Tupaia_belangeri Locus TBRG4
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri TBRG4
Tupaia_belangeri
TBRG4
GeneScaffold_2514
SNORA5, SNORA5
3990..4121, 4491..4625
7493
CTCCTCTTGGGATCTTGGGCACGTACGCACACTCGCCACTAGGTCCGGACCTGGAACCC
TGGTCAACTACATGGGAGTCCAGCAACATAGCCATTATGCTAACTGCTGGTCCCCAAATA
TTCTTTTTCATGAATATAAAGGCCAGGAAAGAGGATTCCTGCTAGTTGCAGGCCCTTCAG
AGCACTAATTTATTCATATAAGCTGAACATTCCACTTATCTGCTTGTTTAAAGAAATTCT
GGGATTTCCTTCTGGAATTTGGGGTGCACAAGCACACATGCCTGGTGTGTTTTTCAAGCC
TCTGAGGCCAAGATTCAAACTGATCAGCTATGTGGGATCTGACTCCCTTCACCACCAGGC
CAAGGTGCCAGCTCTCAGGAGTCATTCTTATTTAAAATGTTCTGTCCTGTTGCTTCTAAT
TAAAAAATCAATTACGCGCAAGCCCTATCAGTAGAGATTCCTGTTCAGGAGATCTTGGGC
AGCTTCTGGATATCTGAATTGTTAAACCATTCCCAAGGAGATTCTGAGGCACAATCAGTT
GAAAACTCCGGCTCAAGCTGTAATGCTCCTGGGTGTTGCTATGTGATGGCAGTGCATACT
GAAACCAAAACCTGAGATTTTTGCCTCAGAAAACACTAGCATGCACTTACAGGTATTGAG
AAATGAAAAAGGCAGGCAGGTTTTACAGAGATGGTGGCCGTGGTCCCATTTCATTTCTCA
TGTTTTTCTCCCAACTTAATAAAAAGCTGCTCTTTGGGGGACCAGCAGGTGGCGTGGTGG
TTAAGGTGCTGGACACTCCCGACCTGGTGGCTTGCTTTCTCACTTCCCCTCACTCTCTCT
CTCTGCTTCTCTCTGTGGTCAAATTAAAATAAATGGATGAATAAATAAAATTAAATAATT
TTTTAAAAAGCTGCTCTTTGATTACCTCTCTTTCTCCTTCCTTTCTCTCAGGGGTTTGGA
GTCACTTGCTAGGAGTTTATATTCCTGCCACCCCAGCCATCATGGCAGCCCGCCTGGTGA
AGCGATGCACATGCCTCCTGAGAGAAGCTGCCCATCTGGCCCCGGCCCCTGCTGCATCTC
CAGTTGGCTGGCTTAGAATCACCAGGGCAGCCCATAAGACTCTAACTTCTTCCGCCACCT
CACCTAGTTCCCACTTCCGAGGTTCCTTGACAGAGCTAGTAGAGAAGGAACCAATGTTTA
CTCCCTACCCAGAGCCCCAGGAGGTAGACCGGCTCATCGAGAAAGCCACCAGGCCGGAGC
AGCTGCTGGAGCTCCTGGGCAGAGATCACCACCTGTACCCCAACCACGCAGCCCTCATAC
TCATCCACCTCTCTCGCCTGCTATCCAAGAAGCCAGAAGACAAGACCTCACTCATTCAGG
ATGCACGCTTCCAGCAGCTGCTCCATCTCGTCAACAGTCAGGTGGGCATTAGCATGTAGT
CTTGAGGGCTTGGGCCCTAGGACAGCCAGCGGCACCCCGATCGGCACCCCGATCTGCGGC
AGTAGGTGATGAGCAGCAGCAGCCAGGCTCCCTCGACATCTAGTGATGTTTCTATCTTGT
ATCGATTTCAGAACACTTTCCTGTGCTTCCTCTCAGTTTACCCTCATAAGACCTCTGTAA
GATAAGCATTGCCACCACCTCCTATAAACAAGAGAACAGGACTCCTGGCAATAGGAATGT
GTGCAGTGGGCTAGGCTTTTCTCAGATCCACAGTGCCTCTTCTCTCCAGGCAGCTTTGAC
TTATATTGCCCCACCACGCCTCCCAGCCTGGCCAAGAACAGGTCCCTGAAACTTGAGAAG
GGCGGGCATTGGCAGGCAAGGGTTCACACCCTCACAGGTGGGGCATGCAGAGAGGAGACC
TACTGAAAAAGAAAGCAGGCACCAGCAAGGAGAGCAGGGCTGGGTCCACATGACTGAGAG
ACTTCCAGGACAAGGTTCCCTTGGTTCCAGGTGCAATGAGGCTGACTCGGGTCTGTGAGG
CTAGGATACAGGTCTGTTCCTAGAAGGGCACCTGGTATTTACAGCGACTCTGTGGGGAGA
TGGTACTAGTGATGGCAGCTTGGTACCTCACAGGGCCTTGGCATTTGGGGGTGGGCAAGC
CTTAGGGATACGAGGAGGTCTTTTTTCCCAGATGTCAAGGCTCTCCTGCAAACCTTAGTG
CCTTGGGGAAGTCTTGTCGCGGTTGGCCTTCAAGGCCTACACACCACTGAAGGGTGTAGT
GGCACCTTTTTTTGTTGCTGTAGGGAACATGCACTCACCAGAGAGACAACAGGAAGAGAG
AAATCACCCTTTGAGGGGTGGCCATGTCGCAGCCCCTTCTCCATTCTCCTCTCAGGATTT
TGGGCAAGTACACATTCAGTGTGAGTTTTAAGCCATTGGGTCTGGGACTCAAACCACAAG
TCAACTGTGTGGGAGTCCAGCAGCATAACCATTACACCATCTGCTGGTCCCATTGGCGCC
ATTCTTAAGCCTGTACCTTCCCTGCAAAGATGTCATTCTGCTTATCACACGAGATGCGTT
TTTCTTTTTTTTTGAGCTTTTTGCCAGGAGCATGCGGTCGCCAAAGAGAGACAGAGACAG
TGAGAAATCATCCCCCCCAGGGGATGGTCACACCACAATCCCTTCTCTGTTCTCCTCCTG
GGATCTTGGGCACGTGTATGCACGCGCCCAGTGTCATTTTCAAGCCAACAGATCTGGGAC
TCAAACCATACAGTTGGTCATCTGGGATCCAACCACCATGCCACCAGCTGGCCCATCAAT
ACTTTTAATAGCTAAAAAGTTTGTCATTGCCAGTAAAAGTAGCAAGCCGGTCACAGAACC
TGAGATACTCTAAGTGCCACCTGCTCTGCCAGGGACTCCCGTCCCTCGGGTGCAGCCTCA
CATTGACCTGCAGTCCCAGTGCTGTTTGCAGCTGCAGTCTGCATGTCCACTCAGAGCTGT
AGCCAGGTGCACATGACAGTGGCTCAGTCTCCCATTTAATCAGCCACATCGGATCAGATC
TGCATTAGGGGAACTCAGAACTTCTCATACCGCTTAAGGTTTTTGCTGGCAAACACTAGC
AAGCTGTTCTGGCTACATCAGTGAGAAACACTGGTTTACTGGAAGCTGGAGGACCAGGCT
CAGGAAATAGGCCAAATGCAGCTGTGGGGAGCCCTGTGAGAACTGGGTGGGGGGCTGTCG
CCCTGAGGGTTTCAGTCAAGCCTCTGAGCCAGGTTCACAGGGCAGGCACGGCATCAGCAG
GTGCTGCAAATGGACCTGCCTGTGTCTGTCTCCTGCCCAGCTATCCTTGATCTGGCACGG
GACCCTCGTAAAGCTGCTGCGGAGCCTGTACAAACTGGCACTCCCCGAGGGCTCCAAAGA
GCTGCAGTCCGTGGAGCAGGAGGTGCGCTGGCGCCTGCGGAGGCTCAAGTACAAGCACCT
GGCCTTCCTGGCAGAGTTCTGCACTGCTTCCATGCAGGAGCAGCACTCCCAGGATCTGCT
GGCCGAGCTGCTGGTGCACCTGGAGAGGCGCTGGACAGAAATTGAGGATGGCCGCATGGT
GGTGGCCATCATGACGAAGGCAGGGCACCTCTCTGAGTCACTAATGAACCGTCTGGAAGA
CAAGGTACTGGGCCTAGGGCGGGCAGCACTTGGTCTGCATTCCAGGACCATGTGATTGTT
CCTGGGACAGTCCTTAGGCCAAGGGGAGTGGGTGTGTGTTTGCTTGACAGCTCTGAAGCT
TCTGGCCAGAGTCTTGGGCGTCAAATGGGGAGGGGCTGGGGCTTCGGGCAGCAAGGGGCA
GCCACCGTGCAGCAACCTCATACTTTCTCCTGACACAAGGCGCTTCTCTTGGTTGTGCCT
TTGTCATTTCCCAGAAGCCCTTGTGTGTGGCCTCGAGAGGTGGGTGTGATGGGCAGTTCC
TGAGGTAGTAGCAAGGTGCTGCTGCGCCTGGGCCAGCCCTGCATGACCCAGTTCTGGCTA
GACTTCCTGGAGGTATTGTCGCTGTAGCCCTGAAGTCTAGTCAAATCATTTCTGTCCTGC
CGTGGCTCGGACTGGCCCAGTGGCTGCCACAGAAAGCCCCAGAGTCCGTGGGCCCTGGCT
CCCTGCCCTGGGACCTGAAGATAAGTGTGGCTGTGGACGCGGTGCTTCAGGGACTCCGGG
TGGGCCCTGCACAGACAGGCCTACATTTACTCAGCTCAGGCCCAGTTACTGTCTCGCAGG
GCCTACGTTGGACGGGACCCCTGCCCCCAGCTCCTCCCCACCGACCCAGGCCATCGAGCT
GACCTCTGCGTGGCTGTGGTTGACAGTGCCTGGAGCTGGTGGAGCAGTTTGGCCCTGACG
AGCTGCGGAAGGTGCTGGTGACACTGGCAGCTCAGAGCCGGCGGTCGGTGCCCCTGCTGC
GGGCTGTCTCCTACCACCTGGTACAGAAGCCCTTCCCACTGACGAAACATGTGCTCCTGG
ACCTGGCCTATGCCTACGGTGAGCCTTCGGTCAGAGGACGGCGGGAGGGGTTGCAGCTGT
GTCAAATTCAGTGCCTGCTCTACCTGTGGCAAGCACTGGCCCCAAAGGCTGCAACAGAAA
ACACTGTGACCCATGGGCCCTGCTCCTCCCTCCCAGGTTCAGGGATAGATCTGGTCACAG
ACACCAAGCCTAGACCAAGGCCAAGGTAGACAAGCAGGCTGGCTGCAACCTTCCCCACCT
AAGCCCCTGTGTCCTGCCTCTATCCCAAAGGCAAACTCAGCTTCCAGCAGACCCAGGTAT
CCCAGCGCCTGGCCACTGACCTGCTACCCCTCGTGCCCAGCCTGACACCCAGCGAGGTGG
CCCGTTGTGTTAAGTCTTTCGCCTTCCTCAAGTGGCTCAACCTACCCCTGTTTGAGGCCC
TTGCCCAGGTGAGCCTGGCCTGGACTTTCCAGGCATCGGCTGGGAACTGTTGCCTTGATT
GGGAAAAACCTGTCTGAGAGCATCCTTAGGGTGGCAGCAGGCATTCTCACCTTCTGGCTT
ACATGGAAAGTGTTGCATTCAGTGGTGGGAATGGCTTCGAGAGCACCCTGTCCCCTCCTG
ATTGTCATCATGTGGCAGCTAGAGCTGCCACACAGGTGAGTCTGAGGACCACTGAGCTCT
CAGGCTGTGGACTGCCCTAGATGGAATGCTAGGAACCACTGTCTCTGCGTAGGTCATGAG
TGGGGGGCTAATCCCAGTGCACCGATTGGAGAGTATTTCTACAGCCATTGTTGGAGGGAG
GTGGCCTCTAGATATCCCCCATCTGCCATGGGTCCTTGCTGCTGACCCTCTGTGACGCAT
ACCTGGGAAGCCTGCAGCTGCTCCTGGCCACCAGGCATCCCTCAGACTCAGAGCTGGGTG
GGAGTATGACCTGTTGGGCAGAGTGCTCACCCTGTCCCTTGCCGTGCCGACCGGCCCAGC
ATGTCCTGAACAGGGCCCAGGACATCGCCTTGCCCCAACTGTGCAACGTGCTCCTGGCTT
TCGCCTGCCTGAACTTCCGTCCGCAGCAAGAGGACCAGTTCTTCAGCCTGGTATGGTCTC
TAGGCTCCCACTCCCCATTCTTTATCCCCTTTCTTGCCAGCTTCTGGCTTGTGAACCATC
CTCCTGGGGCAGCTTAGGTAGGCAGAGGAAAGTGGCCCCACATGCAAAGGCAAGATGACA
GGGGCCTGGCATGGGGCAGGGGGTGCCTCCTGGAGCCAGGCGTCCCTGGGGAAAGACACA
GGAAATCCCTTTGTGCCATCTGGGTGATTCCCTCCCAGGGCCGGTGAGCCCTGCATCCAG
TTTCCTGGTGTTCCCTGACACGCTGACATTCAGAAGCCTCACTGGGCCTCTTCAGAGGCC
TGCTGAAAAGACTGGTAGGTAGCAGCCAGCTGTTCCCTCGCAAATGCTCTGACCCTCAGC
CATCCCAGTTGCACACTTGGGGACGTTACTAGGGAAGGCATTTTGTATGCTGGACAGGCA
GGAGTAAACTTTGCCCGATGCCCCCCACCACCCCGCACAGGGTCAGGGCATGACGATGTT
TTCTTTTTATTTATTTTTTTGGAGAGGTGTTTTTTGCTATAGGGCATGTGCACTCATTAG
AAAGACAAAAGAGACAGAAAATGAGAAATCACCCGCCAGGGGGGGATGGCCACGCCACAA
TCCCTTCTCCATTCTCCTCTTGGTATCTTTGGCACGCACACACGCACACGTACCTGGCAT
GAGTTTAAGCCACCGGGTCCAGGATACGAACCGTGGTCGACTACATGGGAGTTCAGCAAC
ATAGCCATCACGCTAACTGCTGGTCCTGAGGATGTTTTCTAGAGCTGCCTCTGGCCTCAG
TGGGTCCTATGGTGTCTTCACACCTTCCCCACCACACCCATTCTCTCCCAGGTGCACGAG
AGACTAGGGCCAAAGCTGGCTGGCCTCGAGCCAGCTCTGCAGGTGGACCTGGTATGGGCG
CTATGCGTGCTGCAGCATGTGCAGGAGGCGGAGCTACGGGCATCCCTCCACCCTGACTTC
CATGCTCAGCTCTAGGTGAGCCCCTAGTGCTGCCACAGCTCCTTCTCTGTCTACTCCCAG
TCCTCCTGCCTTCATCTGGCTGGGGGAGGTGGATGCTACTTTGTCCACTGGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1420, 3280..3603, 4286..4457, 4710..4867, 5399..5509, 6351..6488, 6491..6493
1001..1420, 3280..3603, 4286..4457, 4710..4867, 5399..5509, 6351..6488, 6491..6493
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved