGAAATTTAATGCATGTACCTTGTTTTCCTATACTTTTAGCTCAAGCAACT
CCTATCTCAATGTTACCTTTTTCTTTCTTAGACCTAGTTAAAAGAGAAATTCTTTGAAGA
AAGAAAGGGATTAAGTAATGTTCATTTTTCCCTAATGCGTTCTTGAAGGGCTTTATCTGT
GAAAAAGTAGTAAATAGTTACTTGTAACCTGTGTGAAGCAGCAACCAGCCTTAAAGTAGT
CCATTCCTACTAAGGGTTATAACAGTGACTACTAGTGTAATCATTTGAGCTGCTTTTAGT
TTCTTTTAGTCAAAATACTAGATGATAGAATTCAAAAACGTGTTACATGTTATTATTACT
TGGTGTACTGATAATCATTTATAAGTAAAAGTCTCTTTGTCATAAAAAAATCAATTCAGG
GACCAACAGTTAGCGTAATGGCTATATTGCTGGACTCCCATGTAGCCGACCGTGGTTCGA
GTCCCGCACCAGGTGGCTTAAACTCACACCGGGCGCGTGTGCGTGCATGCCCGAGATCCT
GAGAGGACAATGGAGGAGAAGGGATTGCAGCATGCCCATCCCCACTGGTGGGTGATATCT
TGCTTTCTGTCTCTCCGTCTCTCTCAGTCTGTCTGGTGAGCGCACGCACCCTATAGCAAA
AATCTCTCTCAAAAAAAAAAAAAAATCAATTCAGTTAATTGGCAATAACAGGTTAAATAC
AGTATTTAAGGAGGCTTTCATTGAGTTAGCCATAAAATCAGGAAACATAGTAAAGCTGTA
TATCTTATGATATAATCATCAATTTTTTTCTACAGATGAACCAGAACAGCCACATCATCC
TGTGTGGTCAGATTTCTCAGTACAACAAAGATGTGCCTTATCCTCCTCCGCTACCTCCTG
CAGTAGCCACAATCCAGAAAGAAAGAAACATCACAAGGTGAGTTCTCCCCCCTTACCCTC
ATTACCAGGTTCCAGGGGATTTAAATGTCATAGAGAGAGGAAATTTATTGTTCTTCACAT
GCAGTCTTTCCTAATTAAATAAAATGGGGATATACACTTTTTTTTTTAAGAGGATTTTGC
CCAGGGAGTATGTGCTTGCCAGAGAGAGACAGAGAGACAGATCCAGTGAAGATGAAAGGG
AGAAATTCACCCCCCAGGGGGATGGGCACACTGCAATCACTTCTCTATTCTCCTCCTTAG
GATCTTAGGTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCCTTTATTAAAATTGGTATG
GCCAAGGTATTTTCCATAGTGTATGGTAGAAAAATTAAATGTTTTCTCCCAATATAAAAT
TTTAAATTCATTAATTTAACAAATATTTGTGGAATACTACTGTCTGAGAAGCTGTGCTTT
CTCAAAAATCATACAAGCACCTCCCAGTACCTCTACCTCTTCACCACCATTCCTTTTTCT
AGCTCTCCCTGACATTCTAATGTATCTTTTAGTCGATGGTTGAAAATCAGGAGTTACTAA
TTTGAGCTCTGGAGATCCTTATCTAGTATATTCTCAAAACCTACAAAATATAGACAAAGT
TTTATGTGTGCAGGCTTATTTACCTTTTTTGTTGTTTTTTGTTGTTTTATTTTGAAAAAC
AGGTATATAGCTTGTGACTACTGTTACTAATTGAAAATTAGCCAATGGGAAATAGGATTA
AATTTTACTTTTTGGCTATAGGGAGTGTGTGCTCACCAGAGAAAGAGGGAGAAGAGAAGC
CACCCCTCATGGGGAATGGTCACGCCATGATCCCTTCTTCTCCATCCCTCTTTCTTTTGG
GATTTTGTGCATGAGTGCACACACTGCCTGGCATGTTTCTCAAGCCACCAGGTTCAGGAC
TAGAACTGTGCATTTGGCTGTGTGGGACCTGGCGGCCTTAACCATCAGGTCACAAAGTTG
GCCCCGGATTTTATTTTATTAATTAGTCAATTAACTCTTTTTTTTTTTTTTTTTTAATTT
TTGCCGGAGGGCACATGCATTTACCTGGCAGGGAGAGAGGAAGAGAGAAAGTGAGAAAGC
ACCCTCCTCTGTGGGGCATGATCATGCTGTAATCCCTTCTTCATCTCTCCTTCCTTTCAG
GATTTTGTGTTTCATGCATGTACACACGCCTATATCCCTGGCATATTTTTCAAGCTTCAG
GGTCCAGGACTCAAACCGTACACTTTAACCCCCATGCCACCAAGATTTTATTTTTTATTT
ATTTTTAAAAATGTATATATTTAATTCCATTTGTTATTATTATTATTTTTTAAAGGTTGG
CCAGAGAGAGAGAGAAAGGGAAAGCAAGAAAGCAAGCTGCCAGGTCTGGGACTCAAACCA
TGTTTGGCCACATGGGAATCCAGCGCCTTTAACACCATGTCATCTGCTGGTCCCTAAGAT
TTTATTTTTAAAAATGAATTGATTAAAAAAAAAAAAAAGGTGGCATAGTAGTTAAGGTGC
TGGATTCCCACACAGTTGACTGGAGTTAAAGTCCTTGACCTGGTGGCTTTCTTTCTCTCT
CTGATAAGTGCACAAACCCTATAGCAAATTTAATACTAATAACAAAATAAAATAAATAAT
TAAAAAAATAAAAATAAAAATGAATTGATAGAGGGACCAGCAGGTGGTGTGGTGGTTAAT
TAAGTTGCTGGACTCCCACATGGTTGACCATGGCTCAAGTTCTGGACCTTGCTTTCTCAT
TTTCCCACTCTTTCTCTCTCTGTGTCTTTCTCTGGTAAACATACAGTCCTATAGCAAATT
AAATAATAATAATAAATAAGATTATTCTTTAAAAAATGAATTGATACTTTTCTAGCAAAG
TTTCCTACATGAGACTTTTCTACCCAAAATTAAAAATTAGCTATTTTTAAGACAGGAAAT
ACTTAATAGTGGGCCAGCTCTGTGGCCTGCTGGTTAAAGGAGCTAGATCCCATATGGCTG
ACTGAATGGACTAAAGGTTTGAATCCCAGCCCTGGAAGCTTGGAAAACACACTGGGTATG
TGTGTACATATGTGTGTGTCCCATATCCCAGTAGGTGGAGAAATGGTGGACAAGGGTTGT
GGCATGACCACACTCTACTGCGGTGTGCTTTCTCCCTCTCCCTCAACCCCCTCTGTTTCT
CTGGTGAGTACGTATACTTTCTGGCAAATTTTTAAAAAGAAACTAAACAGTATTGCTGCC
TTTTGTTTGTTTGTAGTTTTTGTTACAGGGTATGTGTTTTGACAGAGAGACAGAAAGAGG
GCGAGAAATAATATGTATGATAGAAAGGAAGGAAAGAAGGAAGAAAATCACTTCCAGGGG
TATGCCATTCTGCAATCCTTTCTTCTCCATTCTCCGCTTAGGACTTTGGGTATGCACACA
CACACGTGACAGCGTGATTTTTAAACTACCAGATCTGAGATTCAAACCACACAGTCAGCC
ATGTGGGATCTAGCTGCCTTAACCATTATACCACAAGTTGGTCCTGAATTGCTGCCTTTT
GTAAAAAAGAAAACTATTAATAGAAGAATTAAAGTTTGATAAAGAACACTAAATCTATCT
ATTTCAATTTACAGATCAGAGAGACTATGATAAATGGATTGGAAAACATGGGAGGTAAGA
TGCATGTAGGCTTATCTAATTACATGTGTGTGCTGAGCACAAATATTCCCCTTTTTAATG
CTACCTCTAATGTTCCCCTTTTAAATTCTACCTCGATTGCACTTTTTTCTTTTTAATCAT
TTATTTCTTTCCTGTAAAACTGTCCTATAGGTTTCCTTAAATATCTTAAAAACTCAGTGA
AAGTTCAACTTGATGTTTTTTTGTTTTTAAATTTTTGCCATAGGGGCTGTGCACTCACTG
GAGAGGAGAAAGACAAGGAGAGGGAAAGTGAAAAATCATCCCCTGGGGGCATGGCCATGC
TGCAATCCTTTCTCCTCCACTCTTCTCTTGGGATTTTCGGCATGGGTACACATGAGCCCA
GCGTGTTTCACGCCATTGGGTTCAGGACTTGAATTGCGATCTGCCATATGGGATTCTAGC
TGCTTTAACCACCACACCACCTGCTGGTCCCAACCTAATGGTATTTAAGAGGCATTATTT
TCACATTTTAAATTGTAAAATAAGTGTTTCTTTAGTTTTTCATAGAATCTTCAAAAAAAT
TGTGGTAATTGTGAAAGTTATTTAATCTCTGGGTAACATTTCCAGATTAAATGGTTCTAA
GGCATCATAAGATTATATTATGCTAGTTTTCAGTGTTCTATTATTTTGTATATACAGATA
TTCTCTTGTTCACTTCAAAGAGATTTATCAAATAAAACTGATTTTTGCCTTCTTTCAGAA
AAAATTTAATATATTTAGTTAATATGTTTGCTAAAACATAAATAGAAATTTCACTCACTG
TCTTGCATAATAAGTGTGCATTGCAATTTGCTTAATAAAATTGTAGGGCTGGCTCCATGG
CCTGATAATTAAAGCAGATAGATCCCACATGGCTGACTGCATGATTCTAGTCCTGGACCN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TTTTAAAATTTTTTTCCGCCCTTCTAGCTGCATTCCAGTCCATGATGACAGGAGGTAACA
TCGGGAAGCAGATAGTTTGCATTCAGAAAAAATCTCTTTGTAATATCTGTAAATCTTCTC
GTCAGGGAAATCACTTTTTTTTTTTTTTTTTTGCACAAAGATTTTTAAGATTCATTAAAG
AAAAAATATTAGGGTACAAATAACTCTTGGTTTAAATATGATCATAGGTGATATTTTCTT
AGTTGCATATTCTTTCCTATGGGTTTCATATCCTATATACACTTACATTCAAGATAGGAT
TATTTACAATAAAATCAAATGATCAAATTTTTTTTTTTGCTAAAACTAATATATGTTATT
TTTTGTCAGGTATTCTGAACTCATTAATGAGTTGATATAATTGTTAATAGATCCTACACA
ATAGATTTTGAAATTTATTAGTTTGAAATATAATGCTTAAGAGACAGTAAACATTTGAAC
TGGAAATATTTTACATGATCCTTAAGTTGAAACTTGATGTTAAAAATAGAATTGGGATGG
CCTTTCCATATTGTATATAGAAAAGAGACTTAGTAGAATAATTCGTATGTAGAGATTGGG
TATAGAGATGGCGGTGTGCAGAGCTTGTTTCTGGGATAGGAGAGCAGAGGCTTGGGGTTA
GAAGAGCATGAGAATAACAGGTAGGTTAAGTTGATAGGCTAGAATTACTCCAGAAGATGA
TCTGTTTCTGTTTTGCCAAATCATTTTCTGAATAGCCTAGAACCTCTAGGCATGTTTAGA
TTAACAAGTACATTGTGTTGAATAATTTAGGAGGCACATAAATAATAAATGTCATTTGGA
GTTTTAGGTAGTTAAAAAGATTTAGACAACAAAGACAGGACTGACTGACCAAGTTAACAA
ATGTTTGAAAACATAACTGTTAAAGACCACTGGTGGTGTACCTCTAACTAAGAATTTGTT
TTATTGTAATCAATTCTTTAAAACAGTAAAATTATTTTTTTTTCTGAGCCTTCATTGCGT
ATTCACTGATTTACACACTGTGAATATACTTTTGTATGCAACATTTGTGATAAATAGATC
AGTAATCAGTCACTCCACTTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1117, 2056..2247, 9759..9929, 11520..11729, 14915..15036, 15641..15728, 18374..18413, 19887..19942, 19945..19962
1001..1117, 2056..2247, 9759..9929, 11520..11729, 14915..15036, 15641..15728, 18374..18413, 19887..19942, 19945..19959
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved