Tupaia_belangeri Locus TXNDC1
snOPY snoRNA Orthological Gene Database
Tupaia_belangeri TXNDC1
Tupaia_belangeri
TXNDC1
GeneScaffold_2748
SNORA70
4243..4377
21856
TGGAAACTGGAATGCTATCTGGTCAAACTTGATGAATACAGACAAACTAATGACTTTGC
CATCACACAGATCACTGGTGTCCTCCAAAGAGCCATTCAGAGGAGAGGCCATTTGAGTGG
GTTCAAGAGTGACTTTGAGGTGAAGAAATGTAATACATTTTCATTTGACAGACTAATAAT
TTCTAAAGGCAGTACACATTTTGGTTTGCACTGGTATTTACAAATGTTTGGGGGAAAAAA
GAATCCTCCAGTATTTATGGCAAGCCTCTTTGTTTCTCTGTTTTGATGTTGTGATCCGGG
ATCTCTGTATGTACCTGCACTGTCTTCAAACTGAGAAATAATAAACATCAGAATGTGCAT
AAAGTGCATTCATCTTAAGATGCACAGCTCGATGGGCTTTTTTTACATACGTGTGCTCTC
GTGTAACCACTGCTCATACCAAAATGAATATAAAAGCTACCCCATGGGGGGGGGGGTGCA
TCTTCCCAGTCTTAATACCCAGAAGTAAACCCATAGGCTTACTCCTATAAACACCCATTA
GCTTTATTACAAAATTTTTCAAAGGAAACAAATGAAAACTGATGAGCATTTAATTACAAA
CCTCTATAGTAAATTTTACCAATTGGCTTCGATAAGCATAAATGACAGTCATTTGGCGCG
CAAAAGCCGGCCCCAACATCTAAGCGATCCCTCCTCAACGCCATGCTCCACGTTCGCCAC
GCCCCCTCTCGCGCTTTTCCTTCCCTTCTGTCCTGGGCCTTCTAGGTGGTGGGAGGAGCC
CACTTTCTGTCATGCGCACTACCGAGAGGCGCGCTTTCCTCGCCCCCTACGCCCCACCCA
CTGGGACTAGAGCCCAGTCCTGCGCATTGAAATTCCTCTAGGCACGCGCGCCTCCCCGCG
CCGTCGTGCGCATGAGCAGCGCCGCGCGCAGAGAGCGGAAGTGGTAGCTGCTGCAGGGAG
TGGGGCTGCGGTGCTTGCTGTGGGGTGGGCGAGCAGCCGACATGGCGCCCTCCGGGAGCC
TCGTGGTTTCCCCGGCAGTCCTGGTGCTCTTGCTTTTGGGGACCCCCTGGGCCCACGGAC
GGCGGAGCGATGTGCGCGTCATCACGGACGAGAACTGGAGAGAGTTGCTGGAAGGAGAAT
GGATGATAGAATTGTGAGTGCGGGGCGGTTGTCCCGGGTCTCCTCGGCCCGCCAGGCTGG
CTGGGGTCCTGCGCCGGAGGACCCACTTCACCCGCAGGCCGCAGTTTCTTGAGACTGCGC
CCCTGAGTCGCCGACCCGGCGTTCCCGACTCCTTCGGATCCCCAAACTCCTCACGGGATC
TGCCGCCGGCTTAGTTCCACCCTTTGTTCGTTTTACTAGATAGATAAGTTTCTTCCCAAG
TGTTTCTAGGGCTGTGGTGGGCTTGAAAGGTTTTCATGCCACTTTTCCGTGGCTTTGAGG
ATGGGGTTGGACCTGGGGAGCTGCCTAGTTCCCATCCATACAGTTAATGACATTAGAATG
ATTTTCCACAAACTTCTAGACTTACTTTCACTAAGCTTTGCAGAAAAGGATATTGAACAA
AATCTCTCCTAGCTTTTTGTCTAGTATTAAAGTTAGGCTCTGTATAATGTTAGAAACCAG
GGCTTTATTTTTTATAGACTAGCCACATTTTTTTATTGTAAATGCTGAGAAAATTCAAGT
AGAGTTATTTTTGTATCTTGGTTTTCTTTTTTCTTTTTTCGATTTTTCCTTTTGCTCTGT
CTTTTCGACTCCATAACTTATTTTTCCTTTTGAGTGTGTGTTTTTGCAGTGTAGAGAATA
CTTTGATTGTGACTCCCAGGCTTTTGTAAGAGGTATTTCATTAAAGGATAAAGTTAGTAT
GACTAAGTATGACTATTACAACCTTTTAAGAACGCCATGTTGTCATGTATTGTTTCAGCA
AAACCATGTGTCTTGTGTGGTGATTCCATTTTACTAACTTCCGTTTTGTTTTGCAGTGGT
AGGAAACAAATGATCTGCTTTTGCTTTAGATCCTAAGTTGGTGGTGGTAGTGTCATTGAT
ACTGATATTAATGAAATCCTTATTGAATTAACTCAGCGACTGGACACTGCTAAGAATCTT
TACATACATCATCTTATTTAATTATCAAGGCTCTGATAGGAATTATTTTTCCCCACTTTA
CAAATGAGAGCAGCTTAATTAACCAGTTGCTTTATTAGGCTAGGTCTTTGGGTCTGCAGA
GTAGGACTCCGTGTTCTTTAGCAAAGTTCCAGTTGGTATTTCCTAGATCATGGATGGAGC
TAGGGTTGCCAGTTAAGGAGGCAGGTGGAAGTGATACCCCAAGAGAGAACTCAGAAGGCC
AAATCAGTTACTCTTGGGGTATTAAGAAAATACCCCAAATTTAGAACTTGCATGCAGTGG
ATTAGATAGGGGAAATTACAGTCTGCAACTCAATGAAATGAATTTTTAGAAAACATCATT
GAAGCTTAAGCAGAGAAGTAGAACTGGGGACCACATTTGGTTTTGTCAAGAGTACCTTGC
TTTATATTGCCACGGAAAAATATTCAGAGTTCGAAACAATAATTGAGATGCAAATACAGT
ATATCTCAGTTAAAGCTCGTTTAAACTGTACAGATGTAGAACTATTAAGGAGAACGTAGC
AAAACCTGAGCTAAATCTGTATTAGAGCATCATGTGGTAATAGGATAGTGTTTTTTTCTA
TTTTGTCTTAACTCAAGATTGTGAGGTTCAGTGATTGTTCTAATAGCAACTAAGAAAACA
GACTTGAAAAAGAAGGGATCTATTGTAGTCCTAAAATAATCTGCCCATAATTACAGTTGA
ATTATTTTAAATAAATCCAGTTTTGATCAGCAGTTTTGTTACGGATATATTTTTATTATA
ATATGATTTTTTTGTTGAGGAGTTTGGTTTTGTATGTTTTGTCAAGTTTTCCCAATTTTA
CAATGCCTAGGAGTTTGATTTTCCTAAAGCAATTTAAGAAAATGTAAAGTACAGAAATTG
TACTGTGTCTAACAAGTATGGGCATTATTCTTCCTGGTTCCATTAAAAACCTGAGGCAGG
CTATAAGATAATACACAATAAAATAGAAACATAAAATTCCAGGGAAAATCCAGGGCCTGG
GAAGATAATACCAGAGTAGTAATTAAAATGCCATTATGCTTGGCCATAGAATTTAGAAAT
CCAAGTTCTTGGAAACTTTTATCATGGGCTAGCCAAAAGAGTTGTTTGGCCTGCTTAGTA
TTTGTGTGGGGGTTAAGTTTTGCGTTAACATTTTTACATAAAAATGCAGATCTGCAACTT
CTTTTAAATATGAATAGGCGTCTTTCTGGGCCTGCCATCCCTTATGGCTATCCTATTTAG
TAGTAATGGTTGCCCACTTGAAGTGGAGCAGGTGCTTCCTTAAAATTCACAGCAGTCCAG
AGAGCTTCCTGTCTTTCTAGCACCTTGTATTTGTGATTCTACATTGTAAAATGATTAAAA
TTGGCCAACTCTCAATTTGGCTTTGAGCTTATTGGTGGTCACTTTTTAAAGAATTATTTT
ATTTAACTTTCTTTATTTTAATTTGACTAGAAAGGGATAGAGTGAGCCAGAGATAAAGGG
AGAAAGCAAGTAACCAGGTCCAGGACTTGAACCATGGTTGGCCATGTGGGAATCCATCGC
TTTTAACCACTATGCCACCTGCCGGCCCTGGTGGTTACATTTTAATAGAAAAGTTCACAG
GCCTTTAAGGAGCTGTTTTGCATGTGAGAAAAGTTTTTGTGTCTTTAAGAACTTTATCCT
GGAATTACTTTGATGTAATTAGCATCATCTATTGACAATTTACTTCCAGATTGTTATAAC
CACTTTTATAACCATTTTTGTCTATACAAATTAACCACTTTGATATCTTCAGTGACTGTT
CTTGGTAAAGTATTCTTCAAAAATTAAACATTTAGAATTTTTCTTTTCTAGATGAATGGT
ATTCTCATATTATAGTGCTGAGCTTTTTTTTTTTTTTAAATTGTATTTCTTAGTTATGCT
CCATGGTGTCCTGCTTGTCAAAATCTTCAACCAGAATGGGAAAATTTCGCTGAATGGGGA
GAAGATCTTGAGGTTAATGTTGCAAAAGTTGATGTCACAGAGCAGCCAGGTACTATAAGT
CTGGTTATTTTTTTTCTTTGCTGATGGATTGATATGTTTATCCAGTTTTTCACATTATGT
GGTGTTAGGTCTATCTTTCCTTAGGTTTTGAAACCATAAGTGTCTGCAGCTAATTAAGCC
GACTGGCCCACCTCTCTGATGGGGGCTCAGTGTGCAATGGCTGCGAAAAGCAGATTCCTT
GGTTGTGTATGCAGCTCATTCCTTGTATGTGTTGCTTTAAGGGACCCTGGAAACATCTCC
CTCTCCCTATTCCCCACATAACTACCTCCAGTCCTTGTTTGTTTGAATCTCAGGCCCCTG
ACTAGCATGCAATATGTGTTTAAGAAGTCCTAGGATGCTGCAGTCTAGGTGAACATTGAT
CAAGCCATCATTTGCATTCATAGGAGTTTTCAGAATAAGGAGCTTATTTTAATAGTTGGG
TTTCTTTGTAGTGTCATAGTCACATTCCCTGACAAAAGAATATCTGAATCTCTGACACTG
AGTTCCAAATTTGATAACTGTGATTTGAGAACATGGACTTTTAATTACAAAGCAGTCATT
GTGGGGTCAAGTACATTGCTGATTTGGTCCCCTAAACTGGTAGCAAGCCCTGTTCATTTT
TTAGGAGAGATTTTTGCTATAGGGCGTGTGTGCTGGCTGGAGAGACAGAGAGACAGAAAA
CGAAAAATCACCTCCCAGGAGTGGTGGCCATGCCACAATCCTTTTTCCATTCTCCTCTTA
GGATTTTGGGCATGCACGCATACGTGCCCCAAACTATTACACCATTTGTGGTCCCCAAGC
CCTGTTCTTAAGGATGTTTCTTTCTCAGACCACCCTCATCTTATTGGTGGTCACAGCAAA
CCTGGATTCCTGGCTGCCCTATCCCAAATGGTAATAATAGGTAGTATTTATTACTTACCT
ATTAGAGCACTCTCCCAAGTGTTTTACGTTTATTACTTCATGCTCACACAACCATAAGAG
ATATGTAATAATCTCATTTTACAGATAAACAGAGGCACAGATCATTATATATTATTAATA
AATGTTAGCTGCTACTTTTAATGTCTATCTTAAGAAAGATACTTAGCATTTTCCACTTTA
GGAAACACCACCCACTGCCTCTGTTTTTTTGAATGTTGTACAATTTCATTTCATTTTAGA
TCTAAGATGTGCTATCCTATGACTTACCAGTAGTAGCCTTTTTTAATTGAAACATGGTAA
TCATACATGTTCATGGATCAAAGTGTGATCAAAATACCATGATCAAATCAGGATAATGAG
TATATCTGTCACCTCAACCATTTAACATTTCTTTTTGTTAGGAACATTAAAAATATTCTC
TTTCAGCTATTTACAAATATACAATAAATTAACTATAGTTACTCTGTGATGCTATAAAAT
ACTAGAATTTAATCATTCTGTCTAACTGTATTTTTGTACCTATTAACTACACTCGAATCC
TCTACCTTCTCAGGCTCTGATAACCACTTTTCTGTTCTCTGCTTCTATGAGATCAACCTT
TTTTTGGCTTTCACATGAGTGAGAACATGCAGTATTTGTCTTTCTGTGCCTAAATTATTT
CATTTAACAAAATTCCTTCAGACTTGTCCACATTGCCAGGAATGACAGGATTTTATCCCT
TTTAATGAAATAATATTCCATTGTGTCTCTGTGCTACATTTTTACATTTTGTATTATCTG
TTGATAAATACAAACACCTACATTGGTTGTATATCCTGGGCATTGTGAATAATGCTGCGT
TAAACATGGGAGTGTGGATCTCTTTGACATACATATTTCCTTTGGATATACAGTATATCC
AGTAATAAGATGGCTCAATCATACGGCCATTCTATATTTATTTTGTATAAAACCTCCATA
CTGTTTTCCATAATGGTGGTACTAATTTACATCCCTTTTCCCTGAATGCATTCTCAACAG
CATTTGTTGTTTTTTCCTTTTTGATGATAACCATTCTAACTGGGATGGGATAATATCTCA
TCATGGTTTGGATTTGCATTTTCCTAATGATTGCTGATGGTGAGCACTTTTAAAAAATAC
TTGCCAGCCATATATCTTTTGAAAGATGTATATTCAGATCATGTGCCCTCTCCTCCACTT
TAAAATTTGCTAGAGAGGGCATGCACTTGCCAGAGAAACAAGAGTGAGACAGCAAGTTAG
AAATCACCCCCCTGGGGGATGGCCACACCAGAACCCCTTCTTCATTCTGTCGTGATTTTG
GGCATGCACTCACACATACCTGGCTTGTTATTGTTTATTAAGAGGTTTTTGCTATAGGGC
GTGTGCGCTCTCCAGAAAGAGACAGAAAGCGGAGAAATCACCCCCTGGGGGGATGGCCAC
ACCACAATCCCTTCTCTCTGGATGTTGGGCACGCACACACACGTGCTGGTGTGAGTTTAA
GCCACTGGATCTGCAACTCTGTCGACTATATGGGAGTTCAGCGACATAGCCATTACGCTA
ACTGCTGGTACCATGGCTTGCTTTTAAAGCACAGCTTGAAATGCATAGTCAGCCATGTAG
GATCCACCTGTCTTAATCATCATGCCTCCTAGCTGGCCCTACGTGCCCTTTTTTTTTAAA
AAAAATAAATCAGATTTTTAATTAATTTTTTTGCTGTTATATTGAATCCCTTATATATTC
TCTATTAATTCCTGTCAGGTGAACAGTTTACACATATTTTCTTCCATTCTGCAAGTAGTC
TCTTTGCTCTGTTGATCATTTCCTTTATTGTGAAGACGACTTCTAATTTAGTACAATTGT
ATTTGTCTATTTTTGCTTTTGTTGTCTATGCTTTTAAGGTCTTTTCCAAAAAACTCTTTG
TCTATACCAATGTCCTGAGTGTTTCTCCTATCTTCTAGGTGATAGTTTCAGGTCCTACAT
TTAACCTTTGACCCATTTTTATTTATTTATTTATTTTTTTTTGTGAGGTGAGAGAGAGGA
TCTAGTTAAAGGTAGGCGTTTACTTTCATTCTTCACCCTGTGGGTTAGCTACCTTTCTCA
ACATTTATTGAAGAGAATGTCCTTTTTTCAGTGTATGTTCTATTCCTTTGTTGAAAATCA
GTTAGCTGTAAGTATGTGGATTTATTTCTTGGTGCTCTGTTTCATTGTACTATGGTATTT
TTTCTTTAAGAATTATTTATTTGGTTTTATTTATTGTTATTTCAAAATTTCCTATAGGAT
ACATGTGAGAGAGAAAGTGATAAAGCAGGCTGCCAGACCTGGGACTTGAACCTTGGTCAG
CCATGTCCAGCACCCTAATGTCCATGTCACCTGCTGGCGTCTGTTGTTTTTAATGCCAGT
TCCATGCTGATTTAGTTATGCTAGCTTTGAAGTATGTAAGGCAGGTATTGTGATGTTTCC
AGCTTTTATTTTTTTGTTCAAAGTTGCTTTGGCTATTTAGGATCTTTTGTGATTCCATGT
TAATTTTTGGATTTTTTTTTTTTTCTATTCTGTAAAGAGTATCATTGGAATTTTGATAGA
GATTGAGTTGAGGCCTGGCCTGTGACCTTTTGGTTAAGGAAGCCAGATCCTACCTGTCGG
ACTGCATAGTTTTAATCCCAGCCTCCCTGGTTTGAAGTGTGCCCCAAACCTCAACAGGAT
GGAGAAATGAAGGAATTGTAGCTAGACCACAACCCATTGGGGGTTGCTTTCTCTCTTTGT
GTATAGCTCACATATACCTTCTGGAAAAATTTACAAAAAGAGAGATTGTGTTCAATCTGT
AGATTGTTTTGGGTAATATGGACATTTTAACAGTATTCTTTCAATCCATGAAAATGGGTG
TCTTGCCATTTTTTTGTGTGTCTTTAGTTTTTTCATCAGTGTTTTATAGTTTATAGTTTA
TGCATATGTAATATATATTACATATAGTTTATGTTTATATTATAGAGACATTTTGCATTC
TTGGTTAAATATATTCCCAAGGGTGTTTTTTTTTTTTTGTAGTTATTATAAATGGGATAG
TTTTCTTAATTTCTTAGCTAGTTAATTGATACAAAGAAAAGTTTTTGTATTCTGCAATTT
AAATTGTAAATCAGTTCTAAGAGTTTTTTTGGTAGAATCTTTATTTTTTTTTCTATAGAT
AAGATTATGTCATTTTCAAATAGGGGCGATTTGACTTTCTCCTTTTTATTTAGGATGTCT
TTTGTTTCTTTCTCTTGCCTAATTGTTCTGGCTATGATTTCCAGTACTATGTTGAAGTAG
AATGGGGAAAGTGGGCATCCTTGTCTCGTTCTAGATCATTGTGGAAAAGCATTGAGCTTT
TCCAGTTCCGTATGAGGGTAGCTGTGGATCTGACATACATGACCTTTGTTGTGTCAAGGT
GCCTTCTATCTGTAATTTCTTGAGGTTTTATCATGAAGGAATGTGAATTTCATCAGTACT
TTTTTTTGTATCTGCTGAGACAGTCATGGTTTTTGTCCATCTTATTAATGTGATGTATTG
CATCTATGAATTTGCATTTATTTAGACCATCCTTGCATACCTCAGATAAATCCTACTTAA
TCATGGTGTGTAATTTTGGGGTGTGTGTGCATGTGCTATTGGAATTAGTGTTTTGTTGAG
GACTTTTGCATCTGTGTTCATCATGGATATTGATCTGTAGTTTTTTTATTTTTTTAAAGA
GTTATTTAATTTGTTATTATTATTTTTTATTTTGTTATAGGATACATACACTCACCAGAG
AAAAAGAAAGCAAGAAGGCAAGCTGCCATGTCAGAGACTTGAACTGTATGTAGTTGGTCA
TGTAGGAATCCAGCTCCTTAACCATCACGCCACCTACTGTTCTCCAGTCTTTTCTTTTTT
TGTTGTGTCTTTGTCTGATTTGGATCTGAGAGTAATAATGCTGGCCTTATAGGATGAGTT
TGAAAGAGTTCCTTCTTTTTTCTTTTATTTTACTTATTTTAATTTGATCAGAGAGGGGCA
GAGTAAGAGAGAAAGCGAGAGAGAGTGAGAAAGCAAGCCGCCAGGTCTGGGACTCTAGTG
CAGTCGGCCTTGTGAGTGTGCCCTTAACCACCACACCACTTGCCGGCCCCAAGTTTCCTC
TTTTTCAGTTTGTTGGAAGTTTATAAAGAATCAGTGTTAATTCTTCTTTACATGTTTTAT
AGATTTTAGCAGCGAGACCCTCAGGTGCTGGACTGTTCTTTGATAGGCTTTATTACTGCT
TCAATCTTGTTAATAGTAATCTGTTTAGACTTTCTGTTTCTTAATTCAATTGTGATAGTT
TGTATGTTTCTAGGAATTCATTATCCATTTCTTTTAGGTTTTCCAATTTGTTCATGGTAG
TTTCTTAGAATCTTTTCTATTTCCGTGGTATTTTTTGTAATGTCTCATTTTTCATCTCTG
ATTTTATTTATTTGGGTCTTTTTCTTAGTTTAGCTACAGGTTTATCAAGTTTATTTATGT
CTTCAAAGAACCTCTTTTTTGGGGTTTTTTTTGTATTATGTTTTTTTAGTCTTAATTTTG
TTTATGGTGTTCTGATCTTCATTTCTTTCTTTCTGCTAATTTTGGGTTTAGTTCTTGCTT
TTCTAGTTCATTGAGGTACATTTGAAGTCTTTTTACTATTTTTTGTTTTTTTAATGTTTT
TGTGGGTGCCTGTGCTTGTCAGAGAGACAGAGGGAAAGTGAGAAATCACCTCTCAGGAGG
GATGACCACACTGCATTCCCATCTTCTCCATTCTTCTCTCGGGATTTTGGGCATGCACAC
ATGCATGCAGACACACATGGTATGATTTTCAAGCCACTGGGTCTGACCCTCAAACAGCGG
TCAGCCATTTGGGAAACTAGCATCTTAACCACCATGTCACCTGCTGGCCCCTCTTTTTTG
ATGTAGGTATTTATTGTTACTAATTTCCTTTTTAGTACTGATTTTGCTGTAGCCCATTGT
TTTCATTTTGAGAGGCTTGTTTTGTGGTTTAACCATATGGTCTGTTTTGGAGAATGTTTC
ATGTGCTGCTGGGAAGAATGTGTATTTTGCAGCTTTTGGGTGAGATGATTTTTAGGTTAT
TTAGGTTCATTAGGTCTGTAGTTAAATTTGATTTTTTTTTTTTGTTGATTTTTTTTCTGT
CTGGATCATCTGTCCACTTTAGAAGGTAGGGTGTTGAAGTCCTCAACTATTACTGAATCA
GAGTCTTATTTTTTTTACTTTATTTTAGAGCTAATAATTGCTTTAATTTGAGTGCCTGTG
TGTGTGTGTAAAGATATGTGTGCGTGTGCACGTGCTCATAGAATGACTTTCCTGTCTCTT
TAACGGTTTTTGAATTAGGTCTATTTTATTTGATATACATAGTTACTTATGTACATCTTT
GGTTTTTCTTTTCATGGAGTGTCTATCTGTTTACTTTTCACTTTTATCATCGCTAATAGT
CTTAATCAAACAGTATAATTAAGTGCTTACATATATTTACAAATGTCTTACTCCTTGAGC
TTTACATATTTCTTGAGATAATACACAGTATGTTTCTTTAAATACATAATTTCTATTTTT
TATTATAAAACTTAACTATTTTTAGTTACATAATTTTATATTTTTTAATTTAGAATCAAC
TTTTAAGTTGTCCGTGACTGACCTCTATAAAACCTTCTGTTTTGTTCTTTATCATTTATA
GGACTGAGTGGACGGTTTATCATAACTGCTCTTCCTACTATTTATCAGTAAGTATTTGAA
GATTCTCACTTACAGAGAAAGATGGATTAAAGTGTAAACTGAGTAATAGGCTTCTGGCTT
GGATGGTGTTTGAAGAGCTGAGGTTTGGCTGTTAGTGCTACCCATGGTGCCTTTAAATAG
ATTAGTGAAGCGTGAAACATTCTCTGTTCTCGAAGATTCTCAGTGTTGTGAAAGATGCTG
TTCATGTGAAAAGATGAAGTCCTCTTCAGCATAGTAAATGATTATTGACCCAGAGTGGTG
GTGGATCCCATAGGAAGTTGGGTGAAGGAGAGAAATCGTTGTGAGATGGGGTGCTTCCCG
GAAAATATGAAGTTTAAATGAAACTTTGAAGATAGAATTTTCCACAGTGCTGGGTCAGCA
TTCCATTCTGAGGACAGTTTTATAAACAGTCATTTGTAGGATCCTGTTATGGTAAAGTAG
CTAAGGAAGTGCTGTGGCACAGACTTGGTAGGGGAAGAATAGTGTGCGGTGTTTGGGCTT
GAATCCAAATGAGTCCAAATGAATGAGATTAAGATTATATAGTCTTCAGTATCAGGTCTT
TTAGTTTGACTCTGTCTTCTAAAGTAGGGGTAGGAAATTTCAAATCTTGTACCTATTAAA
CAAGGAGGTACTTTTCTCCTCCCTTTGCATCTGTATCTTGCTTTCTTTTGTCCCTTTCTT
TCCATGATTTTTTTTTTTAAATCATTCCTTTATATTTATTTAAATTTCTATTCTCTATCT
CTAGGAGTGCTTCTCTCCCTCCCTTTTTACTTGGTCTTTTTTCCTACCTACCCCTTAACT
GGCTGGAATTTGTCTCTCCTTTTCACTTGTCAGCCCCCTCCCTCCCCCTCCTTACCTATA
ATTTCCTTTTCTTTCTTTTTTTCTTTTGGAGAGATTTTGGCTATAGGGCACGTGTGCTTG
CCAGAAAGACAGAAAGAGAGAGAGAGATACAGAAAGCAACAAGTCACCCCCCTCCCAGGG
GGTGGGGGATGGCACGCTGCAATCCCTTCTCCGTTCTCCTCTTTGGGATCTTGGGCACAC
ACGTACATGCACCTGGCATGAGTTCAAGTCAAAGGTCGGGGACTCGAACTGTGGTCGACA
AAATGGAAGTCCAGGCAACATAGCCATTACATTTGGGGGGCCCTCCTCTTCTTTCATCCA
GTATTTACCCATGCCCTTCCACTAGATTCTGCTTATAAAACCTACTCATCCTTAAGAGAT
GACTCATGCACACTTCTTCTGAAAATTTGGCCTTTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNATGAAGGATCCTGTCACCCTTTAGGTAGTCAGGAGCTAGTGACGT
TTGCACCACAAGATGTGGAACTAGGAGAACGGTCACGACTGTTACAGGAACTCATCTACT
AGTGATAGGGAGGAGGAGGAGGTATAAGGAAGAGTGGAAAACTGACTAATATGATCACTG
AAATGGGAAGAACTGAAGCACTATGCCAGATGTCTTCAGAATTTAAAGCATGGTGACTGG
AATAATGTGATTATGATTGAAAGTACCAGAAAAATACCTTAAATTGGTTACTTGCAGTTT
AACAATAGCTAATAAGTAATATGAGCCAGGTATTGTTCTAATAACGTTTTATATACTAAT
TCCTATATTGTGTATGTTACACATAAGGCTTAAAAAGTTTTTCTGAGATTTGTCTACTTA
CTGTATTCCATAGTTTTATTATTTGGAAGAGCAACAATAACAAAATCTTAATTCTTATGA
TAGCTTTAAAATGTAACCTCATTGTTTATTTAAATTTGGGGCTTTGATGTCATTAGTAGG
CATTAGTATAATAGGCTACTTATATATAGCTAATGCTTTTGAATATTCAGATTGACTGTA
AAATGAGTCTAGAAATAGCAAAGTAAAAACAGTTTATTTCTCATTGCTGGCTAATATTTA
ATTCTGGTTCTCCCTAGTTGTAAAGATGGTGAATTTAGGCGCTATCAGGGTCCAAGGACC
AAGAAGGACTTCATTAATTTTATAAGCGAAAAAGAGTGGAAGACCGTTGAACCTGTTTCC
TCATGGTTTGGTCCAGGCTCTGTCCTGTAAGTATGAGAGACTTTGTCTTACCTATTTCAG
AATTCACTGGAAGACATCATGACATTCAGTGTGAAGAAAGCATTCATAGTTTGTTTCTTA
GGCTCATAAGATATATTAAATTTAGTATGTATTTGATGTTTTTAACTTGACTATCTTCTA
AGTTAAGCAGATACTTTTATGCTTGTTAAGTTAAAAAGAGACAACTATAGAATTCTTGAG
TGTCTCTTCAGGAATATTTGAGCTGTATAGATTTGGTCATATGTATCATTAAAAGCTAAG
TAATTCCCCTACGAGTGTGAGCAATGTAATGGGTAAAGGTATCACTTCAATCAGTTGAAT
GAGAAGGCTCAAACTTTTCCTACTCATGCTACCTTTAGGCTTCAGTTCTTAGTGTAAAGT
GGTAAAATTATGTTTGGTTGGTCTTATGGCTTGTATTAATAGTGTGGATCAGCAATAACC
CTAATTGTGTGACTAACCAGTGAGCTTTATAAATAGCTAGAAGATGAGTGAACTTCTCCC
TAGCAGTTTGCTGTGGAGCATAAGTGTTGGGAACGTCAAACATGGGTCTTTTTTACGCTG
TTGGGATGCAAAGCCTCACTAGTTGTTTGGAGACCTGGGAATGGCAAGTTGTGCCGAGGT
CATGCTGGACTCATCCCAGTGTGGTTACATCCCATGTAAGCCTTTTCCTTACATGGAGGC
TGAGGAGTTGGAATATCAACCATGTGAGGAGAGAAATGCTCTAGAATCTGGGTAAAGAGG
AAAGATGAGCCTAAGGCAGTTATTTGGAAGTAGAAGTTCATCTGTAGCATCTTTTCCTTG
CATACCTCCCTTCCTGAGAAAACCTCTGAATTGTCTGTCAGAACTCACCAGCTGAACCTC
TACGCCCAACCCAGTTAGAGAACCTAGTATTCCTGAAATCATCTAATTCATGGGGACTAT
AGTGAGATGTCCCGACCCGGGGGGACAGCCGAACGGGTTTCTTGAGTGAAGGAGTGAGAG
CCAGGGCAAGCAGCGTAGTGTTACAGCACGGAGACGACAGTGTCGTCTGTTTATTGTGGG
CAGCACGGTACAGCACAGAGACGACGCAGTGTCACAGTTCTTAAGGGTTGCATCGTCTAC
TGTGAGCAGCACAGAGACGACGTGGTATCACAGCTCTTCAGGGTCTCCCAGTTTGTCTGG
AGACGATGCAGTGTCAGCTCTTCAGGATCTTCAGGGTCGTCTGGAGACTGCGCAGTGTTT
CAGCTCTTCAGGCTCTTCAGTTGTCGTCTTCCTAGTCGTCTTCCTAGTCGTCGTCGTCGT
CGTCTCGGTCATCGTCGTCGTCTGTCTACTGTGGGCCAGGCATCGTGGTTATATACACTC
TGGTGGGTTGTAAACGGTGGGCCCTGATTGGTTGTTAACGGTGGGCCCTGATTGGTTGTT
AACGGTGGCTTATGATTGGTTGCTTTTGGACCAATCATGAGGTGCCGGATATGCAAATTT
GAGGGATTCTAGTGGCCAATCAGAGCAAGGTTTCGAAGGTCAGGTTTTTGGAAGGGAACC
AATCATGGTAATTGTTTGCTCTCTGAGAAACTTCAGCAGACTCGCTGGTGCGCAGCCTCC
CACAGTGAGACAGCTTTCTAAACAGCATAATCAGTGTAACTGAAAAATACCCTCCTGTGT
TGAACTAAAAATGTAACTGGTTTTTGTTCTTTGAAGTCTAATGTCATAAATGGATCTTAC
CTTTGTTAGTAGGAGATAGTTCCATGTCTGGTGATTCTCAGGGCAGCAGTTTATGTAAAG
AGCACTCACAGTTAGCTTTGCAAGATTCCTTTCTCCAGGTTTCCTTGCGTTAGTTCTCAA
TGAAGTCAAAACTCCAGAAAGGAAATCAGTGAAGTTTGAGTTATTTGCAGTTAGTCAGCC
CATCCTACTTTGCTTTTGGCTTCTCTGTGTAAAAAAGCCCTTGGCAATACGAGCAACACA
ACACCTCTTACTAAAGAGAAAATGATTGAGAACCCACCAACTTTAACTTTTGAAGCATCC
CTTTTTTCCAATGGCCTATCAAAGTGCCTTGATATAATTGTGAAATAATTATTTTAATTA
TTATAATCTAGCTTTTATTTCTTGTATATTTTGTATATCATTGCAAGATACCAAACTAAT
GTCATTGCAAATTTTAGTAAGTTTTTTTTTGGAGAGGTTTTTGCTCTAGGGTACGTGCGT
GCGCTCGCCAGAAAGAGAGAAAGCGAGAAATCACTCCCCAGGGGGGATGGCCACACTGCA
ATCCCTTCTTTCCTCCATTCTCCTCTTGAGATCCTGGTCACGCATGCACACGCGCCTGGT
GTGAGTTTAAGCCGCCAGGTCCGGGACTCAAACCGCAGTCGACTACGTGGGAGTCCAGCG
ACATAGCCATTACGCTAACTGCTGGTCCCTCTATTTATTTTTTAAAAGAGATTTTTGCCA
TAGGTGTGTGCACTCGCTAGAGATAGAAAGTGAAAAGTAATTCCTGCATGGGGTATGGCC
ATACCACAGTCCCTTCATTCTACTCTCAGGATTTTGGGCATGCGCACTCATGTACCCGGC
ATGAATTTTAAGCTACTACTTCCAGTATGTGAACTGGTCAACTTCTTGGGAGTCCAGTGC
CGGAACAATTATGCCATCTGCTGACCCTGACAATCTAGTAGTTTTAACAAAACAAGGGTT
ATTAAAGGGAAGAATCAGTTCAACAAGTGCTCCTATTTCTTCCCTTAGGCCCCTTTCTTT
GCTTATTTGCAGATTTAGGTGCAGTTAGAGTTGCTTTTCAACTGGTTTGTAGAGCTAAGT
CCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTC
TGCTTTCAGGGCTGTTGCTGGGACTGTAAGTACTTCATTTTGAGTTCTAGGGAGAAACTG
TTTTAAAGTGTGATATTTTCACGTGGTTGTGCTAGCTGAATCATATTGTGCATTCAGATG
TCTTACGTTTGTTTTTGCAGTGTATGATATTTGTGGCAGATTGCCTTTGTCCTTCAAAAA
GGCGCCGACCACAGCCATACCCTTCAAGTAAGTACATTATAACAACTTTACTTTTTATTC
TCCATAACCCCATTTATTTCTATAAACACAATCCTGTTTTTTCACAGGTTGCCCTTTTAG
TTTAGGTTTCTTTTTTCTTTTACGAGTTTTTTTGTTATAGGGTATGTGTACTTGCTAGAG
AGGCAGAAAGCAAGGTATCGTCCCCTAGGGGATGGCAGTCCCTTCTCTTGGGATCTTGGG
CAGACATGCACTTGTGCCTGAAGTGAGTTTCAAGCCACTAGGTCTGGGACTCAAACCACT
TTCGGCGATATGGAAGTCCAGTGACGTAACCATTTTGCCATTTGCTGGTCCTTAATTTAG
TTTCTTAAATGTGGTCTATATCAGCTTTAGCATAAGGGGGAAGGGGGCAGGAGATATATA
TTTTTCATGCGATAATGGTAATCCGGTGGATTTTAGGATGTTATTTTCTTATGTACTAGG
TTGTTGGGAAAGTCATGTATTTTTCTGTTTTTCTATGTAAAAATGCACAGAAATCTCAAT
AGCCTAATAATATGGTGAGTTTTAACATTTGCATGGAACTCTTAGATAGTAATAATGTTG
ATCTTAAAGACTTATTTGAAAATTTTATTTTATTCATGAATTTATTTGGGTATACCTGAG
TTGAGTTTTTTAAACATGGGGATCAGCAGGTGGCATTGTGGCTAAAGGCGCTTCATTCCC
ACCTGGCTCACTGTGGTTCAAGTCCTGGACCCAGTGGCTTGAAAATCCTGTCACATAATA
CTTACATGCCCAAAATCTGAGAGGAGGGATTACGTACGCATGGCCATCCCTCATAGGGGA
GTGATTTCTCACTTTTCCTCTCTGTTCATCTCTAGGGAGTCCATGCATTCTGTGGCAAAA
ACTTAAAAAAAATAAAAAGAAAAAGAAAAAGGTGAATATGTTCCACTCTTGAAATCATTC
ATTAGATTGTGACCACATGTGAAGGTATTTACTTTTTGCATGCTGGCCAATTCCAAGTTT
TTTTTCTGGTCAGCTACTGGGGAGAGCAATTCCTGTAGTTAATTACCTAACCAGCCATTT
ATTTTTAATCTTGAAAATTGTACTGTTATTGGAAGCCCTGATATTTATGGTATATAAATT
GAAAGGGCAACCTTCTACTTCTCTTATCCCATTTGCTTTTCAGCAGCACTGTAGTAGACT
GCAGAGAATACTGCTCACGTTTTGTAGTTGAGAGAACTTAAGATTTAGAGAGATGAAACA
TGTTTTCACAGTCGCACAGAAATGACAGCTATGTGTAGACCAAGATCAGACTGGCTGGGT
ATTTTTTTTATTATGCTGCTTTCCATGGGTTAGGATTTATTGAGGTCAAAACTCCTTACC
TAAAATTAGTGGAGTTTACATTTACCATGTCCCTTGAATAACTGATAGGTCACTTTTCAT
TTCCTAGGTAGTTTTATTGATACTGAAAAGGACATGTGTCATTTAGGGAGGTAATCATTT
TATACACTGAGGCTACTGACCTTTTGGCAAAAAAGACAAGCACAAATTATTTAAAAGACC
AATTTATTGTTAGGTGTAAGGTTTTTAAAGTGAAATCAATATAAAGTATTTATTACCAAC
TTTTAAATTGTGACTAAAATGTAAGATTTGATTTAGTAAACACAAACGATAAATACACAA
AAACATCTATATTATGTTTGGTTTTCTTGATTATTCTTTTTCTACACTCACTTAAGTCCT
ACAGCTGTCATAAAATCTGTGGTCAGTGTACAATTTACCTTGGATCCCGTAAATGTACTG
GAGTTTGTACTAAGTCATGTGATATGTGGACAGAATCATTGCCACTCTTCCCAGATTCTC
TTCTCATTTCTGTCAGTTATCTACCAAAATTTTACTTTGGAAGTCGGTATAAATAGATTT
TTCTGAGGATGAAGTGTTGGAATCTATCTTAACTCTTAGAACAAACTTATAGTATCAGAC
TCATCTGGAGAACTTGTTGAACAGTTTACTGATATCCAGCCCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTGACATTAGTCAGCACTC
AGTAAATATTCACTGTGTATATGATTATGTAGTTTATATTCCTTTAGTGACACAACTGAT
AGATATTAATCCAGACTTTAATGTGATATTGCCCCTTCTATAGCAGACATGATTTATTTT
GGTTGCTTAGATTTTGAATTGCCAGAGAAAGAAACCAAACCCAGTTCATTCTACCTTTCA
GCAGAATAGGAATTTATTGGTGTCTATGTCAAGTTTAAGGTCAGAGTTTACTAGATTCTT
GGGACCTATATATTAAGATGCTATGTGTTTTTGAGTTGCTCAGTTCTCGTACTTTTACTT
GTTCCTTTAGCTTGGTTCTTTCTAGTCAGTAGCATAAGATGACTATAGAAAGCCATAGTT
ACAATCCTGGAGTAAAAAGGCAATCTCTTTTCTTCCAATACTCAACCTGTCTTTGGAGAA
ATTCTGATAAATGAATGCACTTGTAAGAAGAGTCACTGTAAACTGGGGTTTCTCAAACAC
ATTAACATTAATGGCACTTCTGGCTGGATAATTCTTAATTGAAGTGGACTGTCTTTTGTT
GAATGTCATTGAATATTCAGCAGTATCCAGCTAAGTTCCAGTAGTATTCCCTCCCCCCCG
AAGTGTGATAACCAAAAATGTCTCTAGATACTGCTTAATATTCATTGAGAGTCAAAATCA
CCCTTGGAGAAACATTCCATTCACTAGAACCACATGGGCTATAGCTTAGGGAAGGGGCTG
TAAAGCCACCAGAAAGAGGGCTGCCAGGAAGATCAAACAAATATTATCTACTACCGGACA
CGAATTCCTATAGTTTACTTTAAGCTCCCCTCTACCCCCATTGTGGACTGCCTCGGATTA
GGGAATTTATTCTCTTCACTGAACAGAATTAAGCTCTTTGGCCTGATTCTGTTTTCTGTG
TCTTGTGTCTCAGTGACATGGTGTGTTCTAAACTTAATTAGTAACTGGCCCTATAAAAAC
AGAAGTGGGGCCTATTCCATGGACTAGTTATCAAAGAAGCTCATCCCACATGCCAACTGT
GATCCAAATCCTGTCCCAGCAACTTAAAAACATGCCATACACTTGTGTGTGCATACCCTA
AACAAATCGTGACAGAATGGAGAAATGGAGATGGCTTCGTTAGGGAATGCATACCACCTG
CCATGTTTTTCTCTGGTGAGTTCATAACCCACTGGCAAATTAAAAATTATATATAATGAT
AATAATGGACGAACAGATGGTGTAATGGTTACATCACTGGACTCCCACATAGTTGAGTAT
AATTCGAGTCTTGGACTCAGCAGCTTAAAAACTCATGTGGAGCATGAGAGGAGATTGGAA
GAGAAGGGATTAGAGATTGGAGGAGAAGGGATTGTGATGTGGCCATTCCCCCCCAGTTTA
ATGCTCAATTGATTTTGATTCTCAATGAGTATTTAGCAATATCCAGAGACATTTTTGGTT
GTCACACTTCAGGGGGGCAGAGCTACTGGAAACTGGCTGGGTGCTGTTGAACATTCAACC
AAAGACAAACCACTTGCTTTCTTTCTCTGGAGAGTGCACATGCCCTATAGCAAAAAATCT
CTTAAAAAAATAGGATATTTATGTGTGTACATATTTAAATACTTACTGAGCTACATAATT
ATGACTTATACAGATTATTGTTTAATTATACCTTAATAAAGCTGGATAGATAGGGATCAG
GAAGGAGCACATTTGTGGAACCAAAAAAAAAAAAAATAGGAATATCATGTTCAAGTGTCA
ATTTGTGATTCCTGTTCCTCTGGTGAGTACTGAAACAAGGGTAGTAGTGAAAATTTAGTA
TGATTGTTCAAAAAAATTACTAACGAATTCTTAAAAGATGGTTGTATTTAATACGGCATG
TTTTCTTACAACTTTGTATTCATAGTATCAATGTTGATTCATTTTATTCAGTTCATAAAT
AGGTGGCTAACTATAATGAATGCGGTAAATAAAATGGACCTTCTAAACTAACTATTGTTT
TTATAGTACCTATTTCTTTTTATCTTATTAAGTTTGAGAGATCTAAATAAGTGCAAAGCA
GTTTATTGACATACGGATCATTACACTATTTTTATTTGATTCTAAAGCAAATCTAATACA
TCAACAAAAAATCAATTCTTGTCCTTGTCTTTAAGAAAAATTATTACCAGAATCTTATTC
TCAACCTCTGAAAAGAGTGGAAGAGGAACAAGAGGCTGATGAGGAAGATGTTTCAGAAGA
TGAGGCTGAAAGTAAAAACAAGATGAAGACAGACTCTTCCCAGAATGCAATAAGACAGCG
CTCTGTGGGTCCATCACTGGCTACAGATAAATCCTAGTTCGTTCTGTGGATATCTCAATA
TCATTTTGACAAAAACTGAAACTTGGTCTTTTTTTTTTTTTTTTTTTTTTAATTTGAAGT
GAACTGTGACTTGCTTATTAATTGTAGGGTTCAGTCTAGATTGTCACTAGATTGAACAAT
CTGTGTTAAGAAATTAAAAACATTAGGTATAACAGTTTGAAATGTGATTTGAGAACAGTA
CGATGGTTTAAACAGTTCTTTCATTTTTGAAAAATCTGGTGCCAAGCAATAAGATTTGTG
TGTGTGCTTGATAATAATCTGTTTCAAGTTTGAGCTGAGAAATTAATTTCCTAAGTATTG
CATTATTGGGGTATTTAAGATTAGAGAAAAATTTTATTTAATACAATTTTTCTAGGTTTC
ACTATGTGAAAAAAAGATCATATTCCCATAAATGGGAACTTTGCCCATTATCTCAAGAAA
TGTGTCTATGTTCTTTCTAGCATATAGTCTAAAATTTCTTCATATTTTAGATTATGCAAC
TAATAGAAACTACCTTTAATTACAATTTTCTACACATGATATGATAATACAGGACATTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1152, 4013..4128, 10741..10786, 12797..12925, 15900..15945, 16124..16222, 16340..16406, 20675..20856
1001..1152, 4013..4128, 10741..10786, 12797..12925, 15900..15945, 16124..16222, 16340..16406, 20675..20853
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved