Tupaia_belangeri Locus PABPC4
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri PABPC4
Tupaia_belangeri
PABPC4
GeneScaffold_2083
SNORA55
6052..6183
12617
CTTGAGTTCCGTAGAGCCCAGATTTAGACTTCACAAGTCCTAGAAACCACTAGGCAAGG
GGCCTGCTTAGGCAGAAAGGTGTGGTGGTTTCATCCTCCTTGTCCTGATAATGCAGAGAA
CATTTCTGTGTGTATTCATTTTAATGATTAAGACTTTTTCTTCAAAATTGCCACAGGGTT
TGTGTGCTCGTGCTGCTGGAAAGACAAGAGAGAAAGGGAAAGTGAGAAAGCACCCTTCAA
GGGAATTGGCCATGCCATAATCTCCTATTCTCCTTTCAGGATTTTGGAGATTTGGGGCAT
GCATACACACATACCCAGCGGGTTTCTCAAGCCACCGGGCCCAAGACTCGAACTCCACAG
TTAGTCCGCCACCCTAACCATTGCACCTCCCACTGGCCCAATGGAGGTTTTTTTGTCTGT
GTCCATTTCTGTTCTCAGAAACCCTGGGAATAGGAGAAACTGGACTGAATTCTGGGATAG
GACATGTTTCCAAATCAGTTGGTCCTAGTTTTGTCCTGGCTCGCTGTATGCGGGTCGCAG
GCTAAATGGCAGCTAGTTGGCCACTTCGATGCACTGTCTCACAAAAATAATTGGGAAGCT
GGTGTTGGTTTCTGAATCACTGACGAGCTGCGTGCCCTGAGCGTAAGTTTGTTCATAAAA
CTGGGTACCTGAAGCACAGTGGGCGGGAGGCCGCACAGTCTCATAAATGGTCCAGCTTAG
TCGGGGTGACGTATTACATTGGATCTTGGTGTCGTTGAGGCCATTTAGATAATCTTTCCC
CACCCTTTGCTGGCTAAGGACAGAGCCTCGAGGGCATGATTAGCTAGAACTCACTCTGCC
TTCAGTAATACTGTAGGCCAAAGGAATGTAATGCCCTTTGATTTTAGAAGTTGTCTTCTA
TCACGGTGCTTACCCTGAAAAGTCCTGGGGTAATCTGTCCTTGGGATGGGGGCAGTGACC
TATGTGATCCGTGATTGAAAAGTGTTTCTCTCTCGACAGCTGAACGAGCCTTGGACACCA
TGAACTTTGATGTGATTAAAGGAAAGCCAATCCGAATTATGTGTCTCAGAGGGATCCCTC
TTTGAGAAATCGGGTGTGGGGAACGTCTTCATCANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCCAAAAAAAAAAGATTTTATTTTTATGGACCTATAATAATAATCT
AAATTTGACCAGTGGGGGGGGAGCGTGGGGGTGCGGGGACAGAGAGGGGAAGTGAGGAGA
AGCCATCGCATGTTCGGGACTCAAACCGCAGTCAGCCATGTGGGAGTCCAGTGTTCTTAA
CCACCACACCACCTGCCGGCCCAATGATTGAATCTTAAAAATGATAAATACCAAATGCGA
GCGAACTGCCTTGGAATTGGGCAACAGGATATGATAATTTTCACAATACTAGAAATGGAA
TCCTAGAAATCTCTGTAGATAATCCAGGGCCACAACCTATAGGTGCATTTGTGCGCTTAT
TTCCCCCTTAGTTTGAAATGTCCTGTTTTCTAGCTTTGGAAGTTCTCAAAAGTTTTCTTT
TGGGCAAAGGAGAAGGAAGGAACTAGAAAAGAGTCTCTAGTCTCCAGGAAGCTAAGCTTA
GTCATTTTAGAAGCATGAATTCACCCTCTTCTGTGTAGTTCTGTTGATGTGGAGTACTTT
GTAAACCTCTAGTGGTGGTGGTTTGCTTGTCCAGTGCCACACGAGGCTGAAATCCTGTAA
TGGGCTTGGAAAATGGTCTTTCTGTAGTGCCATGGTTTGCACCCGGATCTCTTACATGCT
TTTTAGTAAACGTAAGTAATAAAACTTATCTGGAATGGAAGCAGCCTGTCAGTGGTTGCC
ATTTGTAAATGAGGCTCTGTGAGTGTTAGAAATACCTGGTCCGTGGGAACCAGCAGTTAG
CGTAATGGCTATGTCGCTGGACTCCCACGTAGTCGACTGTGGTTCACGTCCTGGACCCAG
TGACTTAAATCTCACGCTGGGCGCCCAGGAGGAGAATGGAGGAGAAGGGATTGCGGCGTG
ACCATCCCCCCTGGGGGTGATTTCTCGCTTTCTGTCTCTATGTCTCTGTCTGGCGAGCAC
ACGCGCCCTATAGCGAAAAACCTCTCCTCCCCCCAAAAAAAGACCTGGTCCAGCGGACTG
CCTGACCCCAGATGGCAGGAGACCCCACGGTTCCCCGGTCCCTAGAGCTGGCCGGTGGTG
CTAAAGCGGCCTGCCTTCTCTTTGGCAGGTGGTGTGTGATGAGAACGGCTCTAAAGGTTA
TGCCTTTGTCCACTTCGAGACCCAAGAGGCTGCCGACAAGGCCATCGAGAAGATGAATGG
CATGCTCCTCAATGACCGCAAAGTGTGAGTGTCCCAGTCCGGAGCGACAGCCATCGCATG
AGCCAGCTGTGGCCCCACCTCGGTATTAACTGGCACACACAAGGCGGCTACTGGTTCTCT
CGGCCCAAGTGTGGCCTGCTCCTACCTCTCCACTCCAGGGCTGGTGAGTCTCCCTGCCTG
AGCCGTGGCAGCCCTTTTGACTCGCCAAGGTGGGCTTCCTGCCCAAGCCATGGCCTGCCT
GCCTCTCCCGTAAAGGCATCCATCTGTGGGTTTTGTGGGCATCGGCAATAGGGCTGGCTG
GAGGGCAGCGCTACGCTCACTCGCCCGCTCTGAGTGGGGTCTTGGCCAGTGGCAGAGTGG
AGAGGGCCTTGGACTGACCAGGAGCTGTGTACTATACTAGCTATGTGACCTTGGCCTTCC
TGTGACTCAGGTCTGTCCATGGGTCTCTCGCTAGTGGTTGATGCCAAATTGTCCCTCTAG
TTCTCCATTTTCTGACTTAAAACTCAGTGACCTAATACGAGGCTGGCTCCACGGTAATGA
CTTGGTTACAGTGAAAAACCCAATCCTTTTGCAGAGACGCTTCATAACAGACCTTGTTGC
TTTCATGTGGTTGGAGAGAGGGGGACTTAGTAAAGCTAGATTTAGAGAAGAGACACCAGG
TCTTGGCTGTTAGAAGCAAAAATCTTTTCTGTTGTGAACACCCAGAGGGTGGGTTGTATC
TGTGTTCAGTGGGCAGCCGTTCTACAGGTATCACTAGAGAGGAAAACGTTCAGTGTGGGG
GCTTTTCTCTCTTAAGCATGACAAAATGAGTAAAGTAAAAATGCAGAGGGTGCCTCTTCA
CTCCAGCAGTCTCACTCTCCTAGGATGAACCAGTGTTAACAGTTTGGTTTGTATCCTTCC
AGACCTTTTCTATGCATTTACGTAGATGCACAGAAATGAACGTTTTTAAAACGTCATCAG
GTTTCTTCACGAAGGCAGTGTGATGTGGTAGGAGGGCCTGGTCTGAGCCGGGAGCCCTGG
GTCTGGTTCCCGCAGGATAGTCCTGCCTCTTTCTCTTTCTGCCGGGGACTTGGGGTGTCT
CTGAGCTTACTCTTGGTGGTGGAGGGTACCTCGTATTTTAATCTCTCCTGTCAACCTTTA
ATCTGCATTCCTCTGGGCCTGCAGAAATAAGTTGTGTTCCTCTGGATGATCACTGTTTTC
CATGGTTTCTTTTTAGATTTGTGGGTCGATTCAAGTCTCGAAAAGAGCGGGAAGCTGAGC
TTGGAGCCAAAGCCAAGGAATTCACCAATGTTTATATAAAAAACTTTGGGGAAGAGGTGG
ATGATGAGAGTCTGAAAGAGCTGTTCAGCCAGTTTGGTAAGTCGGGGGTCCATTGCCCCA
CCTGACCCTGTCCACAGGGCACACAGACCCAGAAGTAAAACATCTCGCGGGACAAAGGTC
ACAGGGTAGGTAGGGATAGACGCTAGGCCTCAGCTCTTGGCTTCCTCCTCTCCTACTCTG
AAGGCTTGGTCAGAGTTAGAGACCAGGCATGGTGCCTCTTTCTGTCTTAGAGTCCATCCG
GGTTTAGCCAGAGATTTGCTTCAAGTGGGTTCCTAGAGAGAAGCCTTCTTTCCTTGAGCT
GTGGTAGAAATGGCATTACTAATAGTTCTGTCCTTCGGCAATAGGTAAGACCCTAAGTGT
CAAGGTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGGCTGTGAGGG
GATGAAAGGAAAAGATATCAGTGGAAAGTCATATTCGTAGCCTGTGCACAGAAGAAAGTG
GACGGCAGGTGGAGGTAAAGCGGAAGTTTGAGCAGCTGAAACAGGAGAGAATTAGCTGCT
ATCAGGGTGAGGGGGTGTGGGCCTGCCTCCCAGCTGGGGTGTGCTCTGAAATTTCTTCAG
AGCACCCTTTGTATTGTAGGGAAACCTAGCGTCTGCTCTTCTTATTTCTCCCCAAGATGA
GGTTCAAAGGACACGTGCTCACCAGGATTGACAAAGGACAAAAGGGACTGCCCTGTGTGT
TCAGGGACTCTGTTCTGGAAGCAGGTGCTTTTACTTAAATGTGACCTCCTCGCTGGGAAT
GGTGGAGAGATGCACCCTGCTGGTGGATGGTCGGCCAGAGCACCTCTGAGTAGTCAGCAG
CACTCAGCAGCATGTGACTGCATCAGAGTCACCTACAGAGCTTGCAGATCGCTGACGGGG
GGCGGTCCCACGAGGTCACTTAGCGATTGGAGTCCTAGACCCATACCTTCATGCCCCAGA
TCCGAACAGGAGAGAGAAGGAGAAGGGGTTGTGGCGTGACCGCTCTCCATAGCTCCATAG
GGGCGCCTTTTCCCCTTCTCACTGTGCCTCTGCCTCTGTCTCTGGAGAGAACGTGTACCC
TCTGTCGAAATTTTAAAAAAGACCGTTGGGCCCCAACCCCATGGTTCCCAGTTTATTGGG
TTTGGCCCAGGAATTTTCATTCCTGATAAATTCGGAAGGATCCTGGTGCTGTTGCTCTGG
GAACCATTGGCTCAGGGAGTGTCTGGTGTATACGTGCAGTTACAGTGAGCCTTCACTTCC
AGGGGGTGAATCTCTACATTAAGAACTTGGATGACACCATTGATGACGAGAAATTGAGGA
AAGAGTTTTCTCCTTTCGGATCAATCACCAGTGCCAAGGTATTTTAATACTGAGATTTTT
GTGCTCAGCGGTGATAGTATTTTACCAGGGCTCATTAACGTTTATTTCATTGAAGGAATA
AAATCTAGATTGTGTTCATTTCTGAGCTAGGTACTCTCTTCTAGCAAATTTCTCCTTGCC
TTCAGTTACCCAGCTGAGTGTCTTCTCTGGAGAGTGACGTTTCATTAGGTCGATGTTACG
CTGTCTCCCAAGCACTGGGACCTGGAGGAGAGCCTGAGCCCATCCCTCCAGAGCACCGGA
ATCTTTCCCGCTCCTTGCTGCCTCGTGCTGGTGTGGGGACAGGTGGTGCCACAGTGTGAG
CAGAGGATATCCAGACGGGCCGTCCATTTGCCTTGGGGCCTGTCCCTACAACTCTGCCAC
ATTTTCTCTCTTGGAGCTGGGTTCGCGAACTTCTACCCTGCTCCAAGAGTAGGAAGTTCG
TTTTCCCATATTTTGCACTCTGTATTACTTTGTTCATTTTCTGTGATTATCATGTCAACC
GAGTTAGCAGGGTGAGGAAGTATAAACCTCATTTTGAAGATTAGGGATTTGAGTGCTTGG
CATGCTGGCGAAACCACATGGTGTAGTGGTTACATTGCTTGACTCTCAATGTAGTCGACT
ACAGTTCCAGGCCCAGACCTGGTAGCAAAACTCAAGCCAGGTACAAGTGCGTATGTGCCG
AAGATCCCCAGAGGGGATTGGAGAAGGGAATGTGGCGGGGCTTTTCTCCCTGGGGGCTGG
TTTCTTGCTCTCTGTCTCTTGGTTGAGCACACACACTCTGTAGCAAAAATCTCTTAAAAA
AAAAAAAAAGTGCTGCCTACAGGGGAATAGTAGTATATTGTGTGTTCTCAGCACTTCGAA
GTGTGACAGCGGCTGATGGCATCCGAAAGTTTGGGGTCACTGATAAAAAACTGATGGGGA
CACCAGGGACAGCATTGCTGCAGCAGGTGCTGCAGAGTTCCATAGGAGAGGCAGGAAGCT
GAGCGGGTTAGTAAAGGCGAAGTGGCCCGGCCCCAGCTCTCACAGCTGGGAAATGTGCAG
ACACGTGAACAGAGGCCTGCTCTTTGTGGGGTCTGTCCAGTTCCTTGCTGCTCCCTCTGC
CGCCACCCCCTTGATAGGCCCCCATCAGTGCAAGGTATGATCCTTGCTTATCTGGACAGG
AGCCACGTTGACCTCTGTAGAGAGAGCAAAGGACCTACCTTGCAGGTCACAGGCACCTTT
TTGCTTGTTGTTTCTTTAGGGAGATTTTGCTATAGGGCTCATNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTAAGAATTGTTATATTTAACTTTATCT
ATTTTATATTTGGCCAAAGAGGAAGAGAGAGAGAGAAAGCATGCTGCTGGGTCTGGGACT
CAAACTGGGGTCAGCCATGCGGGAGTCCAGTGCCTTAACCACCACACCACCTGTTGGCCC
CCGGCGCCATTTTTAAGATCATGGTTTGGCACTATTCTCACTCCTTACTGACCCACCTTG
GTGGTGGAGAGTCGTTGGGTGAGTCACAGCCTTAGATCCATTTCCTGCCCTGCAGGGGGG
CTCCAGGCCATTAACTGAGTCACAGAACATGCCCAGCACATTCGTGTTGCTGCTGGCATC
TCAGGTTCTCGGGGAGATACCCTTTACAGCGAGGGAGAAGCTATTGGTGAACAGCTAACT
TCATAGTGGAAAAAGACTACCAAGCCAGTAGACCTATGACTTTGTTACTATTTGCCTTAG
AGAATATCAAGGAAATTGAGACTTGGCAAATCAGACTAGACTCTAGGCTGCCTGTCTCCC
CACTAGTTGTCTATTCCCTAGGAACCGGTGTGGCACCCATTGGTGACCTGGCTGTGGCAG
AACGCCTTCTGACAGAGTTTTGTAGAAGTGTAATCTTAGTCCTACTAAGATCTTCTGAAA
ATGTTGTCCACCAGAGTTTTGGAGCAGCTAAGTACTGAGTGCGGAAGAGAAGTTGTGGGT
ACCCAGGGGTAGCTAGGCTCCTGCATAGCAGGAAGCATTTTGGGGTTCCTGTTGTGTTAG
CCATATCTTAACGTTTGGGAACTTTTACCTGAGGACTTGGGAAAAACGCCTGCATACTGT
ATAGGTTGTGATTAACTGGTCCCTGGAGTATTTTAGGGGATCGAACCCTCGGCCTTGACT
TGGAAACTGCAGCCGAACCTGGGTTTTCTGGCTGTTCTGAATCCCTCCTACCCTGACACA
TGCAGATACACACAGGAACCATCCTAAGTAGCTCTTCTCCTTTTGTAGGTCATGCTGGAG
GATGGGAGAAGCAAAGGGTTTGGCTTTGTCTGCTTCTCATCTCCTGAAGAGGCGACCAAA
GCAGTGACTGAGATGAATGGACGCATCGTGGGCTCCAAGCCGCTGTACGTCGCCCTTGCC
CAGAGGAAGGAGGAGAGGAAGGCCCACCTGACCAATCAGTATATGCAGCGGGTGGCAGGG
ATGAGAGCGCTCCCTGCCAATGCCATCCTTAACCAGTTCCAGCCTGCAGCTGGCGGTTAC
TTCGTGCCAGCCGTCCCACAGGTAGGTCTGCTGTGTTGGCCGTAGCTCTTTGGTTCCTGT
GTTCTGCCTTGGTTGGGGAGAGGCGTTTGGGTGTATTGGAGTTCCAGGATGTCGGGTAAA
AGTGAGGAAGGACTTGGTCATGGTCACGCGCACGTACACACACAGATGGAGGAAGCGTAG
GGTGGTCACCAGGAAGGGACTGCTCAGTATTCGAGTGCAGAGTCTTCATTCCACGGAGCT
AGCCTAGGGGCTGGTAGTGAATGTGATGAGCTGCTTATCTGATGGGTGCAGGTCCTCGAA
AGGGCTTGGGTGCTCTTTCTTACAGGCTCAGGGGAGACCTCCGTATTACACACCTAACCA
GTTAGCACAGATGAGGCCTAATCCACGCTGGCAGCAAGGCGGGAGACCTCAAGGTAGGTG
GTGGGGTCATTTGGTCATCCAGGTTGTACCCGTCCTGTCTTCCGTGCCGTAGCCGGGGCC
CTGGTCCGCGTCACTTGTCAGTGACGAGCAGTGTTTGTCTCCACCAGGCTTCCAAGGAAT
GCCAAGTGCTATACGCCAATCTGGGCCTCGTCCAACTCTTCGCCATCTGGCTCCAACTGG
TAATGCTCCGGCCTCTCGTGGCCTCCCTACTACCACTCAGAGAGTCGGTGAGCAAACTGG
CCTTAATATACAGGCCCGGGGAGGAGGGAGTCAGGATGACTAGGCTCTGCCCTGGGTTGG
TCAGTTTGTCGGGCTCGAGGTTCTCGAGTCCTGGTTCTGTGATCTCAGTCGTGCACGGAG
GCAGGTGCGTCAGGAGCAGAGCAGCGCTGTGAGGTCCGGGATGTTGGTCTGTGCTCATCG
GTGACTCGTGTGGAGGAGGCTCACTGTAGACGCTGGCTAGTGGACGACTCAGGCAGCCTG
TTCTTCTGAGGGGAGGGGGTGTGAGGAAGCTTTTTACAGAGTATGTCCCGTGTTCCGAGT
TGTGGAGTCGTATGTTACCCTTTGACTCGTCCTCCAAAGTAGCAGTAGTGGTCCCATGTG
TGATGTGTCATGTGAACGTGCTTTTGGAGATTCTCCTTCCGTGGGACGTGGCCAGATGGA
CATCTGTCGCCGACACTGATGTGCGTTTGCTGGTCTACTGGACGGTCTGTATACACGGAC
CGCTTGGCTATGGACTTTGGTGGGGCTGGTGCCGCCCAGCAAGGGCTGACTGACAGCTGC
CAGTCTGGAGGTGGTATTGGATGCACACAGAAGGGGGAAAGATGGGATTTGACGGGTCTT
TGGCCAGACTGATGGGCTTTAATTGTGTGTGTTCGTTTCCCCAAGGCGTCCCCACAGCCG
TGCAGAACTTAGCACCTCGCGCTGCTGTTGCCGCTCCCGCTCCCCGGGCTGTGGCCCCGT
ACAAATACGCCTCCAGCGTCCGCAGCCCTCATCCTGCCATACAGCCTCTGCAGGTGAGGC
CCCGCTGCTGCCCCGGGGATTCCCCATTTGCACTCGGTTTAAACCCTTCAACAGGTGTTA
AGTGCCCACTCCGTGTTGGGCGCTGTGTTCTGTGACTCGGATACTCTCCTTGCCCTTTGG
GTGGGGGCCAGGGGCTTGGATATGTCCTCCTATAGCCTCACTTGGAACTGCCCAGAGGGT
CCAGCTGGTGCTTCCTGCTCTCCTCTGTGACGAGTGTGCTCAGCTCTCAGCCTCCAGGCC
GCTTTCCCATCTAGCAGCCGTGGGCATCCCTGACTGTGCTGCAGGATGATTGGACACTAA
GGCAGGAAGTAACCTCATCTTTCAGATGAGGAGCTTACTTTCAGAGGCGCTGAGTAGGTG
GGGACGTGGGAGGGGTTGAACTCGGAGTCTGGGTTTTCTGAGCTGCAACTTGAGCGTGCC
CCTAAAGGCCAGCCAAGGTACAGCCATTCCATGTCAGAGCTCAGTAGCAGTTTGTTGCAG
AGGTGCCCACTCATCCTCAGACCCGGTGTTGCCCTTCCACCATCCTGCCCCATGTTCACT
AAGTTGGAATTTTCTCAGAATTCGAGGCTACAGAAGATATCTTTTACCTGCAAGGATCTA
CTTTTAGGCTGTCACTGTCATTGACATGGCACGTTGATAGTCTTCAAGCATTTGTCACTG
ATACAGTGGGAGCACTGTACAGGAAGTGACGTGGGCGGAAATTATAAATGCTTTGGTATT
CGCTCTGACCCATCTGTAATGGACTTCACTCAAGGAAAGCCATAATTTTCAGGAGAGGCT
ATACTTGAAAATGTGGGTAACATGACTTCAAATTCTTGGGTAACGGGTGAATCACATGAG
CTGTCAGAACTGCTCAGCCTTGTAGACTGGTCTTATTGTGCATTTCACACTCCCTTCTAA
TTACAAGCGTTTTCATAGTAATTGGACAATATCTTTACGTCCATACCACTCTGTTCTTCC
CTGCACCCCTCAGTCCCCCAAGGACCTCGAGAGCGAGGACAACTCCTCCACCTCCTCTCA
TAGCTATGTTCAGGTGTTGATCGTCGGCGTCCTGTCCTCGTGCTAACCCTCTGCCTCTCC
TGTTCCCAGGCACCTCAGCCTGCAGTCCACGTGCAGGGGCAGGAGCCTCTGACTGCCTCC
ATGCTGGCCGCAGCACCCCCCCAGGAGCAGAAGCAGATGCTGGGTGAGTGGGCCATGTGC
TTGCAGGAGGAGGAGGACCAGAACCTTGGGTCACCCTGGACACCAGTGTCTGTTCCTCCC
TGGGGTGCAATTTGGGTTCGTTCCCTGTCCTGCCCGCAGGAGAACGTCTGTTCCCGCTCA
TCCAGACGATGCACTCGAACCTGGCTGGGAAGATCACGGGCATGCTGCTGGAGATCGACA
ACTCCGAGCTGCTGCACATGCTGGAGTCCCCCGAGTCGCTCCGCTCCAAGGTGAGCGAGG
TGTCAGACCCTGTGCTGCAGCCCTCAGATTGGGAACTGGGGCACTCCGGCACAGCAGAGC
GGGTTCGCCCCATCAGCCCCCCTCTCAGGTGCTGCAGTGAGTGGGGACTGCTGTGTGGTA
TGGGAAGCAGTTGGCACTAGAAGCCCAGGGATCGTTTCCATGGTTGGTTCTGGTCCACCA
GTGGGCAGGCTACCGGGGGTGTGTGTGGGCTGATTCCCCTCAGATCCACTGACCACTCAG
ATCCCTTGCAGGTGGATGAAGCCGTGGCAGTCCTGCAGGCTCATCACGCCAAGAAAGAAG
CTGCCCAGAAGGTGGGCGCTGTCGCTGCTGCTACCTCTTAGGAAGAACCGTAGGTTTTAT
TGTTCCGTTTTCTACAGTGGTTCTGGCTTATGAATGTCTTCCTACTTGAACAGAGACAAG
GTTTAGAACCATGTTCCTGCCTCTGTAACCTGATAACTTGGGCAAGATCTTTTTTGGTCA
TTTGCATGATTAAATATGGAGAAAAGAGCACAGATTATGAAATAAAAAGGAGCCTGTCAG
ATCTTACTTAACAATCACTTCATTGGTCTGAAGTAGTGACACATGTGAGTTGTCATAAGC
AGGCCCCCAAGCCTCGTTTCTGTGAGCCTCACCTTTCTGGTTTGGCCTGAGGTCGATGAC
ACGTGTATACCTACTGCTTAGCTCTGAGAGTACAGCAGGCAGAGTGGGCCCTGGTGTGTC
TGTTGGGACACAGTGTGTTCCAGTTGATTTATCGCAAAGACTACAGGCGGTCTGCAGGGG
CTTGGTGAGGGCAGTTCACACCTCTGGCAGGGGGTGGTGGGGTGCCTCCGGGTGGGGATA
GGAGTCGGTGAGCACAGGCGGGGCAAGGGAGCACATGGGGCCCCTGCACTGCTGTCGGCC
TGAAGAGCCGTGTCCTGTAGTGGCTTAGACCTGGGGTGCCACTGGCCCGAAGAACCGTGT
CCTGTAGTGGCTTAGACCCGGGGTGCCACTGACCTGCAGTGGATCCCCAAACAGAACTGT
GGGCCCAGCATGTCTCGGCTGCCAGGTTGAGAGATCCTGGTCCAGACTGCTTACGAGCTG
GGACTCACAATCTCTGGTCTTAACTCTGTTGTTTGTGTTGGTGTTTTGTTTGCAGGATTC
AAAAGCCAAATAACCCCTCATGGAATTCAGCTCAAGGTTCGAAGACTTCTTAGCTTGTCC
TATGGACCTCAGCATCGAGAACCAGATTTCAAATGTAATAGGTCATTTTGTATCAAAAGG
TCAATGATGAAGCACCTAGAATTTTTGAATTATACAGATATATTTTCTGGGCTCTGCTGT
GGCCCAGACAGTGTTAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1060, 1063..1083, 1086..1190, 2488..2603, 3796..3935, 4244..4338, 4850..4855, 4858..4881, 4884..4919, 4922..4984, 5702..5797, 8148..8420, 8725..8812, 8927..9046, 9523..9609, 9705..9832, 10929..11022, 11139..11269, 11531..11617
1001..1060, 1063..1083, 1086..1190, 2488..2603, 3796..3935, 4244..4338, 4850..4855, 4858..4881, 4884..4919, 4922..4984, 5702..5797, 8148..8420, 8725..8812, 8927..9046, 9523..9609, 9705..9832, 10929..11022, 11139..11269, 11531..11617
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved