Tupaia_belangeri Locus FXR1
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri FXR1
Tupaia_belangeri
FXR1
GeneScaffold_1497
SNORA38
48273..48402
116123
CATACAGTCTGGGAAGATGGTGGGAGGAGGCTCTGAGGAAACACAATAAGGAAAAATTA
AGTGAGACATTCATGGGACAAAGAAATGGGTTGAAAATAACTCAACTGGACTGGTGAGAA
ATGTATTCATGTTGGAATATTTACAAGCTAAGTGACATATGTGATTGAATGTATAAAATA
AATTTAAATTTAAAACATTCACAATGTCTTTGTCATGGTGCTTACACAGGCGGGCTAGGT
TCTAGTTGAAAAGTCACATAAGGTAGGTCTGCCTTGACATTATTTGTGGCACTTGGTAAG
CGCTGCAGCAGGGGAAATGTGCGCTCCTACGTAAGGTTCCCTGACTACTAACAGTGGGTC
ATGAGCTCAACTCTGGTCCGCGTTGTGAGCGCAGCTGCGTTGCAGCGGCTCCGCTTTCCT
TGCCTTTTAAATAGCTATAGTACCAGGTCGGGGGTGAGGCCTTGGCCAAACATAAAAGGG
GTGGGTGGTAAGAGCTGGAATTGAGTCGAGGGCATACCTGATTTTATTTTAAAAGAAAAA
AAAAGCGGGGAAGACTTCGGAGCCCAGCGAGGCACACTGGCCCGCTATCCGCGCCCGAAG
GTCGCGCGGGGGAAACTGCAGCGCAGAGCGAGGCTTCCCACTCGGGAGCCACTGGGGCGC
GGCCGAGCGCAGACGCGCGGGCCAGGCCGGCGGGCGGCTCGCTCGGGGCGGCGGCACGGA
GCCGCGGGAGGCGGGCGGGCGAGCCCGGGGCGGGCCGGGGGCGCGGCCAGCGAGGCGGCG
ATTGTGCCGGGAGGCGGCGGGCGGAGCCCACCCTAGGTGACGCACGCAGCCCGGAGCCCG
CCGGGCGAGCGGGGCGGCGCGGAGACCCCGGCCGGGGCGGGGGATCCCAGTCCCCGCCCT
GCTGTCCCCGCCCCTCCCCGGCCTCCTTCACGCCCCTCCCCCCGCCCCTCCGGTTGGAAA
GTTTCTAGAATCTCTTCCCGGCGGCCTTTGCGGTTCCACACACTGGCAGGAGCTGACGGT
GGAGGTTCGCGGCTCAACGGGGCTTTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTT
TACCATTGGACAGATGTACTTGCCAGACAGTGAGAATGGAAATGAAAGAGAAAGTATTCC
CTCCAACAGAGCATGATCAGATCACGATTCTCTTTCCTCCATTTCTCCTTCCTGTCAGGA
TTTTAGGCATGTAAACATATGTGCCGTCTCAAGTCCCATCGAGGGGTGCTTTTTCCATCT
CCTTCTGTCTCTTTGTCTTTCTCTGGTGAGTACACATACCCTCTGGAAACTTAAAAAAAA
AATTATTCCAGTCTTTAATTATTACAAACAATACTATACTGGATAATAAACATTCTTAGC
TTCATATCTTTTGATAGCATTTTTAAAGACTTTTTCTCTTTTATTGTGCCAGAGGGCATG
TCTGCATGCACAAAAGAGAGAGAAGAGAGAGGGCAAGTGAGATGATAGAAAAATCATCCC
CCAGTTGCTTCTGGTCACACTGAAATCCTTTTTTCCTCCAATTATCCATCCATTAGGATC
CTGGGCATGCACCAAAGCCAGGACTCAAATCTTGGTTAGCCATGGGGAATCCAGCTTCCT
CTGTACAGAGTTTAATCACTGTGCTATGGGACCTGATGTCTCTCTACAGCATTTTAAAAT
AGATTGAAACAGCTTATAGCTAGAACAAGAAATTATCCCCTTAGCTACTCCCATGTATAT
GTTTTCTTAAAGTTCTTACTTTAATTACATATAGAAAGTTGTCTAACAGCCTAGTAATAA
ATTTCATTAGCAGAAACTAGAGCATTGCCTACATGGATATTACATAAAATAGTGCGCTAA
ATGGTCCTGTCTCAAAATGGAATTGTAACAGGCAAATTCATAATATGACCAACCTAATTG
GGAATGCATGTTTTAGGTATGGTTTATCATTCCTTCCTTCTTCTTTCTTATCACCATGTC
TTTTCTCCATTTTCCCTTTTTCTTTCCCTCCCTCCTTTCCTGACTTTTTACCTTTCTTTT
TTCCCTTCTTCCTCTCCCTCCCTTGCTTTCTTCCCTCTTTTCACACTTGTGGATATTAGT
AACAATTTATTAAATATGTTAGAATATACCTTTCAAACATTGGCATTTACATTACCATAT
CTGTGTAATAATTGTTATGTGTAGACAATCACTGAGAAGTATTTCTAATTTTCACAGCCC
TTAAAAGACGGAAAGACCGAGGTTCCACATGGCTCCTGCGAACTAGGTATTGCAGGGCAC
AGGAGAAATGAAGACTTTCTACTGATAATTCAGCCTCCAGCAAACAAGCTAGTGGTAGGG
AGCCACCCCACCCAACCCGCAGCTTTCTATCTCTATTTCTGTGTCTCTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCTGTTTTACTATAATTGTAGTAGACTACAGAACAATTTCAAATATATATATTATT
GTAGTTTACTTTAATATTAACTGAGGTTTTGGAGTAATAGCCTAAATTATGTAGTAGGTT
TATTATCACTAATGGTGGTGACATATAAAGTCATAGTAACAGAGTTGTAGTCTGAGGGTT
TACTGACTTGTCAGAGTTTGTACAGAATCTTGTCAGTTGACTGCTTTGTGGAGATTAGTA
TTGAGGAAAAGATGTTGCCTGTCTTCATGTATTAGTACTCTCTGTTAAATTAAAAATACA
TAGATCCACATATTTCAAAGATAATTTTGAGTTATATATTTAAAATTTTGATATTTATAA
TATAAAAAGCTTAAAGAACTAAGATTTAACTAAGTTGAAAATGTCAAAATTTTTATTTTA
GTTTTTAGATTGCTCATTGTTGGGAGAGGGAAAGCTCAGATCTACTCCACCATCTTGCTG
ATATTGATTACAAGTTTTAGAAATTAAATGTCTTTTTTTGGGGGGGGGGTCAGAGGGTGC
ATGTATGCTCTTGACCTGAATAGGAAGGGAGAAAGTGAGGAAAGCACCCCCCCCCATGGG
CAGGGGCACACTGCAGTCCTTTTTCTACTTCTCTTTTTGGGCTTTTGAGCACATACACAC
TCATGCCTGGTGTGTTTTGCAGGCTGCTAGATATGGGACTTAAAACCATGCAGTTGACCA
TGTGGTGTCCAATTGCCTTATAACCCCAGGCTGCTTGCTTGGCCATTAAGTTTTGTTTTT
GTATTCCAGAGCAATACATAATTAGGGAAAATCTAAAAACAGGAAACTGAATCCTGGCTC
AATAATATACTTCCAGGAAGCGACTTTTACATACTGTACTTTATAACTAGATCTTTTCTG
TATCATCGAAAAGATGCCTTTGGATAAGACAATAAAGTTGTTGACAGCTTGTTTAGGAGA
GATTCTTTTAAGCAAATCCATGTATTTTCTGATTTTCATGTCTCACGGACTCTATGAGTT
GTGTATTTAATAATCATTTTATATATTGGGAAACTGACAATAGGAAGTAAGTAATTTGAC
CAAGATTACACCTTAGTTGAAATAAATGGCCTTTAACTCGTGGGCTTCTCTTTAGCATAG
GATTATAGAGATTCTTCAAAGGAAATTTTAGGGTAGTGTGTTTTAGTTAGGAAGACAAGA
GGAGACTCTTGACTAAATTACAACTCAAATGACTGTGTTGTCTCTATCACAAAGTTAAGG
ATGTAGCAAATTAGATTTTTTTTTTTTTGGTAGTGGGAAGAGCAATATGCATTCCACGAA
CCCTAATTCATTCTTTTTTTTTTTTTTTTTTTTTGAGAGGTTTTTGCTGTAGGGCGCATG
AGCTCACCAGAGACAGAAGGTGGAGAAATCACCCCCCAGGGGGATGGCCATGCCTCCCTT
CTCCATTCTCCTCTCTGGATCTTGGGCAAGCATGCACACGTGCCCGGCCTGAGTTTAAGC
CACTGATTCTGGGACTTGAACCACAATTGGCTGCATTCAAACTGCGATTGACTGCATGGG
AGTCCAGCGACATAGCCATTACACCAGCCCCTGGTCCCCATGAGCCCTAANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCCCACCCTTTTTAATGGA
CAGAGTATCCAGGTGCATGCCAGAGAGAGGGAAAGGGAGACAGCAACTCCCCAGCAGGTT
GTGGTCATGCTGTGATCTCTTATCAAATGCTCCATTCTTCAGAGTTTTGGGACACAAAGC
AGTGTGACTGACTTGCCTTTCAGACCACTGAGGCTGGGGTTCAAACTGTAGTTGCCCATG
TGAATCCAGCTTTTTGTATGTAGCGCTTAACTCCTACCTGTTAAGTCCAGGCCCCAATTT
GTATTTATTGGAAGAAAATCGGTCAGTCTTCTCTTCTGAACACAATTTGTTGTGTAATCT
TACTAAGTAATTGCACAGATACAAAACGACATTGTTTCTGGTTTTGGTTCAAACTACAAT
AATTATATCAGGGGTCATAGTCAAAGTCAGATGTTGTCACAGCACCTGTTGCATACATAG
AGGAAACTAAATGGAACTTCAGCTCTGCAGCAGGAAAGTCAGGATAATTTTGAGTGGCTG
TTTGGAACCATTTTTTCATTCCATTTCAAGGAGTATTGTTAATACTACAAACTTGTGAAA
TTAAGCCAAGAAAATTACTTGTATATAGGCCGTAGTAGATTTTGCGTATTCTTTTGAAAT
CTTCACATTCTTGTTATCTTCTGGTTTTCCATTCAGAATAGCTAAAATACAGTCAGTTGC
TGCATAATGATATTTTGATCAACAGTGGATCATAATATATACAAGGTGGTTTTATATGCA
TGGCCTAGGTATATTGTGGGCTATACAGTTGATCAAGGTTTATGTAAGTATACCCTGTAA
ACACAGTGAAGTTGCCTAATTACTCACTTATCAGAATATACCTGCATTGTTAAGCAATGT
GTGATGGTACTCAATATTAATGAATTCTGAAGGTTCTCCTTGAATACTTCTCTCCGGTCA
TAGCTTTTTCCAGAATCAATGATATTTGTAATATATCTTGTAACTAAAATATATTTATTT
ATAGAACACGCATCCGTTGGTTAGAAATAATTTTCATTTTTATAGATTTAGTTATGTAGG
ATTTTTGGGGGGAGGGGATGTCAGGAGGTATGTGCACTTGCCAGGGAGAGAGGGAGAGGG
AGAAAGCAACCCCACCTACACTCCCCAAGTGGAGCATGATCATACCTCAGTCCCTTTTCC
ATTTCTGAACTCATAAAGATTTTTGGTCATCACATATAATCTATGCAGTATTGAAAAATA
CTTTGAAGCTGTCAGGGCTGGGATTGAAACCGGTTGGCCATGTTGGCTCTAGCTCTCTTA
ACTTAGCTATGGGACTGGCCCAAGGAAGAAGGGATTTTCTAAATAAATATTAATAGATTG
CTTTCCACAAAGACTTTTTTTTTTCTCTTAAATTTGCCAGAAGACACATGCTTATTGGAG
AGAAAGAGAAGGAAAGTAAAGAAACCCCACCCTCACCCTCATAGGAGATGGTTGTGCTGC
AATTCTTTCTCTTCCATTTCTCCTTTGGGATTTTGGGCATACATCACCAAGCTTCAGGCC
TGTTTGTCAAGTCACTGAGTCTGGGACTCAGACTGCTAGTTCAACCATGTGGGATCCAGT
CATCTTAACCACCACACCCTTGACTGACCTTTCCATGAAACTTAACATTTTCTTTTTTCA
CCGTCAGTAAGTGGCAAGTCTTTTTCTTTATATCCCTGCCACCAATAGATTTTATAATAT
TTAATTTTTGCCAATTTGTTAGTTGTGAAGGGATTTCTCATTGGAACTTTGTAGATCCAA
CTTGTGATTTTTAATGTTTGCATGCCATTTTGATGTATTCTTCTGTAAATTTCTTGTGTT
TTCTTTTGTGGTATCCTTTGTCAGTTTTTGAGGTCCACTTGCATATTATGTATATTAACC
TTTTAATTTAAAGTAAGAGTGTCTCCTCTTCTCTCCCCTTGTTTTTTTCCCTTTCCAGCA
TCTCTGGCCACAGAGAAGTTTGTTTTTGTTTTTGTTTGTTAAACATTCTGATTCCTTCAT
AAAGGCTTCTGCATTCCAGTGCTGGTTAAGACACTCTGTACCCAGATTATACATGTGGTC
TTTTAATATCCTGCAGTATTTTATTTTCACATTGAAACATTTGCTACATCTTTTATTATT
ATTATAATTCTTTAGGTTTTTGCTATATAGTGTATGCACTCACTGGAGCGAGAGAGAGAA
AGTGAGAAATTGCTCCCCACAGGGGATGGCTATGCTGCAATCTCTTTTTCTGCATTCGTC
CTCTTGGGATTATGGGCATGCATGTGCCCAGCGTGATTTTAAGTCACTGGGTTAGGGACT
TGAACCGTGGTCCTCAGAATCCAGCATCTTCATTACCATGCCACCTGCTGGCCTCATAAT
ACTTTTCAAGTTCTTTTATTTTTACTGTTTTTATTCTTTGAGAGAGAGACACAAAGGGAC
AGACAACAGGGACCGGCACCCTCAGTAGGTCTTAATGCTGTGATTCACTCCCATTATCAT
CCAGCCAGGATCACAGATGCCTGCTTGTATGTCTAACATGTACAGGGAGATCCCAGGATG
TGAACCTGGGAGCTTTCCACATGGCTTTAGCATTATGGAGCATTGTGTTATGCTGCGCCA
CTGAGCCTGGCCATTGAATATTGTTTTGAATAGTCATGTGGATAGGCAGATGTGTTAATG
CCATGCATTAAAAAAAAACTTATGTCTGTTTGAAGGCTTTAAACAATTTTTCTTGTATGT
GGGGATTAGCTACTTGGTTTTCTTAGTAATACCTCCCTCACTTCTAGTATTGGGATCAAG
GGATGATATCTTACCATCCAGGAGGGTTGAATCCCAAACAGATTGGTAGGATCTCCTGAG
AATTGCTCCCTAAAGTCTTTCTGGCAGGACCATGAAGAGGCCCTGAAAGGAGAGGATTGA
AATTTTGCTTTTTGACAAATACAAGTAGTAAGGAGTCTTACTTTCCCTACATTACTGCCT
TGAGTCTGCTTGTTTTACCTACCACATAGTAAGTGGTAGGTCAGAGATTGAATAGTGAAA
TTCTATATTGTATTGCTTTCATTCAGAGAGGTGTTGTTTTTCCTTCCTTGCCCTGGTTGT
TCTTTATTATATACTATACAGACAGTCCCAAGGTATTAAATGTTTTATTATTAATCATTT
AAATTACTTGGCAGAAAAGTTTTAGGAAGATTTACCATGTTATTTTATGAAGGGGAGTAA
CATCCCAACAGGGTCTTGGATGCCGTGATCCACCTCCACCCTTAAGTCAGTCCTGGATCA
TGGGCACATGCATGCTCTGGCTTAATCAAGGTATTTGTGCCCAGTATACCGAGTGAGTGC
TCCAGGTTTGATTCTAGAACCTTCCCATGTGTGTCAGCCTCAGAGAGCATCATGTTTTAG
TACTTCTCTACCATCCATTCCTCCATGAAATGCTGTTTTTTTTTTCTTAATAATCGTATA
GGTAGTACTGTTCTGCATAATTGAGATTAAGTTAATTATGCACAGTGGATAGCTTATTGT
ATTGATCTGTATTCTCTTAGAACCCTGGTTAAAAAAGACTTGGCTATATTCAGCTTATTC
TTTAAAAAAATTCCTGTGAAATGGGTCCTACATGTTCAGGGTTCAAAGCATGATAACAGA
TGAGATTCTGGCTGTGGACATGTTGATTTAAGGTGCCAGTAAGTCAGAAGTTGAATACAG
AATTAAGAGAATAGATTATTTTTCCCTGTACAGATTTGAGAAATTAGTGGAAGATCTACG
TATGCAATTTCATTTTACTTGAAATGGCATCGGTTGTGGGTCTGGAAAGTGGTGCAGTGA
TGAAATGCTATGCTCTGGAGGCAGTTCTACATGGGAGCGTGCCCCCCCCCTCCCCCCGTT
CAGGTCAGACTTCTTGACTACAGTAGGCACACTCTTGCAGTGGTCCAGGGCTGACTGATG
CTGGGGGTCAGATCCTGGTGTTGGGACCGTTGGCTTCCTGTCTCACTCTTAGGCTCTCAC
TCATGGAAGAGATAAGTAAATGTTAAAGAAAATATGAGGAATAAGAATGAAGAGCTAGGA
AATAAAATAAAAATGTTTTAAAAAGTCATGACGGTTTTAACAGGAGTCCTACCACTAAGA
AGGAAGGAAAGTTCCCAGTTAACTTGAGCAATGGTTTTCCTTATGTTTTGTGTACTTACT
GAAAGTTCTCATTTAAGCACTTGTGTACATAAAATGAGAAATATAAGCAGAATAAAGCTG
TTAAAATGTCACATGTTGATGTTTGTGTTCCTTCTCATGGTATCATCTTAGTGCCATGAA
GAACATTGATGTTACAAGCAAATTGTAGATGACCTCACTATTATCTCCAGGATTTTTTTT
ACAAGAATTTTCACCCAGTCTGCAAGTTTTGATGCTGGCACTTTTTTGAATATTCAGAAG
ATGTCAATAGAACTACCTTCTGGTAAGAAACCTCAGTTCTTCCTAAAACGGTCCTGGGAC
CAGCAGTTGGTGTAACAGCTATTTCACTGGAATCCCATGTAGACGACTATGGTTCAAGTC
CCGAACCCGGTGGCTTAAAACTCATGCCGGTTGCGTGTGCATGCGTGTGTGCCTAAGATC
CCGAGAGGAGAATGGAGGAGAAGGGATGGTGGTGTGGCCATTCCCCCTGGGGGGTGTTTT
CTCGCTTTCTGTCTGTCTGTCTCTGTTTTTCCGACGAACACACACGTCATAGAGCAAAAA
CCTCAAAAAGAAGTAAAGAAATAAATAATAAAATGGTCCCTCCTTTGTTTGCTCTTTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTATGAGAGTGTGTGCAGGGG
AGAGGGATATTTTTGACAGATATTCTTGCCCCAGTCTCCTAGTCAACTGAAACTGCAGGT
TTGCACACAGTGCCTGGTGCCTCCTGCTTGAGTCACCACAGGTCCACAGGTGGGCCCTTT
GTATCAGTTTTTTTTTTTTTTTTTGGAGAGGTTCTTGCTATAGGGGGCGCATGGGCGCTC
ACCAAAAGACAGAGAAAGTGAAAGATCACCCCTCATGCCCTGGGGGTATGGCCACACGCC
AATCCCTTCTCCTCCATTCTCCTCTCAGGATCTTGGGCATGCACGCGCCAGGTGTGAGTT
TAAGCCACCGGGCATGGGACTCGAACCATGGTTGACTACATGGGTGTCCAACAACACAGC
CATTATGCCAGCTGCTGGTCTCCCTTTGTGTCAGTTCTTAGGAATCAAAAAACTTATGTG
GTGAAATTTGCATAAGTTGTGTTAGTAACTCACTGTTTATATTTTATTAAATCTTTCGAC
TGCAGTAATCATTATTTTTTATATAAAGTTTGTTTTATCTGTTTCTTCCATGAATGAGAG
AGAGACACAGATACAGCACCCCAAACAGGGTCCTGTTGCTGTGCTCCATCACCAGCCTTC
AGTCACCTCCAGATCATGAGCAAGCTTGTTCCTAGTATACTTAGGGAGGTTCCCTAGGCT
TGATCTGGGAACTTTCCCTTGCAGAGAATCATGTTTTACTACTGCAACAACATCTGGCCC
TTCGCAGCAGTGATCTTTAATTAATGTAGTAGAGGAAAATAAAGAGTTCTCACTTAGAGG
AAAGGCCCAGTGGTATCCTAACAAACTGAGCCGACTGTCTCTAATAGAGAAGAATTCATC
AGTTTATCTTTAGAAATACAGTGCTGTATTAATAGGTTTGTTTCATGAATTAAGTCATTA
GCTGCAATGTTTCTGATGCATTTGAGAAGGCATCATAAATACAGTTATTTCTGACTACCT
TGCAGATTAAATATAGAGACAGTGTTTATTTACATTTCATGCCAGTGATTCATGAGAAAA
GACATTTTAATTAAAACTTAGATAAAAGAATTAAACCAGAATGACTCTAAACTTATTAAG
TTGGATGAAACAGTAATAGGAGTCTGTTACTCCTTCTTTTAAATTCTTTTCATTGGCAGA
AGGTGCATGTGCTCAACAGAATAGAGACAGAGAGGAGGAGGGAAAGCGATTAATGTTCCC
CCCTAATGGGATATGGTCATACTGAAATCTCTCTTCCTCCCATTTCTCCATCCTGTTGGG
ATTTGGGCCTATCTGCACATATGCCTGGTGTGTTTTTCAAGCCTCAGGGGCCAGGAGTTG
GAAACGTGCAGTCAGCCATGTAGAATCCAGTTCTCTTAACTTCTAGACCATGGGGTCAGC
CCTCTTTTATTTTAAATTTATTTTTAGTTTGTTTACTTCTTCCATAACAGAGAGAGAGGG
GCAGCATTCCCACCAGAGTTTTGACTTAGCAGTCAACTCCTGCTTTAGCCAGCTGAGGAT
CATGGGCATGTACATGTTCACAGAGGTCTCCAGATGTTAACCCAGAACTTTTCCATGTGG
GTCAGTATTGTGTAGTGTTGTTTTACCACAGCAATACCATTCAGGCCCCTGATACTTCCT
TTTTTTTTTTTTTGCTTGCTTAAGAAAATACATGAACCAGAGACTTGATTCCTGACAGGT
CCATTATATATTTTTTCTTTTAATTTGTCAGAGGAGTTGTGTGCCTGCCAGAGACAGACT
AGGAGGGAAGCACCCAACATGGAGAATAGTCATACTACAGTCCTTCTCCATTTCTTCCTC
ATTTTGGGATTTTGGGCATGGTCACACATGCATCCAGTTTCTGTTTGTTTTGTTTTTTTT
TTTTTTTTCCTCAAGCAGCCTGGTCTGGGACTCGAAACATGCAGTTGGTTCAGTGCATGT
AACCACCAGGCTATGGGCTGCCTGACAGATCCACCCACTATTATACCACAAAAATATACT
TTGATAGGTTGGAATAATGAGATTGAAGTCATTGAAATGTTAGATCACTGCACTAAGAAT
AGTTTCTAACCTCAATTTAAGATTGTACTGTTCAAGTTTTTGTTTCCCCCTTATAACCAG
TGTTAATTTGTTATTTAATCAACTGAAACAATAGGAAGATGTTAGTGGGGCTTTTAAAAA
TCTAAAGTCTATATATTTTTTTTTGTTGTTTTTGAGAAAGATGTTTGCTATAGGACATGT
GCACTCACTGGAGAGACAAAGTGAGAAACCATCCCCCAGCAGGTATGGTCATGTTGCAGT
CCCTTCTCCATTCTCCTCTTGGGGTCTTGGGCAGGCATGCACACACACATACCTGGCGTG
AGTTTTAAGCCTCCAGGTCAGGGACTCGAAACGCAGTCAACCATGTGGGAGTTTGGTGAC
TTAACCATTATCCCACCTGCTAGTCCCATGTCTAGATGAATTTAAAATCATAATTTTTAG
TCAGTTAATCCTAGACTGTTTTCAAATAACTATTTTATTATTATTATTATTATTTATTTA
TTTTTTTCCTGGAGAGGTTTTCGCTATAGGACGTGTGCGCTCACCAGAGAGAGAGAGAGA
GAGAGACAGAAAGCGAGAAATCACCCCCCCCGGGAGGATGGCCATGCCTCAATCTCTTCT
CCTCCGTTCTCCTCTTGGGATCTTGGGTACACACGCACATGCGCCTGGCGTGAGTTTAAG
CCACCGGGCCCCAGACTCGAACTGTGGTTGACTACATGGGAGTCCAGCGACATAGCCATT
ATGCTAACTTCTGGTTCTTTATTATTATTATTATTATTATTATTATTTTAATTTGACCAG
AAAGAGAGAAAGCGAAAAAGCAAGTTGTCAGGTTCAGAACTTGAACTGCAGTTATGTGGA
AGTCCAGTGCCTTAACCACAATGTCACCTGCCAGCCTCTAGAGGAGGATAAACTCTTAAT
GAGTTTAGTAGGAATATTCTCTGAGGAACAGATGCATCTGTACAGATTTCTAACCATAGC
TCATGCTAGGTCTCTAATACGTTGATCAGAGTTTTAAATATGAAAATTTTATTCAAGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTTGGTCCTAGACCTGACTGCTGCTTCTCAGTTTTC
TCTCTCTCTCTCTCTCTCTCTCTCTATCACTCACTCACTCACTCACTCTCTCTCTCTCTC
ACTCACTCTGTTCCTCTCTGGTCAAAATAAAATAATAAATAAAATTAAATAAATCTTTTA
AAAAATTGTAGCAAATGGGTAATACTTCAGTGACTTTATAATATTAAAATTATAATTTTC
TGTCAGTTACCTGTTGACATAGCTCATATCCATTATTATTTTCTCTAGCAGCTTGTTCCT
CCTTTTTTTTTTTTTTTTTTTTTTTGCCAGAATGCTTGTGTGTGCTAGAGGGAGTGGGGG
AAGAGGGAAAGTGGAAAAGCAATCTCCCTTCACAGGAGATGATCACCTAGTGTCCTTTCT
CCCAATTTTTCTTCTGTCCTGATTTTTAGCATGCATGCATACATGCTTAGCATGTTTTTG
TTTTGTTTAAAGAGATTTTGTTAATAGGGTGCATGCACTCTCAGGAGAGTCTGAGAGATG
GGAAGCGAGAAGTTACTCCCCAGGGTGGATGGTCATGCCACATCTCTTTTTCATTTTCCT
CTCCGGATTTTAGGCACACATACACACGCCTTTGGTGTGAGTTTCAAGCTGTTGGGTCTG
GGACTGGAACCGTGGTTGACCAAATGGGAATCCAGCAATGTAACCATTATGCCATCCACT
GGTTCCCGCAGCATGTTTTTTAACCCACTGGTTCTGGGACTCCAGCTGCGCTGTAGGCCA
TATAAAATCCACCTGCCTTAACCACTAGGCCACTAGCTGGCCCTGAACTTATTCTTACTT
ACTTACCTGAGAATATTGTAAATTGGGAAATTAACTCTTGACTGTATGTTGTTCTTACTC
CCTCTTTATTTTGCTCACATGTGGTAATGTTTACCATATTTTAGCATTCGGTTAGTATAT
ATTACTGAATTTTGTGACTTTAGGGTTTTTTGTTTGTTTTTGGTTTGTAAGACCTTTCTT
ACTCAAGGTTGTAAGTAATCTTATCATGAAACTTACTGATTTTTAAAAGTTGGAGTCTTT
TATTATATTGTTGAATGCATCTATTTTCATTTTCTCAAGTAATTATCCAACTGTTTCAAT
ACTGTTTAAAAAGAATCTGTTCTTCATTCTGTTGTAAATTCATAATTGACTTAGGGCTAT
CTTTGGAATCTGCTCCTTTAAAATAAATACTTTCCCTCTTGCAAAGGTGTGTCTGTAGTT
CCCTGTCTTAGGACATGTAAGAATTGGAGCAAAGAAATGTGGATTTGGAGAAACTTGGGG
TCAGCTTGTTCCCTGCATGCTTAAGATCAACCATCCCACATAGAGAAAAAGTCTTTGCTG
TCTCGATTACTGTAATTTAAAAATAAGCTCTGATGTTTGGTAGGTATAGTGTGTGCTTTT
CATATTCTCCACCCCCCTATTTAAAAAATTTACTTAAGTACTTTTTCTTTTGTTTTTAAG
ATAGATTTTAGTGCAATTTAAAATACTAGTCATTTAACCCCCTCCAACAGAATGTATATA
GACATTTCTCATTAGTTTAGTGGCATTCTATTGAAATTAAAGGTTAACTATAGAGGCATA
TTGAAATTTTTACAGTATTAGGACCCCCTGTGTCAGCATGATGACATTGTATGCTTTCTT
AAATTTTCTATTTATATTCATAAGAGCTTCAAAGAGTTCTGTGGATCGTCCTGTTCATCA
TTTTTTTTTTTTTTTTTTTTTTGAGGGCATTTGTAGTATTTAATTTTTGGTTGCTTTTTT
TTGTTTTCAGTTTGCTAAAGGGAGAGCACACTTGATGGGCTGGGAAGAGAGGAAGGGGAG
GGTGAGAAATTACCTCTCAGGCACTGAGCATGGCTGCACTGTAATCCCTCCCCCATTCTC
TGGGATATGGGCACACACATCTGGTGTATTTTCAAGCTGCTTGATCTGGGACTTGCAGTG
TTCAGTCAGCCTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGTCCAGAACTTGACCGT
GGTCAGCCTTGTGCATGTCTAGAGCCTTAACCACCATGCCATCTGCTGGCTCCAGTTTGG
TCTTCACTGTAGAAATTGTATGGTGGAAAGATACTATAGTAATAATAGATGCCCAGAGCT
GTGTTTTCTCTTGTAGTTTGTGAAAAACGTGTACCCCAAAGAAGTTAATGCTGCTGTTTA
TGGTGGAATCGTTTGTGGGAGGAGGTGCAAGCATTTATTTTTAGAGCAATAAAAGGTTTT
GAAGCATTAAGTTCAAGTGCTGGACTCCCACGTGGATGACTGTGGTTCAAGTCCCAGACC
TGGTGGCTTGCTTTCTCACTTCCCTTTCTCTCTCTGCTCAGATTTTTAAAAAGAAAAATA
ATAATAACAAAATTAAGTAATCCTTTTACAAAAAAGGTTTTGAGTCAGTCCTGTGGCTTA
GTGATTAAGGGAACTGGATCCCACAAGGTTGACCATCTTCATATCCTGGATTGAATCCTG
GCCTGAAATTTGAAGAACACAGCAGTTGCATATGTGAGTGTGCCCAGATCCTGGCAGGTT
GGAGAAATGTGGAAGAGATTGTGATGTGACTAATGCTTCATTGGAGGATCCTTTTTACCT
CTATTTATTCCTGTCTGGCAAGTGCATAGGCCTTGGTCAACTAAAAAAGAAAAGATAAAA
ATATTTGTCATAATGACCAGAATTTCTTAATAGCTTGGAGTTCTGATTAAAGTAATGCAT
GGTATGAATTGTAAAGAAACTACAAGTAAGTGGTGAAACTTTCCAACCTTTGTGAAAACT
GTTGAAGGACTTGGAAATGTTAAAGTTGAAAATCACTTTATTATTATTATTTTTTGCATA
TTCATGATAAAATGTATGCACGTGCACTTGAGAGAGAGTGTATGTGTGTGTGAGAGAGAG
AGGGAGACATACACACAGACATGAGTACTCTTCTGGATTTGGTCACTCCGCAATCTCCTT
CCTCTCCAGTCCTTTAATCTGGTCAGATACGGAGCATTCTTCTCTGGTGTGTGCAGGCTG
ACCATGCTGAAGATTTGAATTGCTCATCAGGTGAAATCAGGCTTCTCTAGCAGTGCACCA
TAGGACTGGCCCTGAAAATGACTGACTTCTAGTGGCAAGACATGCTTTGCTAATATTCAT
GAACTTGAAAGTTCTCAGTTTTTGACATGGTCGCTACAAAGTGCCAAGGGAATAATACAG
ATTTTTCTGGTAATGTAACTGAAATTACTGACCAAAATGATTGCCAGAAATGAATGTGCC
CAAATGAGTGAAACTGGTGAGGAAGACATTATTATAGCATTGTCAGGTTTGGGAGAAGAA
AGGGCAGTACCTTCAGAATTTCAGGTCAGGCCCTTGAGAAGTTATATTTGTGTGAGAGAC
AGATGGAGCACCTTCTCTACTGAGTTTTGTTACACTGCAGTCCTGTCCATCCTTCCAACT
CATCAGATGCTATAGCACTCTTGAATAGGAAGGTATTCTGAGTTTTAGGCCTCGGTGAGG
ATATTTGTATGGAAATGTCTCATACCACACAAATAAATGAGATGAAAGACAGTTGGAGTT
GAAGGGAATAGGACCAAATTATAGTTTTGTAACAAATATGGGGGTACACACTGACAGATG
TTAGATTTATGAATTAGCTACGTTCTGCAGTTGATCATCCTACATTACTAAAAATAAAAT
GACATTTTCAGTTTTACTTTTAACCCTCTCTTCTCCAACTCTTCTCCAAGCCTTTATGTT
CCAAAGACTTTTTGGGGGTTTAGAGCTGATATACTTGCTTTTGGGTTTTCCCACTGCCAG
TTTGTTTCATAGTTTAGTTTTCTGATTTGCCTAGATTAATGTCTGACATATATTGTAGTA
ATCAGTTAAATAAATATTTGTTGTTGCTTTGTTTTTAATTGCTATTACTCCTCTCTCATC
TGCTTTGAAAATGTCTATAAATTTTGTCATTTTCTTTTTCCTTTATTCTCTTCTTGTGAG
TTTGTGTCTTAAAATCCCATTAGTGTTATTTAATGAACTTTTTTTTTTTTTTGGAGGGGG
AGAGGTTTTTAATAGGGCATGTGCGCTCGCCAGACAGAGAGAGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTAAGTGTTATTATTATTTTATTTATATAGAAGCCACGACTGCTCT
GGCTCAAGGGTCGCATATTGTGGGCGTAGGGATTTTGAACAGCAGGTTACAATTCCTGAC
GCCCCACATCCTGTGTTCTCTTGAATATGTCAAAGTCGTGGTTTCTTTGAGATGTACTAA
TCAAAGGAAGATAAAGTAAAAACACTAATTTTAAGACTGAAAAAAAAAGACCACTGATTT
TTTTCTGAGAAACTATAGTCATTCCAAAATGGTTTTGAGACAGTGTATTCACTGTAGCCC
AATTTTAAAAGAGAAATAGGGAAAAATAGTTGTGCATTATACTGGGCTCTAATTTGATAT
TTATAAAATTGAGTCCTTACTCTGTACTAGGTTAATCAGTTCTCATAATTTCACGAGACA
TGATACTGTAAGGTTAAAATTATGCTCAGAGTATACAAGTGATAGCGCTGGAATGTGAAT
CCTGGCAGCTAGACTCCAGAGCTTGAGCTTTAGTCCTAATACTAAATAACACTTCACTCA
ACTAAAACCTGTAATGTTCCAAAATGTACATTTATGTTCACTGATTCTGAGTTAGATGAT
AGTTTGTGCAAATGAAGTTCAGAGAGGTTAAGTAACTTACAAGTCATACATCTCATAAAT
GGAAGAAATGCCATCAGATCTGTCTGATTCCAAACTTTGTGCTCTTTCAGTACTCTGTCA
TGTTTTTGTATCTCTAATACAGCCTTTTAAAGTTTTGTAACATTTAACTTAATATTTTTG
ATAAGCTTTTAATAGTGTTTTCCTGTCTTGCAGGGATTTATCAAAGATGTTCATGAAGAC
TCTCTCACAGTTGTTTTTGAAAATAAGTAAGTTATTTTTTATTGACTAAGCTTAAAGATC
GTTAATAGGACTAACCTGTTTGTTTTTGGGTATTTCTGCTGCTATTGAAAAAACAATTTT
ACTTTTGGGGAAGCTTTGGTTATTTGATCATCTTACGAGTTCAAACTTGTCTCAGTTACC
TCTTCCCCTATTTTTGTGCCCAAAAAATGACTTGTCACTTTTTCTATGATCCTCTTTGCA
AGATCACATGCAGGTATTAATCAATAAGTAGTTCTGGTAGACGTAGATGTTACAAATGAT
AATATAATATACTTAATTCTTGAAAGCCCAGAATGTTGAAATGATGCTGTAGAAGGCATT
TAAAATTGGGTCAGCTGGTAGCTTTTCAGCCTGAAAACTGTGCCAGGTTCATGTGTGTGC
ATGCCCAATATCCCAGAAGGAAAAATGCAGGGATTGCAGCAGGACCTTCCCTGTGAGAAA
GAGTAGTTCTCATCCCTTCCCCCATCTTGCCCTTTGGCCAAAATAAACCTAGAAAACAAA
AGCATTAGAAATTGCTATTAACAGTCTGAATAAAGTATTAGGCTATCTTTAATTGCTTGA
TGTCATTAAGGGCTAGTACCAGTTTTATAGGTGTTATAAGGGCTAGGTAGTCTAAATCAG
AACCACAGTAAACTGGGCCTCGTTAGGAAAGATTATAAAAGAGCACCATTTAATTGAAGG
TCAGAGTAGAACTGTTTGGCTTCTATCTTTAAGTTGTTTCTGGAACTGTCTGAAGGACTC
TTCTTTGCCCAACAGCTGCATTAAGTAGAAACAAGTGTTGAGATGATTTCTATCTTTGAG
CACCTGCCATTTAGATGGTAATAGTGAAAGAAAGCGCCCAGAAGTCTTTTTTTGTCAGCT
GCTGCTTTGTCTAGCATTGGCAGATAGACGACTTAACATTTTATGTGTTAATATATCTCC
CAGGCATGTAAGTGTTCTATAAGAACTTAGACTAGGCAAGAATTTTTAACTTCATAAATT
CAGTTTATATAACATCACAAAAAATGTCACTTAACAGCTGACTTAGTAGTTTAATATATT
TGCTGCAAAGATTAAAAGTAGCCTTTCCTGGGACTAACAGATGGTGTAATGGTTATGTTG
CTGGATTCACACATAGTTGATTGTGGTTTTAGTCCCGGATCTGACTGCTTAAAACTCTTT
CCGGGCACATGTGCATGGGTACCCAAAATCCTGAGAGGAGAAGGGATTGCAATGTGATCA
TCTCACCCCCACCTCTCCCCAACCCCTGCCTCTTCCATGGGGAGAGCGGTGATTTCTTGC
TTTCTGTCTTGCTGTCTCTCCGGGTCCTATAGCAAAAAAAAAAAAAAAAACTCAAAAAAA
AAAAGTGTAAGCCTTTCTCAAGTATTGTTCATTGTACAAAAGATGAATATAAAAAAATGA
AATTTTTTATAGTTTAGCTATTCATAATAATTGCTGATTAATTTTTTGTGTTTCTGTGGA
CACGTATGCAAAAAGAATTATGCAGTTTGATTTTGGTTTGTAGTTTGTGAAATTGTATTC
GTTTTGAGTAGGTAGTTGTAAAAGCATTTGGAATAGGTGATCCTACACTTCATTAGCTGC
AACATTCTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAAAGTC
ATGCCAGGCATGCCAGAAATCCCAGGAGGAGGAGAAAAGGCATTGGGATGTGGCCATCCT
GGGGGCAAGGGTTGATTTCTCACTTTCCCATTGTGTCTCTGTCATGTAAGCACATAATGT
ACCTTTGGTATGAACAAAAAATAAGTTAATTATTTATCAACTTTTAAGAGTCATGCAAAA
TTGGTTCTATCTCAGTAAATAATTATTTGGAAAATTACATAGTATGAAGTTGTTTTTCTT
CTCTTTGGGGAAAGCTAAATGATAAACTAGTTTGGAAAATTAATTAATTCTTGTTTCTAA
TCCTTCAGTTGGCAACCAGAACGCCAGGTTCCATTTAATGAAGTTAGATTACCACCTCCA
CCTGATATAAAAAAAGAAATTAGTGAAGGAGATGAAGTAGAGGTATGTATTTTCTTTGAT
TTTCTTGCACCTACTTTTGTTCTAAATAAATATTCTTATAAAAAAATCTGTTTATGGGAC
CAGCAGTTAGCGTAATGGCTATGTCGCTGGACTCCCATGTAGTTGACTGCGGTTCGCGTC
CCGGACCCGGTGTTTTAAAACTCACACTGGGCGCATGTGTGTGCGTGTCCAAGATCCCGA
GAGGAGAATGGGAAGAGAAGGGATTGCGGCGTGACCATCCCCCCCGGGGGGGTGATTTCT
TGCTTTCTGTCTCTCTGGCGAGCGCACGCGCCCTATAGCAAAAACCTCTCCCAACAACAA
CAACAAAAAAATCTGTTTAGCTAATAGAGAATAATCTCCAGGTTTGGGTTTTCTTTTGTT
TGTTTGTTTGTTTTTCCCCTTCAACTGATAATGGCAGTGCTTAAGTTTGGGAGTTAGATT
CATATCTCAGCGCTATTATTTTTAGCTTTATGGACTAGATTAAGTGGATCACTAAAATGA
AAGTAATTTGAAAGTTAAATATGACAAGTATTTGAATTGATTAGAAAATTTGTTATAGAA
TTGTGTGGTTTTAATGACAATGTTTTTTGTTAATTTAAAATTTGTCTTGTGATTTATATG
CCTCAGTATTTTTGTAAAATATTGGTAGTTATTCCATTACTATAATGATCATTATCATTG
TTCATATGTAATAATGTGAAATGGTATAATTAATGTACTGCCTTATAGAATATTTTAGAA
ATGTCTGGTAAATTTGTTTTTAATGGCCAGAGGGTGCATGTGCCTTCCAGAGAGGAAGAA
TGAGAAAGAGGGAGAAGGAGAAAGGACACCACAGCCCCCCACACATACACCCCTGCGTGA
TCATGCCACAGTGCCCTTCTCTATCCTGTTTGGATTTAGGGCATGCACACACATGTGCCT
GCTGTGTTTTCAAGCTGCAGGGCTGGGGATTCAAACCATGGTTGACCTTGTGGAACTGAC
TCCCTTAACCAGTAGGCTGCAGGACTGGCTGCTCAGAAAAGATTTTAGAAATGGAAAATG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGA
GTTTAAGCTACTGGGTCCAGGACTTGAACCGCGGTCAACTACATGGGAGTCCAGCAACAT
AGCATTATGCTAACTGCTGGTCCCTCTTTTGTTTGTTTTTGAGAGAGATTTTTGCTATAG
GGCACATTTGCTCACTGGAGAGACAAAAAGTGAGAAATCATCCCCCAGTGGGAATGGCCA
AGCTGCAGTTCACTCACTTCTTGGGATTTCGGGCACACACATGCACCTGGTGTGAGTTTT
ATGCTGTCTAGTCCAGGACTTGAACCATAGTTGATCACATGGGCATTCATTGCCTTAACC
ACTGTGCCATCTGCTGGCCTTTGCCCAAAAGGCTAAGAGGAGAATGAAGAAGGGATTATG
ACTTGGCCATCCCCATTGGGGTTGATTTCTCACCCTCTGTCTTCCTGCCAGTGCATAAGC
CCTATAGCAAAACTAAAAGAAAAAAAATGTTAAAAAGTCAGAGTTAATGTTCTTATATAA
CTTTTCTAGTAGTATAGATCTCAGGGGAGTAATTGTATGCTACTGCATCTGCCTGTCCTT
TTAGCACATTTTAGTAGACCTCTGGTTACACCGAACACCAGTATGTCAGTGCGTTTACTA
ACTCAGAAGCTTCATGACTGTGTGCTTTTAAAACAGTTTTTTTTATAGTTTAATATAGCA
GTCTATGTCTTTTTTTTCCCCAATTTATTTATTTGCATTCATTCACTGTACATCATTACA
GCATACAAAATGAGATTTTCCATCCAGAGTACACTGTATATTGTCTCAATCAAGCACATC
AACAAACATGTTATTGTCAGCAAATGATCTTCCATTTCTTGTTTTCTGTATGTTTTGCTT
TTTTTCCCCCCATCCTTGATTCCCTATCTCTTACCCTCTGCCACCTCCCACTCTCCTCCC
TCACTGTCTCTGGTATCTATGTTTGCTTTCTATACCGTTTTCCCCCCACATTTTATTGAA
TCACCAAAGACCCTAAGAGAGCCAGATAGCTTCTTATTACTGTCGTTAACACTCACATGT
TCGTGATCACAAGACAATTTTATTCATCCCTATCGGATCACTTATGTTCGGCTTCTATCC
GGTCTATCAACTAAAGGCAAGAGATTTATTGACGGAAACATATATTCAATGTACAAANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTGAAAAACACACTGGGCCTTATATGTATGTATGTGTGT
GTGTGGGCCCTAAATTTCCAACAGTTGTAGAAATAGAGGAGAAGGGATGTGCATGGGCAC
ACCCCATTGGGCTGTGACGTTTCTGTCTGTGTATCTGTCAAGCATATGTGTCCTCTGGCA
TTAACCAAAAAAAATGGAGGCAGCAGCTTTGGGACCTGAAATTCTGATAGGACAGAGTCA
TGTCAAGCAGAACATGAATTAGATATGGAAATGTTCTAGAATTAGAAATTTATGGTGTGG
TCAGTTTTGGGGAAAGTGTTTTTCATGCTTTGTTATTATTCAGACAAGTGGTATTGGTAG
TGTAAAAATCTTAGATAAAAGGAAAAACTACTTGTTAGTAGGGTGCTGAGAGTGTTATTA
GAGTGCATTTTCTAGGCCCAAGTCCAGGAAAGGTCTTGTCTTATTCCTGGATTGTGTCTG
TGATCTGCCTCCCCAGCTGTGAAGAGAACATTGATGTTAGAGATGGCGATGCCTGGGGCC
AGTCTGTGGTATCTAGTTAAGTTGTTTGGATCCCACATGGCGAAGTGTGAGGTTCAAATC
TTAGACCCAGCAGATTCAGGAACACTGCAGGTGCATGTATGTATGTGTTCAAAATCCTAA
AAGGAGGGAGAAATGGGGGAGGAAGATTGTGTTACCATGCCCCATGATAGGTGCTTTCTT
GCTTTCTCTGTCTCTAGCAAGTGCACATGTCCCCTGGGAAAAACGAAAAAGAAAGAAAAA
AAGGGGAATCGATCCTAAAGTGTTTTTATTATTTTACTTTGTGTCTTATGATTCAACCAT
GGTGAAATTTGCTCTCTATAATTTTGTAAATTGTGTTTGAAATTAAAATATCATCATTTA
TTTTACTTATGGGAACTTTGAAAGTTTATCTAAGGAAAATGTTTAAGCATCTTGTGTCAC
TTACTGATTTTTGCCACAGTTCTTCAGGAAGCCCTTATATGGTGCAGGTGTTTAAAAATT
GCGGTTATTGGTGCTTTATTTTTTAAATTAACTTTTGAATGCCTCCTTCCCTCTTTACGA
TCAAAGTAATTTTAGTATAAAAATGAAATGATGCATAATTGTATAAAGTATAAAGTGAAT
CAGTGAATCTTCACTCTTAGCATAGGTGTGCTTGTCCATTCACCCAAACTTAAAATCCTA
TGTACTGGAGTGTCTCCTTTGCATTTATAAAGATTTTTTCTTTTAGAGGCTTTTTTTTTT
TTTTTTTTCCTTTCAAGAGACACAAAGAGAGGAATTGAGAATCATCTACCAAGGGAGTGG
CCATTCAGAAATCCCTTCTCCATTCTCCTCTTGAGGTTCTAGACATGCATGCACATGAAC
CCGATATGATTTTTTTTTTTTTCCAATCCACCAGGTCGTGATCAGCATGTGATCAGATTG
TGGGTGTCCAGTTTCTTCCCCAGTATACCACCTGCTGGCCCCTAAAGGATATATTTTTAA
GTTGCAGAAACTAGTGCTGTCGTGTATGTGTGTGTGTGTGTGTGAATTTATCAGTTAATT
AGACCTTCGTGGACATTTTCATGTCTGCCCACGTTTACCTCATTCTTTCTAACCACTGTA
AAATTATTTGGTATAGCTATATCAAAATTTAAAAGCCATCGAGATTTTTAATAAATTTTT
TTGCTATTACCAAAACCTTAAACATAAAGCCAGCTGGACGTCGTATCATACACTTGTAAT
TCTAGTTACTTTGAGGCTGAGGAAGAAAGATCATGCAGTTCAAGGCTATCCTGGACAATA
TAGCGAAACTGTCTCTCAAAAAAAATATTGCTGGGCCAGCAGGTGGTATGGAGATTAAGG
TGGCTGGATCCCACATGGCTGACTGCATAGGTCTGAGTCCTGGAATCTGAGGCTTGAAAA
ACACACTAAGCATGTGTGCTTGTCCAGAATCCTTTTTGTTTTCTTTTGTTTGTTTGTTTT
TGAGAGGTTTTAGCTACAGGGCACGTGTGTTCGCCAGACAGAGACAGACAGAGAGATAGA
AAGCAGGACATCAACCCCCAGGGGGGATGGCCATGCCGAAATCCCTTCTCCTCCATTCTA
CTCTCGGGATCTTGGGCACACATGCACATGCACCTGGCATGAGTTTTAAGCCACCGGGTC
CAGAACTTGAGCTGTGATTGACTATGTGGGAGTCGATGTAACCATTATCTCATTTGCTGG
TCTCCAAAATCATGTGCATTGAGAGAGAGAGACAGGGGGGGTGACTCAATTCCGCAATTC
TCCAGCCTCCAGATTGTTTTTACCATAGGGTGAGTGCCACCATACCAGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTTGAATGAAAAA
AAAAAATCGTAGACTTAGGATCCAAATTGGAATTCTCTTTAAATCATGTGGTGGTTATGT
GCTCGAATGTGAAGATCACTGTGTTACCAGGTTTGAATTGGTCATTTGGTGGAAAGAGTT
CTGCAGTATGCTTTATGTACGTATGTTGTGTGTATGTATGTTGCCACAAGGCACATGTGC
TCATCAGAGAGAGAAAGCAAAGCACCCTCCAGTGGGACGTGGTCATGCTACAATCTGTTT
TCCATTTTGCCATCTGTCAGGACTTGGGGCACATGTGCCCAGCGTATTTTTCAAGCTGCC
GGGGTTGGGATTTCAACTGCGGATAATCCTGTGGGATCCAAATCTCTTGGCCTTGCAATA
TGGGGTTCTTCCTATTCAGTCCTCAACTCCATGAACAGTAGTCTTGAATATTATTTTGCT
TTTTGGTGTCTCATTGTCACTCCTGTGTTTAAAGCTCTTTGGATTTGATGAAGCTTTAGG
ATGTTAGAGCAATGAGGACCATTGCTTCAGAATGTGAATTGCTCCCATGGAGTAGTTAGG
ACAGTTAAGTGAAATTAAAGAAAGAGCTTTCTATAAGATGCTCTTATTCAAATGATGTTC
ATCAGTCAGTTCATTAATCAACATTTGGGATATAGTATATAGTCTACTGTTCTAATGGGG
GTATTAAAGTGAATTTTTTTTTATGTGAGATATACTAAATTTCATACCCATAGCACTAAA
GTGGAACCAAATTCAGTGTTTTGATTCAGGCTTAGGAACTTAGGTTTATTTGGCTTTATG
AGAGTGGCTTTAATTTCAGGGGGTAAAGTTATTAATGAAACTTACAGAAATGGATATTAA
GTATAAAATTCAATCCAGCATTGTAATTTTCAATGAGAAGTAAAGCCTCTAGGCAGTTAA
GAATGGTTTATTCTATTTTTTGTAAGCAAGCTACATAGGAAGCCATACGGAAGCTAGATT
CCTAGGGGATTATGCTTTGGTGAAAATAGAAAAGGAATAAAGGGGTTTAGATAGCTTTAA
TACCTGTCTTTTCAGCAAATCAAGCTTGAGGTACCCATTCACTATAACCCATCCACTATA
GAGCACCAACAGATACTCCAATCTGCTTAGCTGAGCTGCCTCTTGGAGATAGTGCTTGAA
AATGGACACTTCTGCCAGTTCTTAGTTTAGTGTTTTTCTTTCTTTTTTCTTTTTTTTTTA
AACCTTTAACCTACTAGGGAAAACTGTCATTGATCATTTACCATTTGAGTCTAACGGTCC
TTTTTTTAATTTAAGGTATTTTACAAATAATTTTACCATGAGAATGAAAGGCTAGTGAAA
TCCAACATTATTAGGTATTTTTACTAAGAGTTGTTTTTGTTTGTTTGTTTAATTGCCATA
GGGTACAGTGCTTGTCAGAGAGTGAGAGACAAAGCACCCCCCAATGGGATGTGGTCACAC
ACATTTCTCAGGAAAGGGGAGGGGGAGTGGGTGAGAGAGAGAGAGAGAAGCACAGGATCA
GGATTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCTATACTTGCAATGAGACTCAAGATCCTTTTTTTTTTTTTTGAGAGATTTTCACTGT
AGGGCGCGTGCGCTCGCCAGACAGACAGAGAGAGACATAGAGACAGAAAGCGAGAAATCA
CCCCCCAGGAGAGATGGTCACGCCGCAATCCCCTCTCCTCCATTCTCTTCTCGGGATCTT
GGGCACGCACGCACACGCGCCCGGCGTGAGTTTTTTAAGCCACCAGGTCCGGGACACGAA
CCGTGGTCGACTACGTGAGAATCCAGCGACATAGCCATTACGCTAACTGCTGGTTCCCGA
GACTCAGGTTCTTGTCCCACCCACAGGAAGAATTGAGAGTCATGGACACAGCAGGTGTAG
CAAATTGGGGAGTTGATTAAAGGAGAGGGAAGGAAAAACAGAGCTCCCAAGAAGGGAGGG
AACAGGAAAAATGGTTTGTCAAGGAAGAACTGTGGCAAGGGGTTTTTATGTGGATGAGGA
AGAGCTTTGTCTGGACCTTGGGTTCTAGGTCGGGCTTGTGCATTCCTGTCTTGGTAGGGA
GGGACATGTGCTGGATGGATCCAGTTATTTTCCTAACTTAGGTGTGCGTTCCAGGGTCTA
GAGAGTCTTTGTCTAGAAGCTTTGAGCCATGAAAACCATTATCTTACCTTCTTCCTGGAA
TGTGGTAGGACATGGAAAAAGCCTTTGTTTTAGGTCTAGGTCATATTGCCTAGGTTAGTC
ACTGAGCCATCACTGGCTCCATCTCAAAACTTAGCCATTTTTTGACTCCATCTTGGGCCC
ATACCTTAACTATATTTTTAGGGTCCCTGTCTCCTACCTCAATTGGACCATGAAAAAACA
GTTCTTAGATTTGACGAACTTTGTTTTGTGAGGACAATTTCTGTAATGTTTATGTGTAGT
AAACCTTCATTAATTGGTGATTTGATTTTCAAGAAGTTAAATTGTCCAAAAAGTAATCCA
TTTTATTTTTTTAAAATATTTTATTTAACTTTATTAATATTATTATTACTATTATTATTT
TTAATTTGACCAGGGAGAGAGAGAGAGAATGAAAAAGCAAGCCACTGGGTCCAGGACTTG
ACCCATAGTTGGCCGTGTGAGAATCCACCACCTGCTGGCCCCATCAATTTTATTTTTTAA
GTAGTAAAATTTAAGAATACACAGAACTTGCATTGATCTATATACTAATTTCAGTAACAA
CATTATTGATTCTAGAGTTTAATGGGATTTAACATTTATTACAAGTCATTGTTTACAGTG
TTGAAATCTTTTGAAATGAATGAATAAAGTCATTTTTTCCCTATCAGGTATATTCAAGAG
CAAATGACCAGGAACCATGTGGATGGTGGTTGGCTAAAGTTCGGATGATGAAAGGAGAAG
TAAGTGATCTTGATGATACTTGCTTTGTCCTAGTTTCCTTGTAAATACATTAGCCCCTGG
TTTTTGTAAGATATTACTCCAACTCAAGTTTTGTTTCTAAAACTCTTACCTAAGAAATAG
TTGATCAGGGAACCAGCAGTTAGCGTAATGGCTACTGTCGCGTGGACTCCCGCGTGGCTT
AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTCTCTGCGTGTGTGT
ACACACACGTGCACATGCCAGAGTCACATGTGCTTCCTGGAGAGAGGAGAAATCACTGCC
ACAGGGAATGGTCATGCTGCAGTCTCATCTCCTCTGTTTCTTCCCTCTAGGATTTTGGGC
ATACTTGTACACGTACCCAGCATGGTTTTTAAGCTGCTGGATTTGGAACTCTTTAACCAT
ACAATTTACCGTGTGAAATCCAGCCACTTAACCACCATGCCATGGGCTGGCCCTGTAGTA
GTTTATTTCAGTTAGTGCGATAATCACCAAGTTTCATCTGTGTCATGGCATATGTGAGAA
TTGCATTCTTTTTTAACGCTATATATATTGCATTATGTGCGTATGCCATGGTTTTTTTGT
TCCCTGGTTGATGGACATTTGAATTATTTCTACCTCTTGCCTCATGTGAATAATGTTACC
GTGAACGTAAGTGTATAGAAAATTCCTTTGTTATACTCCTTTATAATAAATTCCAATTTC
TTTCCTTTACTAGTGCACGAAACAACTTGCAGCAGCTTTTCATGAGGAATTTGTTGTGAG
AGAAGATTTAATGGGCCTGGCAATAGGAACACATGGTAGTAACATACAGCAAGCAAGGAA
GGTTCCTGGAGTTACTGCGATTGAGCTCGATGAAGATACTGGGACATTTAGAATCTATGG
AGAGGTAACCTATTGTCTGTGCTGCCTTAGCTAACATTAACCATCTATCATTTGACCATA
CTTTAACAGGAATTTAAGTTTTTCAGTGAAATACCTCTGAAATAGAATTGGTTCATTTGA
ATCAATCTACCTGCTAATCATTACTTACAAAATAAATTGAATTTGATTTGTGTTGGGGAA
ATGGAAGGTTGACTGAATAATGTGTAATGTTTTCAGAAGTTCCTTAACTGATTCTGAATT
AATTCTGTTTTGTGCCCATTACAAATAATTTACCCATGTATTATTTGTGTGCTTAGTATG
TGTCAAGTACCGGCAATAGTATATAGTATATAATAGAATACCTTTTATAGAACTCGAATT
TGGGTAACACTTCATTAATAGTTAACTTGTAACATTTACAGGGATAGGAAATAAATAAAT
ATTTTTTAAGGAGGTTTTTGCTTTAGGGCACATATGATTGCCAGAGAGAGACAGTGAGAG
GGAAAGTAAGAAATTACCCCCAAAGGGGGATGGCCATGCCACAGGCCCTTCTCCTCCCTT
CTCCCGGGATCTTGGGCACATATGCACATGTGTCTGGTGTGTTTCAAGCTACCTCCAGTA
CTTGAACTATGGTTGGCTATTGACATAACTGCTACGCTATCTGCTGACCTAGTAAATTAT
TTTTATAAATATAATACAGATTTTTATTAGACTGTCTTTCAAATGAGAGTAAATGGATTA
TTTTTTTTTAATGATATTTTAAGTTTTACATGTATGGCTGTCATGAAATATAGATTCATA
CAGTAAATGGGACTAGAAGCTTTATTTTTTTATTTCTAAAAACTTTAAAAGTAGGTAGTA
TGTGAAAGTAATTGATGATAGCCATTGGAGCCATACTGTATGAGTAACAGTATTATGTAT
ATGTATATTATAGTAGTTATACTTTGTGAATTAAAAATGTTTTTTAAAGTATTTTTTGTA
TATAGCATACATTGTAACCATATAATAAATTCATGCTATGTTTATAAAAGAATATTAAAA
GTTAAAATAGCTATTAATTGAGAAATATAGAATTACTTTAAAAGACCCCCTTCTAATCCT
TTAAGATTATATTCATAATTAGAAAATAAGAGTTTCAGTGTTTTTTTTTTAAGTGAATTA
ATTTTATTTATTATCATTATTGCTTTTTAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNAAGGGGGGATGGTCACGCCGCAATCCCTTCTCCTCCATTCTCCTCTC
AGGATCTTGGGCACACACGCACACTCGCCCGGCGTGAGTTTTAAGCCACCGGGTCCGGGA
CGCGAACTGCGGTCGACTACGTGGGAGTCCAGTGACATAGCCATTACGCTAACTGTTGGT
TCCCCCCCTTAGCCTTTTAATGATTACTTTTTTAAGAAACTGAATGAATTGCTTATCTTG
AAATGACTCTCCATTGGGCTGGTTAGAATCCTAGCAAAGCATAATTCAGAATTTTCTCTT
TTCCCATATTTTTGTTTTCGATTGTGAGTTGCTTCAGGACTGAAATGGTTTCATGTTTAT
TTTTCTCTTCCCTCCTCCCCTCCCCATTTACAGAGTGCTGATGCTGTAAAAAAGGCTAGA
GGTTTCTTGGAATTTGTGGAGGATTTTATTCAGGTTCCTAGGAATCTTGTTGGTAGGTAC
TAACTATCAAGTATTAAATAAATAAAATGTTACTTGGTTTTATGTATTGACTTACATGAA
AATAAGACTACTTATAGTTATGTAGAGTATTTAGATAGTAATACTTTAATTTTTGGGGGG
TGAGATGATAGTATGTGACTTATACCTTTTATTGTCATGTATTAGAAAGTGTTAACATTG
TCATATATTCTGTACAGGGTGATCCACTAAAGATCAATAATTTTTGTAACAGTTGGCCAT
TTCAGTTTTTTTTTTTTTTTTTAGCTCTCATTCTGGGTCTTTCCTATTATTTTTATTCCT
TTAATGTCTTTCTATCATTCATATATCCATCAAAATTGTGATAGTACTTTACGAGAAGGT
GTTTGTGATAATTTTTTTCTTTTGTTTAGTGCAGAAGAAAAAGTAACAGTGGACTAACAA
TAGGGTAATAGACTTCTACACAGTAGGCCCTGAATAAATAATAATTGGTTGTTGCAAAGG
CATAGAATAAGGTAAGAAGTTGTGGGGAGGAGAGAAGGCTGGTGATAATGATATGAGGGG
AGGCTTCACTATTAAGTGCTTGACACCATTAATGAAAACTTTTGTACCCGTGGGTTATAA
GTGACAAGAACTTACAGCTGTTTAATTAATATGCCCTATATCTGTGTGTTTCTTAAGTGG
TAGTGGAGACAAATTGGAAGACTTCAGTTTTGTATTAAGTACTCAGTGATTATCCTAAAA
ATTGAATATAAAAGCATCAATTTAATGTAGTGGAATTTACTGGGAAGGGAATAAGTTTTT
GTTTCCTATCGACTGTTACTAATTTTTTGACCTTGTGTAAGTAGTTTTAACCCTTTAGGC
TTCACTTATGTATAAGGCTACCCTTTCTACCTTTAGGAAGCAACTTCTTAGCTTAGTTGT
ATACTGCCAGTCATGTAAGTTCTACTTTATCAGTTCTTGGTATACTGTCATTCATGGTAG
GCTGAACTAGAGAGAGAGTTGAGGTATTGAAATTGGATATAAGTTTGAACAATTTTATGT
AATTTTTATGAACATTGTTAAGATACAAAATGTTATCAGGTATTTGTTTTCAGATGAAAT
CACCTTTGAAAATAACGCTGCTTTTGAACGTGGTCCTCCTTTTTTGATTTGTTTAAATTG
TAAATTGTTGACATCTGTCAGCACTAGCATTGCGCTAGTTGCTGTACAGCACATAATTTA
ACTTTTGTGAAGATGATTTGGTGGTGAGTTTGTGAAGAGGATTAGGTTTTTTCTATACAG
AGTTAGTGGTAGTGTTAATTGCGAGTAAAAATTCCCTGTTATTTCAGAAGTAAAGGAACT
TGATATATTTATAGTTCTGTGATTTTTGTTGTCTTTTTTTCTCTGTCCTGTGTTAGTTGG
ACTTTGTGATGTGGGTTGTGTGCTTTTTAGGAAGTTCACATTAGCAGCATCTTGCATGTT
GGTGGACTAACTCATGAGTAGTATGACAATTTCTATTGGTTGTCATGTGTAATCATTGTA
TTTCCCTCCAAAATGTTCCACGAGCGAAGCAATCTTTTGAACATTAGTGCACACTTAGTC
CAAATGAAAGAAAAAGAGGACTGAGGAATAAAAAGGGAATGAGGACCACTTGGTGAGTAA
GTTCCAGAAAGGACGACGATACCCAGTTTGAGTTTGAAGAGTGCTAGTATTGACTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGTTTTCTTTGCATCTTTTTTGT
TTTGGTGATGTTGTTTTAAATCGCCAGAGCCAGTATGCATTTGTTAAGGATGTGATATAT
AGTCCCACCCTCCCCGTTGTGGGTAGATTTCCTCCTTTCTCACTATTGTCTGTCTCTCTG
GGAGCCACCACAACATCATAAGGAGGGGGGGGGGACTTCTTTTTTTGGGAGAGGTTTTTG
CTATAGGGACGCGTGTGCTCGCCAGAAAGAGAGAGAGAGACAGCGAGAAATCACCCCCTC
AGGGGAGATGGCCATGTTGTGATCCCTTCTCCTCTGTTCTCCTCTCGGGATCTTGGGCAC
GCATGCACATGTGTCTGGCGTGAGTTTAAGCCACCAGGTCCGGGACTCGAACCGTGGTCG
ACTACATGGGAGTCCAGTGATATAGTCATTACTGCTGGTCCCACAAAAAAAACTCTTAAA
AAATAAATGAAAGGAGTGACCTAGAGGGAGAGTGATAAAGCGTCCCCTCAGTGGGCATGG
TTATTCTACAGTCCTTTCTCCGTTCTGATAGAATTTAAGTCAAGCAGGATATGACTATTT
TAACCCCTAAACTGTAGGGTCAGCCCTTTTTCTTATTTTTTACATTTTTTAAAGAATATT
TTACACTTATAATATTATAATATTGCATATAACAGTTCTTTTTTTATTCTTAGACTATAA
AGCTGTAGAATTTAGTGTGTTCAACAAAATAGTTTAGTATAAAGGAATTCCTTTTTTTTT
TTGGAGAGGTTTTTGCTATAGGGCGCGTGTGCTCGCCAGACAGAGAGAAACAGAGAAACA
GAAAGCAAGAAATCACCCCCCCCTCCCCCAGGGGAATGGCCATGCTGCAATCCCTTCTCC
TCTCGGGATCTTGGGCAGGCACGCACACGCGCCCAGCATGAGTTTTAAACCACTGGGTCC
AGGATGCGAACTGCGGTCGACTACGTGGGAGTCCAGCGGCATAGCCATTACTCTAACTGC
TGGTCCCTATAAAGGAATTCTTGATCACGCTGTCTCTGACTTTATAGAATCTTAAAGAAT
TGTTCACCTTTTAACAGAAATTCCTTTAATCTTATATATCACTATTAACTCAGATCCCAA
CTTTGTGGAATTAGTTTTTCAATTTCTTTCTTTCCATATGTTTTGTTCACAATACTGTTA
CTCATTCAGCACTTGAGAATTTCACTCACAGTTGTGTCAACTATGTGTCCTTGGCCTAGG
CTTTTTAAAAATGCCTGAAATAATTTTTTTCTAAAATTACATCCCAGAAAGTAGTAAACT
AACAATCTCCCTCAGATATGCAGTTTGGGCAGGTTTCTTAACCTGTTGGATAGTGTTTAA
GAAGGAGAGGGAAAGTATGTGTGCACGTAGACTGTATGGTAACAACTATTTGTTTTCAAG
ATGGCCTTTAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGGTGTGGTTGTTAAGGGTACTGGACTCCTTCCACATG
GCCGGATATGGTTTGAGTCTTGGACTTGTAATTTCCTCCTTCCATGTGCAAGACAGAGAC
CAAGAGAACAGACAGCACTCCACCTGTACGCAGGTTTACCCAGCCTCTGATTATGGGCAT
AAGCATTTCTGGTATATTTAAGGAGGTTGCCAGGCATGAACCCAGAACCTTCCTATTTAG
ATCAGCCTCAGTGAGTGTCAGGTTTTTACCACTGTGCTACTGACCAGCCCCTAGACCTGA
AAGTTCTTAAGCTATAACTCTTTCTGTATTTAGAATTTAGAAACCTTATGCCAGTTTGTA
TAAATATCTGTTGGGAAATATTCTGTAAAATTCAGGAAATGAAAGTCATTGAAACTGATT
GGGTGAGTTTATTTTAGGCCTTAAATCTCATTTTTTTAAGCTATTAGGACACTGAAAGTG
TTTTTCCTCTTTTTAAACTTCCTATTCTGAAATTCAGCAAACTTAAGAGCAAGTCTGAGT
GAATTCTTTCATTTACTTAATACCTGTGACTTAAGTCTGCTCCTATCAGTAACTGCTTTA
TATTGTGTAAACATTTATGCGCTATAAATGTTATTTCTTTGACTGGTCAGAGAGCAGCCC
CTGTGGTACAGACACTCCATGTTCTCTGCACACATATTAACCTGCTTAATGTGCTTTATT
GGGTTTTAAAGCTCTGCCTCCTAAGAAGATATATCTATTTGGTTGTTTGGAAAGTCACGA
CATAATATTCTATGCAAAAATGCATCATGGCTATCCCAACACCCAAAATTCTCTAAGTTC
ATGGCTAGTCTGGGAAAATGCCAGTGTATTCCTTTGCGAGAGAGAGAGAGAAAGAGAGAG
AGAGAGAGAGAGAATGCTTAAGTCAACACACACCCTCGCTCAGTCCTTTTTTCCTTCATT
TCTTCACCCATCAGGATCCTGGGCATCTTCGCTCATGCTGAGTGAGTTTTTCAAGCTGCC
CTGGCCAGGATTTAAACTTTCATTGGCCATGCAGAAACCAGCTTCCTCTCACAGCACAGA
GCTGCTGTACTTTGGAACCATACTGAAGAAAAACTTTTAACTTTAAATGTTGGCTTATGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTAAAGGTTGTATCCTGTT
CATAATATTTTCTCATACCATTGCTAGTACATTTTCTGCATAAATATTGTACATTTACAG
CTAACAAATCCAAAATATCCATGTCCTTATACTATGTTTATTTTCAGATTTTTAAGGATT
TTGTTAGTTTATCTTCACCTTTACCTTGTTTTGCTACATGATAATTTAAAAATAAAAATC
TTCCACCATAAGAAAATGAGTGTGCTCATGGACATTATTTCCCTTATGTTCTTCTGAGTT
TAAAATTAAAAAAAAAAATTGTTTTAGCCTTTAACCTTTTAAAAGTATTAATAACCAGGT
GAGCGTGGTAGGAAGTCTTTTCCAACCCTGCTCATGCAAACTCAAAGCTTACATTCTTCT
TTGGAACAAACTGTTTATAAGGGTATTCCAGTTGTAAAATTTCTCTCCATCTTTTCTCCC
TGTATTCCTCTCTTTAGTCTTAGCTGCCACAATCAGACAGAAAGCATAAAGGAACTTTTT
TCTTGAATCTGTAGTGGAAACTTGAGCAGTAGACAGTAACTGCTCTAGGTCTGTCTGGGC
TTTTATGTTTCTTTTCTTATTTAGGAAATGGTCACTTTTTATATTCATATGATTTGACTG
TTACTGTGTATCTTCTCATTCTATACTAGAGACATTTGTTTCTACCTTTTTAAAAATTTT
TGTTAATTCATTCATTCATTTTATTTGACGAGAGTGGGGGGGGGGAGAGGAGGAGAGAGA
GAGAGAGAAAGTGAGAAAGCAAGTCACCAGGTCTGGGACTTGAACGTGGTCGGCCATGTG
TGACTGTAAAAGTGCCTTAACCACCATGCTACCTGCTGGTCCCCATTTCTACCTTCTTAC
TGTACATACAAATAAGGTACAGAACCATGAATGACATTGGGCTTTCTTGGTAATTTTGAT
TATTATCTGAATCAGTTACATTGCCCCAATAAAAATCATTTGAGTTTTCATCTATTGTTA
CGAAAATAGTCTTACTTGAGTTGATACACAAAGAGCAAAGCGTTTAAAAAAAGGAATGAG
TAACAAATTATTAAATATTATGATTATATTTTCCCACTGTTTTTTCTTTCATTCTCTCTC
ACCTTTGCTCCTAGGTTTTTTCTCTTTTTAAGTATGTATTTATATCTTCCATATGCGTGA
GAGTGAGCAAGAGTGCACGGCTAGTGAAAGACACCCCAGTAGGTTCTTCATTCCACAGTC
TACCCAGTCTAGCCCAGCCTGGATGATGAGCATGCCCTGTGTGCCCAGTATGCACAAGAA
AGTCCCCTTCTTACATGGGTCCAGTTGCATTACCACTGCACTATCACTTGGCCCCACTGT
TAGTATGTTGAAAGCACTCCAATAATTCCTTTTATTTGAAAGTCATCTTTATAAGTTTCG
ATTCACAATGATACTGTAAGCTAACACTTTATTTTCTGGTACTCTTTTTATCTCTTTTAG
CCAACAGTTTTCTCTAGATAACAGTTTTATATATAACTGTTTTTTAAAAATCTTGAAGTT
GGAGAGTCCTTATTATCTTTGATATTATATGTTGGTAGCACATTCTAAAGTATTCATAAG
CATTTAAATTGAATCAGCAAATGACCTTGAATTGTGTTTACTACAACACAGTGCTAGTTC
ACCAACTAATGTCACAGCTTCTTCATTTAAAAGAGAGTACAGCTCTAGCACTAGCTCTAG
ACTTCTTTCTTTTTAGCCATAGGATATGTACTTTGGCAAGAGAGAGAGCATTTGAGTGTA
AGCATACTTCCCAATAGGGTGTGGTCATGCTCCAGTCCTTTTTCTTCCATTTTTCCATCC
TGTCATTCTTTGGGGGACACATGGCACAATGCTGCTGGAGCTGGAATTCAAACTGTGGTT
AGCCATGTGGGGTCCATTGCTGTCTATCCACAGGGTTGTGGAGTTGGCCCTAGCACTATG
CTTTAAGAAGGCAAATAGTTGCTTACAAGAAAACTTACCATTTCTGTTTTGATTGTAGGA
AGTAGAACAACTAAGAATGGAACGCTTACAGATTGATGAACAACTTCGGCAGATTGGTAT
GGGTTTCAGACCTTCTTCCACCAGAGGGCCTGAAAAAGAGAAAGGATATGCCACTGATGA
AAGTACCGTCTCTTCTGTACAAGGTTCTAGGTCTTATAGTGGAAGAGGCAGAGGTCGTCG
CGGCCCTAATTACACCTCCGGTTATGGTAAAAAGTGTTTTTTTCTCCCCCCCCCCCCCCA
GATAGTACTAGTAGAAGTACTAGCTTAGATGCTTCAACACATTCTATTATAATTAACTCA
TCACTCTATCTTGGCTTTTAGTGTAGAAGGCAATTCTGAAGTATATGTCTTAGTGAGGAC
ATATTTTATGTAATTCCTAAGCAGTCATCTAATTAAATGAAGAATGTTTTTAAGCTGGTA
GTTCATAATCATGTTTATTTTAAATATTTAGAAATAATATTTGGAAACTGGTTTTCCAAA
TGTTTCTCTAGTACTGTTTTATGCATTTCCTAGTATAAACCTTGTAATGATAGTGGTACT
GCTATGAATTATCTTTTGTATACCCTGTTAGAAAAGTAGAAATGGAAAGTATCACTGTGC
CAAGATGACTTTTAAAATACATGTTGTAGACCCATTTGGTAGATGTGAATATATTAACTA
ACATCTCATATCTGGAAATATTTTTTGTAATGATAGAATTTCACCGAAATAAGGGCTTTT
TAAAAAGCCAGAACCTAACATTTTATAAATGACCATTTTCTAAAATTTGTATCACAGTGA
GGATGGGGCCTAACTCATATAGGAAAGGACTGATAGCATGGTGATAGCATTTCTCTAATC
CTAAATTCTTACTTCTTCTTCTTCAGCTTTTGAAGTTCCCTTTTTCTACATTTCACCTTG
GATCTTAGCAGTGACCTGATTTTTTTCTTCTCCTTTATTTATTTATTTTTTCTCTTCCCT
CCTTTTTGACTCCCCTGTGTATGTTATGCTCATGCCGTTTTGGGAAAATAAGTTTGTAAA
CCTTTTGCAAAATGTATGGCATATAAAAAGAAAAAAATATATTGTAGAACACTCAGAGGT
TTTGGTAACACAATTTCTGGTAACACAATTGCATTGTACTCTAAAAAAAATTAAGAAGGC
TATTTATTGAGCTGGCCTTATAACCAAATGGTTAAGGGAGCCAGAGCACACGTGGTTGAC
TGCATGGTTTGAATCCCAACCCGTGATGGCTTGGGGTGGGAGGAACACCAGGCACATGTG
TANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACCAAAAGCCCCGCGTT
TTAGTAAAATTAAATGTTCAGATTGACTTTGGAGCTTTATTGTCAGATTGGGGTTTTAGA
TGATGAGAATTCAATGATAAGTTTATAGCCTCTGTGGAAGTCAGCTTACTGGTGAAAAGC
CACCCCTGGCCACCTTTCACAAAAATGTTTATATTGAGAGTAGATATTGTAATAAGAGTA
GTAAAACAGCATAGTGAGACTTAAAGAAAGCTGTGCAAATTGTTCAGTAGATGGCAGTCT
TAACCTTTTAATATTTGCAGATCTAGTTATATTGTATTTCTTAAAACAGCTGTTGAACTT
GAGTGGTCTCCAGACATAAAAACCATTTGTGCATTTGGTTATAGACATTCTTATACATTT
TTTATAAGAAAGATTTTTAGGTGAAAATATATATCAGTTCTATCAGAAATATTTTTCCGT
ATAGTATCTCTGATGTTCATTGTCTTACGTTGGATGGTATCATACAACTCTAATTAAACA
CTCTTTATTAATGGCACTCAGATTATTTGTCTTAAAATGATGCACTTGTAAGTGATAAAA
TGGGTACCTCTAGTTATTAAATTTGGCACACATAACCATTGAAAATGTGGACAATCTTCA
ACAATAATATTATTTTGGAAGTATTAAAGGGGATTTTAAAAAAAGTTAAAAACAGATTGC
CTATTTTAGATCATTACAAATTGGACCAGTGTGATGAATCATTTTTTTAAAAAATAATTT
ATTATTATTTTTTAAATTGACAAGAGAAGGGGAGAGAGAAATAGAGCAAGCCGCCAGGTC
CGGGACTTGAAACGTGGTCGGCCATGTGGGAGTCCAGCACCTTAAATACCATGCCACCTG
CTGACCTGCACTGAATCATTTTTTGAGCTTAAAATTTTTTTTCTTGAATCACGAACTTGT
ATTTTACAAAAATGAGAGTTGGAAATTTATTTATTTTAAATACTGTAGCTTGAATAAGTT
GTCACAAACTTAGACTTCAACAGCATGAATTTATTTTGTTGGTCAGAGGTATGACATGGG
CTAAAGTCTTAAGTCAAGCTGTATTCCTTTCCAGGGGATCTAGAGCAGGGACCCCAAGCC
CCTGGGCCATGGATAGACTGGGGTCCATGGCCTGTTAACCTGCATACCAATCCCTCCACA
GACGGGGTTGGGAGGGTGGGAAAGCAAGGGAGGATTTATATGTGCTTGCAGTCACTCACA
TTGCCTCTTAGGCCCTGCCAGCTGTGGAGTCAGCAGCATATTGGATTCTCTTGGAAGTCC
AAACCCTAATCTGTGATTGTTTCATTATGTATTGTAGTGTGGTAGTGATGGAAATTGGGT
GCACAGTGGATGTAGGATACTTAGATTATCCGGTACCAACCTACCCCACTCCAGTCTGGA
GAGATTGTCTTCCACAAGGCCTGTCCTTGGTGCCGGGAAGGTTGGAAACCACTGTTCTAG
AGGGAGAATCTGTTTTCTTATCACTCCAGCTTCTAGAGACTACCTCAATTTTGGAATTTA
TGTCCCTCCCTCAATTTTAAAAGGCCTGTTACTGTAGAGCTCTTCTCATGCTGCCATCCC
TTCCTCTGCAGATGAGAAAGATTTTACACTGGTTTGCTGTAGGTCCTGTCTGCTCTTGTG
GGGACACATTAGTTGGGGAGAAAGTAAGAAATCACCACCCAGGGAGGGATTGGTGGCCAT
GCCACTATCCCATCTTCATTCTCCTTTGGGGATTTTGGGCTTGCTTTCATAGGCACTTGA
CATGTTTTCTAAGCTGCTGTGTCTGGACGCATACAGCACTGTTGGTCATGTGGGATCCAG
CCACTTTAACAACTCTACCACCTGGTGCTCCCATTCTCCACTTTTTTTTTGGAGAGGTTT
TTGCTATAGGGCGCAAGCTCTTGCCAGAAAGAGACAGACAGAGAGAAATCATCCCCCGGG
GCAGATGTCCATGCTGCAATCCCTTCTCCTCCATTCCATTCTCCTGTTGGGATCTTGGAC
ACGCATGCACATGCGACCCCATTCTCCACTTTTTAAAGACCCATGAAATCAATTAGATAA
TGTTGCCCATCTCAAGGTCCTTTACCTTAGTCACATCTGTGAAATTCTCATTCCAGTGAT
ACATGGCATCTACTTAAATGCTTTTTTGGCATTTGACAAATAAGTATTAGGGGAGATTAA
TTTCTTTTCATGAGATTCTCATACCCAACAAAAACTTGAAAGTAAATAATTGCAGGCTAG
CAGGTCATGATGTAGTGGTTAAGACGCTGGACTCTCACATGGCTGTACAGTTTAAGTGTC
AGACCTGGCGGCTTGCTTTCTCTTCCTCCTCCCTACCCCCGTGAGTGCATCCCTCTAGCA
AATAAAAAATAATAACAAAAATAAATCTTTAAAAAAGTAAGTAATAGGAAACTTGATGTA
TTCTTTCTACGATATACTTTCAGCTACTTAATCCCTTCTTCTGTAGTCAACATAATTAAT
GCATATTTAATGGCGTAGGAGAAAGGGATGTGTTGCAGAGTTATCTTTAAAGGAATTGAG
TCCTTCAGTTGTTAAATGTTCCATTTTATTCCTTTCACTTTATTACATATTCCTTTGTGT
AACTGAAGAGCTCTTGTTTTGCTTTTATTCTCAAATACTGGAGCTTAAATATAGAGAACT
ATTGGGTCATCAGAAAAGTCACAAACTCTTTTTTGCATAGAAAAATATGTCTTGACTTTT
CTGACCACCCAATATTAGATATTTCAGGAAATCACTCTTACTTCAGTATTTAGCAAATGA
GGTTCAGAAAATCATGTTGCAAATTTATTAATCAGGAAGAAGTTGTTAAACATATTGTTA
CTCATTTGGGGGGCATTTAGAAATATGAGATAGAATCCCATTTTTTATCATAGGCCAGCT
TTGGTATAATTCCAAAGTGAAAAAGTAAAGAACAGTACATGACACACACTATAATAGATA
TATGGTGCTTCTTAAGAACATTAGGGAAGGGGAGAGGTCTGTTCGCTCTTAAATTGATCT
GAAGCCAGAAATTGAACTAGACTTTAAGAAACAGATACCTTATAAGAGGACAGGAAGAAA
GTGGCATATCAGAACTAATAAAGAATAGAGTAGGAGCCAGCAGGTGGTATGGTGGTTAAG
GCACTGGATTTCCAGATGACCAACTACGGTTCAAGTCCCAGACTGATAGCTTGAAAATCA
CACTGGGTACATGTGTGTGCATGCCAAAAATCCAGAGGGAAGAATGAGGAGAAGGAATTG
TACCGGGGCCATTTCCCCAGGGGGTAATTTCTCACGTTCCCTCTGTCTCTCACAAAAAAG
CACATGTGGCCAAAGGCATAAATCTAAGAAAAAAGAATAGAGTGGGAATGAATTTAAGAG
TGATTTGGTCACGTAACATCTGACATTATTATTATTTTTAATTATCAGAGGAGATAAAAG
GAGGAGAAAGAGAGTGTGAGCATCCCCCAGTAGGGCATGGTTATGCTACAGTCCTTTTTA
CTCCCGTTTTCCATCTGGTCAGGATTTGGGGCATACATGCACATGCTCCTGGTGTGTGTT
TCAAGCCACTGGGGCTAGGATTTGAACCGTGGTTGGTCATATGGTTGTTCCAAATACACT
GTACTTAAACACTGAGCTTCTGCACTAGCCCATTGCTGACCCTTTAATTGCAATGTGATG
ATGATACACACTTCTTAGGAAATCTTTTCAGTATTAATGTCAAATATAGTGAAAACACTA
TTCTTATACAGTGTAATACTATTCAGCCACAGAAAACAGCAAGACTCTGGCATTTGATAG
AAAGTGGATGATTACGTATTAAATTTACTGCTGAGTAAAGCAAAGTCAGGCTGTGAAAGA
GAGACGTTGTGTGTCTCCACTCACTTAACATATACCTACTATCCACACTCTTATGGTAGA
GACTGAAAGATTGGAGGACATAAAAACATTGAAAATAGTTTATGGAAACTAGAGAGTGTA
GAAGGAGGTTGGGAGAGAGGAAGAGGGTAGGGAATGAAATTAGGGAGAAGTAGAGAGGTA
AGACATTTGTGGGTCACAGAAATGGCTTATTACTCGTTGATAATGTGTATAGTATTTTCG
ACTGGACTGAGGTGTATTTCATGTAGGGTAAATTCTCTTTACAAGCTAAATGATACATAG
TAATTCAATGTAAATAATAATAGGTACTCTTGCTAGTAAAACATGCTATTTTTATGTACA
TCCACTGAAGAAAACACTTCCAGTTTGTAAGACAGACACTATCAGTTACTAGAAATGTCT
TGATTTCAGAGATGTTAGAGTGTGGGGGGTACACTCCAGAATCAATAAAATAATGGTAGA
CTGTATCATACCAGCCATGAATTGTTTTTTTTTCCCTAACTTTGATTAAATTTGCTTCTA
ACATTGAATACTTACTAAGTCATTAAAACCTAAAAATGAATAGAAGCTTTTTTACTATCT
ATATTAAATCTATTTTAATATTGTAATGGTTTGTATGTTTTCTGTAATTCTGTTGGCTAG
TTTCTGCACATCAGAACAATTAACTTTTATATATATCTTGGCTAAAGAGTAATATATATT
ATTCTAACATTTAGTTCGTGAATTTTTAATTTATTTAAATTTTCATTTAGCTTAATTTCT
TCAAGTAACTAGTATGCTTACTTAAACAGTACTTTGCATGAAATAATTTTGAAAATTTTG
AAACCTTTTTCAGAAATAGGAATTTAATTGGTTTGTTATCTTCTGCCCGTAGGTACAAAT
TCTGAGCTGTCTAACCCCTCTGAAACAGAATCTGAGCGTAAAGACGAGCTGAGTGATTGG
TCATTGGCAGGAGAAGATGATCGAGAGAGTCGACCTCAGCGTGACAGCAGGAGACGCCCA
GGAGGAAGAGGCAGAAGTGTTTCAGGGGGTCGAGGTCGTGGTGGACCACGTGGTGGCAAA
TCCTCCATCAGTTCTGGTAGTCTTTTATATACTATGTCAGCATCCATTCTTTGTAAACAG
TACAACCTTAAGTTAATTCATTTTGCAAAGACATCTATTTTTTACATTTCTCTTTTCACT
CCTTATCTTACAGGAAATAGGAACATAAGGGAAAGCACCCTGTAGAATGTAAAGGTTTAC
TTGGAATATTCAAGTCTGAATTTCCATTTGCTAATTCTCTTGTGTTTTTGACGTTTAGTC
CTTCAGTTTAGGGGGCCTTATATAATTGGAAATGTTTTTGTTTTCCCTACAATGTCTATG
TTATGCATTTCTCTTTACGAGACAAAATTCTATTGCACAGAGAAATGAACACTTTGCTAT
ACACACTTAATATTAAAAAGCTGAAAACCTTTCTATACTATGTAGTATAATGAGAACAGG
AAAATTGTGGAGTCCGTCTTTAAAGAAAATTACATTGCTTAAGAAATTGAGCTGTGAGAA
TTGTTTAGATGACTGAAGGCTTGAGGTATATAAACACCTTTTTACTTGTGTCTTTTTAAA
AATTTTTCATGCTTTCTGTTATGTGGAATAGGAGGAGATTTCAGAATATTCTTGATTAGC
ATAATGGGTTAGGAGGGAGAATTACCAGGAATACACAGACTAGATTATATCACGGATTTA
ATATAGCATTATTATATAACACTTTTAGAAAACCACACTTGTTAATATTGCAACATACCT
ATGAATGTTTATGTAGTTTTTCAAGATACATGCATGTACATTAAATATGTGCTTACAAAT
AAGAAAAACTAGAGCAAATGAGGACAAAGTTCAGCGATTTCCTTTGTTTCTGAGTTCTTG
TTCCATGGTTATCTTTGAACTGTAAGTTTAACTCGCAGGCTTTCAGAGTAATAGTTTTTC
AGTTTTGTTAAAAGGCACGTGAACTCACTAGAGAGAGAGAGATCACCCCAGTGTGGGTGG
CCATGTGCAGTTCCTTCTCCATTCTCCTCAGGGTTTGGTGCACGTATATACAGGTATTCT
GTGTTTTTCATGCTGTTTGGTCCAGGACTTGACCTGTGCTGTTTGGCCATGTGGGGTCCA
GCTGCCTTAACCACCATGCCTCTGGCCAGCCCACGAAATAATTTTAATGCTTTAGTATAC
TCTACTTTGTTAATCAAGGTTTATAAAATTAATAGTATACTGACTTGTAAGTAGTTGTAC
TTAGTGTGAGTGATTAATGGATAGATAGTATCTTTTGTAAAGATGTTAGCTTGCTAGGAA
AAATTATGATTAGGTGGATTTCCTCTGTAATTTGCTTGTTGGAGGCAATAAATGCACATA
GGTAAGATGGGTATTTTTTTTATGAATTAAATCCTAAAACTTCCTTCTCTACCTTCACAT
TTGGTATGTAGAGATGGACTGCTTGGAAACATTCATTTGAACATTTTCCTTTTCATAACC
TGTTACAGTTTCAACCTTAGATTGCTATTTTGTATGGACTTGTTTTGATTGTTTCAGTTC
ATTGTTACAGCATTCCATGACATAATAGAAATCCATAACTTGTAGGTGTTGAATACTTGG
AAATTGTTTATTAATATCCACACAAAATTGATAAAAGAGACAAAAGGTCTACTTAGGATT
AATTCATATTAGCTAAATATTTATTTTTCAAGCCTCTGGACAAGATCACTAAGGAATGTG
GATGTTAACATTCATCTGAGGATAGCAGGTGGCATAGTGGTTAAGGTGCTGAACTCCCAC
ATGGTTGCGGTTTGAGTTCTGGACCTGGTGGCTTTGGTGGCTTGAAAATTATTCCGGGTG
TGTGTGCTTATATGCCCAAAATTCTGAGGGAAGAATGGAGGAAAAAGGATTATGGTGTGG
CTATACCCACTGAGGGGGTGATTTCTCATTTTATCTCTCCCAGTGAGTAGGGAAAAAAAT
TAGCATATAATATACTATTTGCTAGTATATATTTTCAAATAAGTCAAAGCAAATGTTAAG
CTTAGTCATCTTAACATCTTTTTCATCTCTATATAAACTTTTCATATTTAATAATTTTGA
TAAAAATGATTCAGAAAATATTTTATTTGAAGAAAAAACATTTTTTATCGGGAGAAATGA
AGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCTCTTAATGAATATT
TCTTGCCTCTGACATGAATATATGTGCTCAAAGATCCAGACAGCAATCCATACAGCTTAC
TTGATAATACAGAATCAGATCAGACTGCAGACACTGATGCCAGCGAATCTCATCACAGTA
CTAACCGTCGTAGGCGGTCTCGTAGACGAAGGACTGATGAAGATGCTGTTCTGATGGACG
GAATGACTGAATCTGATACAGCTTCAGTTAATGAAAATGGGCTAGGTATGTAAACACTCA
GGAAAAGAGAAAGTAATTTTATAATGTGAATGTATGAAGCCTTTTTCAAAAAGTATGCAG
TTTATAAGTTGGCTTTTTCTTAGTGTTTACTTAATCAAGGTTTACATTAACTTTTTGTCT
TTCGTAAATGTCTAGTTCTCACCTGTTATGGTCAAATTATTTGAAACTTAAGAATTAAAT
AAAATGCCCTCTTAAGCCATTTAATCAATGTAGATATTCAAACTGCAAGGTACTTCCTGC
TCTGTTGTCCCCAAACCAAAATTGGGCTTTCAGCTTATGTCTTTAAAATTATTATAAATG
ACACCAATTGAAGGTATGTATATCAAGAGTAGGGTGTTAGTTTCCAGAGGGCTAAAATGT
GGTTAACCATACTAAGCTGTATTGGAGAGGAAAACTTTTTCACTAAATGGTGGTGATTTA
AAGTCTGAGAGTTGATGTTACTGATTTCCAGATGATAATTCCGTTTTGAATTATTTAAAG
TCCCTAAAGCTACAAAAGTATACTTGTCAGTAACATGTCATTTTTATATTTTGGTGTTCA
ATTAAGTTTCTTGCCTCATCATTAAATCTTGGAAGGAAAGAAGCATTTTTGGTTTTTTTT
TTGTTGTTTGTTTTTTTTTTGTCAGAATAGTTCATGATAAACTTTGCAATTGCAGATGAT
AGTGAAAAAAAACCCCAGCGACGCAATCGTAGCCGCAGGCGTCGTTTCAGGGGTCAGGCA
GAAGATAGACAGCCAGGTAACTTGAGTGGACCTTTTGACATCATCAGGTTATAAGCATGG
AAAAAGTCATGTGTCTGCTTCCTAAATATAGTATACTTTCATGTGCACATGTGTGTATAT
CCATTCAAACTTTGCATTGGATAAATGGTTTACTCAACTAAATAAGACTACTTTAGAAAT
GCATTCTTCCTTTACATCATAAATGTTTAGTAACCTGTCTAATTGAACTAATACTGTGTC
TCCAGTTGTTAAAAAAACAACTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1001, 1003..1006, 1008..1032, 1035..1046, 1149..1154, 53253..53305, 55988..56081, 81587..81658, 81942..82090, 82191..82284, 82385..82501, 83113..83283, 85953..86031, 87815..87924, 104300..104386, 106378..106435, 106523..106585, 112492..112695, 114924..115123
1001..1001, 1003..1006, 1008..1032, 1035..1046, 1149..1154, 53253..53305, 55988..56081, 81587..81658, 81942..82090, 82191..82284, 82385..82501, 83113..83283, 85953..86031, 87815..87924, 104300..104386, 106378..106435, 106523..106585, 112492..112695, 114924..115123
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved